ID: 906724685

View in Genome Browser
Species Human (GRCh38)
Location 1:48035693-48035715
Sequence TCCTCTCCTTGTGTAAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906724683_906724685 18 Left 906724683 1:48035652-48035674 CCTCTCTTGTTTTCTATTTTCTC No data
Right 906724685 1:48035693-48035715 TCCTCTCCTTGTGTAAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906724685 Original CRISPR TCCTCTCCTTGTGTAAAAGA GGG Intergenic
No off target data available for this crispr