ID: 906727614

View in Genome Browser
Species Human (GRCh38)
Location 1:48055361-48055383
Sequence TACCAGATGCTGCTTCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906727614_906727617 4 Left 906727614 1:48055361-48055383 CCAGTCAGAAGCAGCATCTGGTA No data
Right 906727617 1:48055388-48055410 TCCCAGGCTGGACATGAGCTTGG No data
906727614_906727616 -8 Left 906727614 1:48055361-48055383 CCAGTCAGAAGCAGCATCTGGTA No data
Right 906727616 1:48055376-48055398 ATCTGGTATCTCTCCCAGGCTGG No data
906727614_906727621 13 Left 906727614 1:48055361-48055383 CCAGTCAGAAGCAGCATCTGGTA No data
Right 906727621 1:48055397-48055419 GGACATGAGCTTGGAATCCAGGG No data
906727614_906727620 12 Left 906727614 1:48055361-48055383 CCAGTCAGAAGCAGCATCTGGTA No data
Right 906727620 1:48055396-48055418 TGGACATGAGCTTGGAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906727614 Original CRISPR TACCAGATGCTGCTTCTGAC TGG (reversed) Intergenic
No off target data available for this crispr