ID: 906730077

View in Genome Browser
Species Human (GRCh38)
Location 1:48073446-48073468
Sequence CATTCCAGGAATGAGTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906730077_906730081 18 Left 906730077 1:48073446-48073468 CCTCAAAACTCATTCCTGGAATG No data
Right 906730081 1:48073487-48073509 TCTGCCCACCATATTGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906730077 Original CRISPR CATTCCAGGAATGAGTTTTG AGG (reversed) Intergenic
No off target data available for this crispr