ID: 906734397

View in Genome Browser
Species Human (GRCh38)
Location 1:48110687-48110709
Sequence CTGGTTCCTTCTCTTTGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906734397_906734399 5 Left 906734397 1:48110687-48110709 CCTGAACAAAGAGAAGGAACCAG No data
Right 906734399 1:48110715-48110737 TATTGATATTTGCAATTCCAAGG No data
906734397_906734400 21 Left 906734397 1:48110687-48110709 CCTGAACAAAGAGAAGGAACCAG No data
Right 906734400 1:48110731-48110753 TCCAAGGAAACTACAGTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906734397 Original CRISPR CTGGTTCCTTCTCTTTGTTC AGG (reversed) Intergenic
No off target data available for this crispr