ID: 906746949

View in Genome Browser
Species Human (GRCh38)
Location 1:48228727-48228749
Sequence ATGCAGTGCCTGGCATACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 608
Summary {0: 1, 1: 2, 2: 15, 3: 86, 4: 504}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906746947_906746949 12 Left 906746947 1:48228692-48228714 CCTGCGGATATCTGTGGAATTAA 0: 1
1: 0
2: 0
3: 3
4: 81
Right 906746949 1:48228727-48228749 ATGCAGTGCCTGGCATACAGTGG 0: 1
1: 2
2: 15
3: 86
4: 504
906746944_906746949 17 Left 906746944 1:48228687-48228709 CCCTCCCTGCGGATATCTGTGGA 0: 1
1: 0
2: 0
3: 14
4: 119
Right 906746949 1:48228727-48228749 ATGCAGTGCCTGGCATACAGTGG 0: 1
1: 2
2: 15
3: 86
4: 504
906746945_906746949 16 Left 906746945 1:48228688-48228710 CCTCCCTGCGGATATCTGTGGAA 0: 1
1: 0
2: 0
3: 23
4: 338
Right 906746949 1:48228727-48228749 ATGCAGTGCCTGGCATACAGTGG 0: 1
1: 2
2: 15
3: 86
4: 504
906746946_906746949 13 Left 906746946 1:48228691-48228713 CCCTGCGGATATCTGTGGAATTA 0: 1
1: 0
2: 0
3: 10
4: 101
Right 906746949 1:48228727-48228749 ATGCAGTGCCTGGCATACAGTGG 0: 1
1: 2
2: 15
3: 86
4: 504
906746942_906746949 18 Left 906746942 1:48228686-48228708 CCCCTCCCTGCGGATATCTGTGG 0: 1
1: 0
2: 0
3: 12
4: 110
Right 906746949 1:48228727-48228749 ATGCAGTGCCTGGCATACAGTGG 0: 1
1: 2
2: 15
3: 86
4: 504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906746949 Original CRISPR ATGCAGTGCCTGGCATACAG TGG Intronic
900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG + Intronic
901067398 1:6500764-6500786 AGGCAGTGTCTGGCATGCAGTGG - Intronic
901663207 1:10811938-10811960 ACACAGTGCCTGGCACATAGTGG + Intergenic
902375828 1:16029540-16029562 GCACAGTGCCAGGCATACAGTGG + Intronic
902471435 1:16649438-16649460 ATGGAGAGCCAGGCCTACAGCGG + Intergenic
902487375 1:16758007-16758029 ATGGAGAGCCAGGCCTACAGCGG - Intronic
902551225 1:17220787-17220809 GTGCAGTGCCTGGCACAGAGAGG + Intronic
902737011 1:18407951-18407973 AGGCAGCACCTGGCATACAGAGG - Intergenic
902776278 1:18676802-18676824 GGACAGTGCCAGGCATACAGCGG - Intronic
903022547 1:20404290-20404312 AAACAGTGCCTGGCACATAGTGG - Intergenic
903762875 1:25711614-25711636 GAGCAGGGCCTGGCACACAGTGG - Intronic
904141748 1:28358867-28358889 AGACAGTGCCTGGCATGGAGTGG - Intergenic
904207075 1:28862420-28862442 CTGCAATGACTGGCATTCAGTGG + Intronic
904473539 1:30750401-30750423 ATGCAGAGCCCGTGATACAGAGG - Intronic
905196222 1:36279937-36279959 GAGCAGTGTCTGGCATACAAGGG - Intronic
905541356 1:38763014-38763036 ACACAGGGCCTGGCATAAAGTGG + Intergenic
905801204 1:40844186-40844208 AGGCAGGGTCTGGCATATAGCGG - Intergenic
906536806 1:46555270-46555292 ATGCAGTCCCTGGCCCAGAGGGG - Intergenic
906691601 1:47796379-47796401 ATGGAGAGCCTGGCATGAAGAGG + Intronic
906746949 1:48228727-48228749 ATGCAGTGCCTGGCATACAGTGG + Intronic
907376638 1:54049407-54049429 ATACAGTGCCTGGCACATTGTGG - Intronic
907491061 1:54809058-54809080 TTGCAGTGCCTGGCACACATAGG + Intronic
907824902 1:58006152-58006174 GTTCAGTGCCTGGCATCCAGAGG + Intronic
908286699 1:62612114-62612136 ATGCCCTGTCTGGAATACAGTGG - Intronic
908472520 1:64457963-64457985 CCGCAGTACCTGGCATATAGTGG + Intergenic
908754179 1:67452889-67452911 ACACAGTGCCTGGCATATACTGG - Intergenic
909620481 1:77661696-77661718 ATGGAATGTCTGGCATAAAGTGG + Intronic
910424959 1:87112463-87112485 GTGCAGTGCCTGGCAAACAGTGG - Intronic
910436193 1:87208564-87208586 ATACAGTGCCTGGCACACACCGG + Intergenic
910634502 1:89392234-89392256 ATGCAGTGCCTGGCATTTAGTGG - Intergenic
910789610 1:91037560-91037582 GTACAGTGCCAGGCACACAGGGG - Intergenic
912518635 1:110230853-110230875 TGGCAGTGCCTGGTATGCAGGGG - Intronic
912692105 1:111812296-111812318 ATGCAGGGTGTGGCACACAGAGG - Intronic
912718612 1:112001332-112001354 TTGCTGTGCCTGGCATATGGTGG + Intergenic
912719810 1:112010683-112010705 AAGCAGTGACTGGCATACAGTGG - Intergenic
915330332 1:155107752-155107774 TGCCAGTGCCTGGCACACAGTGG - Intergenic
915533527 1:156518726-156518748 GGGCAGTGTCTGGCACACAGAGG + Intergenic
916715994 1:167447025-167447047 ACAAAGTGCCTGGCACACAGTGG + Intronic
917058773 1:171013725-171013747 GTGCAGTGCCTGGCCTGTAGTGG + Intronic
917143299 1:171859580-171859602 AGACAGTGCCTGGCACACAGTGG - Intronic
917819997 1:178753094-178753116 ATTCAGTGCCTCGTATTCAGTGG - Intronic
918093462 1:181316617-181316639 GGGCAGAGCCTGGCACACAGTGG - Intergenic
918118463 1:181517021-181517043 ACACAGTACCTGGCACACAGTGG - Intronic
918286930 1:183065998-183066020 CTGAAGTGACTGGCATATAGTGG + Intronic
919102440 1:193111095-193111117 CTACAGTGCCTGGCATATGGTGG - Intergenic
919777400 1:201203187-201203209 AAACAGTGCCTGGCACACAGTGG + Intronic
920119301 1:203643727-203643749 ATGCAGTGACTTGCAGACAAGGG + Intronic
920286308 1:204882275-204882297 ATGCAGTGCCTTGTATACCATGG - Intronic
920447631 1:206031233-206031255 GAGCAGTGCATGGCATAAAGTGG - Intergenic
920673620 1:208023803-208023825 GAGCAGTGGCTGGCAGACAGTGG + Exonic
921315336 1:213885125-213885147 GCTCAGTGCCTGGCACACAGTGG - Intergenic
921365280 1:214367890-214367912 ATCCAGTGCCTGGCACGTAGTGG + Intronic
923203885 1:231739470-231739492 ATGCAGGGGCTGCCACACAGAGG - Intronic
923530783 1:234810492-234810514 TGCCAGTGCCTGGCATATAGGGG - Intergenic
924048824 1:240060117-240060139 ACGCAGTGCCTGGCGCATAGTGG - Intronic
924691295 1:246353802-246353824 ATACAGTGCCTGGCACACAGTGG + Intronic
1063022371 10:2142449-2142471 ATGCAGGGCCTGGCAGACCAGGG + Intergenic
1063158028 10:3397820-3397842 CTGCAGTGCCTGGCATGTTGGGG - Intergenic
1063636824 10:7789642-7789664 GGACAGTGCCTGGCATGCAGTGG + Intronic
1063980033 10:11445383-11445405 GCACAGTGCCTGGCATACAGGGG + Intergenic
1064471225 10:15638000-15638022 ATGCAGTGGCTGGCATGCTTTGG + Intronic
1064519736 10:16188453-16188475 ATGCAGTCCCTGGCAAAAATAGG + Intergenic
1065660886 10:28003268-28003290 ATGGAGTGCCTGGCACAAAATGG - Intergenic
1066046466 10:31599755-31599777 ATGCAGTGACTGTCAGACACTGG - Intergenic
1067148904 10:43713448-43713470 CTCCAGTGCCTGGCACACAGAGG + Intergenic
1067659334 10:48222648-48222670 ATGAAGTGACTGGCATAGAGTGG - Intronic
1067764503 10:49075011-49075033 ATGAGGTGCCTGGCCCACAGCGG + Intronic
1067829535 10:49602465-49602487 TCCCAGTGCCTGGCAAACAGTGG - Intergenic
1068313625 10:55312463-55312485 ATACAGTGCATGGCATAATGTGG - Intronic
1068420199 10:56781183-56781205 ACTTAGTGCCTGGCACACAGCGG - Intergenic
1068716934 10:60199053-60199075 ATGCACAGCCTGGCAAGCAGAGG - Intronic
1069590749 10:69640283-69640305 ATGCAGTGCCTGGGGTGTAGCGG + Intergenic
1069908300 10:71745117-71745139 CTCCAGTGCCTGGCACATAGTGG - Intronic
1070121476 10:73581433-73581455 TTGCAGTGCCTCACATCCAGAGG + Intronic
1070323560 10:75372969-75372991 ATGCAGTGCCTCCCTTCCAGAGG + Intergenic
1070344063 10:75524508-75524530 ATACAGTGCCTGGCATACATAGG + Intronic
1070744801 10:78927317-78927339 GTGCAGTGCATGGCACACAGAGG + Intergenic
1072258071 10:93639925-93639947 ATCCAGTGCCTGGCACATGGTGG + Intronic
1072519897 10:96222093-96222115 ATACAGTGCCTCACACACAGAGG - Intronic
1073447905 10:103592081-103592103 ATGCCCTGCCTGCCACACAGAGG - Exonic
1073458959 10:103654528-103654550 ATGCAGGGCCTGACACACAGTGG - Intronic
1073489702 10:103844822-103844844 ATGCAATGCCTGGCACAAAATGG + Intronic
1073498611 10:103916868-103916890 GAACAGTGCCTGGCATATAGTGG - Intronic
1073559588 10:104485528-104485550 GATCAGTGCCTGGCATAAAGTGG + Intergenic
1073559738 10:104486645-104486667 GCTCAGTGCCTGGAATACAGTGG - Intergenic
1073889587 10:108084021-108084043 ATACAGTGCGTGGCAGACACAGG + Intergenic
1074234966 10:111576007-111576029 ATGCAGTGACTGGCATTTTGGGG - Intergenic
1074718271 10:116240753-116240775 ACACAGTGCTTGGCATAGAGTGG + Intronic
1075244041 10:120804643-120804665 GACCAGGGCCTGGCATACAGTGG - Intergenic
1075355094 10:121764918-121764940 ATGAAGTGTCTGGCATAAGGTGG + Intronic
1075933927 10:126323591-126323613 GTGCAGTGCTTGGCACAGAGTGG - Intronic
1076051073 10:127333591-127333613 ATGCAGTGCGTGGGCTCCAGAGG - Intronic
1076153514 10:128184663-128184685 ATCCAGTGCCTGGAGTACTGAGG - Intergenic
1077141682 11:1027580-1027602 CTGCAGTGCCCGGCAGGCAGGGG - Intronic
1077147736 11:1053482-1053504 AGGTGGTGCCTGGCATGCAGAGG - Intergenic
1077562593 11:3273336-3273358 CAGCAGTGCCCGGCTTACAGTGG + Intergenic
1077568486 11:3319155-3319177 CAGCAGTGCCCGGCTTACAGTGG + Intergenic
1077988257 11:7377189-7377211 GAACAGTGCCTGGCATAGAGTGG - Intronic
1078483345 11:11699658-11699680 TAGCAGTGCCTGACACACAGTGG - Intergenic
1078665874 11:13324723-13324745 AAACAGAGCCTGGCACACAGTGG + Intronic
1078710577 11:13787050-13787072 CTGGAGTGCCTGGTACACAGTGG - Intergenic
1078969597 11:16392338-16392360 GAACAGTGCCTGGCATATAGTGG - Intronic
1079391967 11:20029637-20029659 GCACAGTGCCTGGCACACAGGGG + Intronic
1080107657 11:28527464-28527486 ATACTGTGCCTGGCATGCAGGGG - Intergenic
1080129512 11:28777718-28777740 ATGCAGTGAATGTCAAACAGGGG - Intergenic
1080549360 11:33358310-33358332 GCACAGTGCCTGGCATATAGTGG + Intergenic
1081622270 11:44625616-44625638 CCACAGTGCCTGGCATAGAGTGG - Intergenic
1081659887 11:44881640-44881662 GAACAGTGCCTGGCATACAGCGG - Intronic
1081662753 11:44898070-44898092 GAGCAGTGCCTGGCACATAGTGG - Intronic
1083636848 11:64125402-64125424 GCACAGTGCCTGGCACACAGGGG + Intronic
1083856557 11:65396033-65396055 CTGCAGTGCCGGGCACACTGCGG + Intronic
1083945470 11:65920467-65920489 GGCCAGGGCCTGGCATACAGTGG + Intronic
1083965155 11:66039298-66039320 GTACAGGGCCTGGCACACAGAGG - Intergenic
1084408554 11:68992812-68992834 AATCAGGGGCTGGCATACAGTGG + Intergenic
1084433083 11:69122347-69122369 ACCCAGTGCCTGGCACACAGCGG + Intergenic
1085030989 11:73270780-73270802 AGGCAGAGCCTGGCACAGAGTGG + Intronic
1085215105 11:74822881-74822903 ACACAGTGCCTGGCATACAGTGG - Intronic
1085294788 11:75425324-75425346 ATTCTGCGCCTGGCACACAGTGG + Intronic
1085300037 11:75452583-75452605 ACGCAGTGCCTGGCACACACAGG + Intronic
1085333257 11:75669757-75669779 CGGCAGTGCCTGGCCTGCAGGGG + Intergenic
1085426471 11:76409087-76409109 GCACAGTGCCTGGCATGCAGCGG - Intronic
1085957204 11:81413927-81413949 TTACAGTGCCTGGCACAGAGAGG - Intergenic
1086182666 11:83972811-83972833 ATCCTGTGCCTGGCACAGAGTGG - Intronic
1086462331 11:87018234-87018256 CTGCAGGGCCTGGCTGACAGTGG + Intergenic
1088001227 11:104883496-104883518 TTGCACTGCCTGCCACACAGTGG - Intergenic
1088796619 11:113271030-113271052 ATACAGTGCCTGGCATGTGGTGG - Intronic
1089481044 11:118805323-118805345 GTACAGTGCCTGGAACACAGTGG - Intergenic
1089740547 11:120579100-120579122 GGACAGGGCCTGGCATACAGTGG - Intronic
1090461662 11:126896628-126896650 ATGCAGTGCATGGGAGACCGAGG + Intronic
1091890623 12:4051342-4051364 ATGCAGTGCCTCGCACAAGGTGG + Intergenic
1092024926 12:5232375-5232397 GTGCAGTGCCTGGCCCTCAGGGG + Intergenic
1092844032 12:12567570-12567592 GTGCAGTGCCTGGCACATAAGGG - Intergenic
1093292802 12:17349514-17349536 TAGCAGTGCCTGGCAAAAAGTGG - Intergenic
1095959985 12:47828418-47828440 CTACAGTGCCTGGCACACATTGG + Intronic
1096687701 12:53299789-53299811 ATGCGGTGCCGGGTATACAGGGG - Exonic
1097338274 12:58409036-58409058 ACACAGTGCCTGGTATAGAGTGG - Intergenic
1098100051 12:67005661-67005683 GTGCAGTGCCTGGCACTCAGTGG - Intergenic
1098219817 12:68257239-68257261 GAACAGTGCCTGGCATATAGTGG + Intergenic
1098463402 12:70759268-70759290 ATTTAGTGCCTGGCATGCAATGG - Intronic
1098481023 12:70961668-70961690 ATCCAGTGTCTGGCATAGAAAGG - Intergenic
1099847622 12:88048139-88048161 ACCCAGTACCTGGCAGACAGTGG + Intronic
1100747203 12:97659494-97659516 ATCTAGTCCCTGGAATACAGGGG - Intergenic
1101098947 12:101372431-101372453 ACGCAGTGCTTGGCACATAGAGG + Intronic
1101993112 12:109503955-109503977 CCTCAGTGCCTGGCACACAGGGG - Intronic
1101993636 12:109508411-109508433 GTGCAGTGCCTGGCACAGAGTGG + Intronic
1102907551 12:116688355-116688377 AGGCAGTGCTTGGCATGCGGCGG + Intergenic
1103174448 12:118850159-118850181 GTACAGTGCCTGGCATATAGTGG + Intergenic
1103995888 12:124829767-124829789 GAGCAGAGCCTGCCATACAGTGG - Intronic
1104526512 12:129528775-129528797 CAGCAGTGTCTGGCACACAGTGG - Intronic
1105913478 13:24892144-24892166 ATGCAGTGCCTGGCACACCCTGG + Intronic
1106148984 13:27079602-27079624 ATGCAGACCCTGGAATCCAGTGG + Intronic
1106476039 13:30098982-30099004 CAGTAGTGCCTGGCACACAGTGG - Intergenic
1106904709 13:34393006-34393028 ATGGAGTGCCTGGCACATATTGG + Intergenic
1107068376 13:36242662-36242684 ATAGAGTGCCTGGCATAAATTGG - Intronic
1107246475 13:38302309-38302331 AAATAGTGCCTGGCATATAGTGG + Intergenic
1107869757 13:44735660-44735682 CTGCAGTGTCTGGCTTATAGTGG + Intergenic
1108014725 13:46062694-46062716 GTGCAGTGCCTGGCACAAGGAGG - Intronic
1108203244 13:48062442-48062464 GAGAAGTGCCTGGCACACAGAGG + Intronic
1109354637 13:61221816-61221838 ATATAGTTCCTGCCATACAGGGG + Intergenic
1111380608 13:87445477-87445499 ATGGAGTGGCAGGCATAGAGTGG + Intergenic
1112189746 13:97164412-97164434 GTGCAATGCCTGGTACACAGAGG + Intergenic
1112315547 13:98359283-98359305 ACCCACTGCCTGGCACACAGTGG + Intronic
1113922304 13:113919941-113919963 ACTCAGTGCCTGGCACACTGGGG - Intergenic
1117496272 14:56308585-56308607 GTGCAGTGCCTGGAGTACAATGG - Intergenic
1118433997 14:65752969-65752991 AAACAGTGCCTGACATATAGTGG - Intergenic
1118838824 14:69496002-69496024 GAGCAGTGCTTGGCACACAGTGG + Intronic
1119131098 14:72173962-72173984 ATGCTGTGCCTGGAACACACTGG + Intronic
1119491453 14:75037445-75037467 GTACAGTCCCTGGCATACAATGG + Intronic
1119891285 14:78184256-78184278 TTCCAGTGCCTGGCATCGAGCGG - Intergenic
1120813424 14:88827926-88827948 ATGCAGAGTCAGGCACACAGGGG + Intronic
1120905758 14:89619484-89619506 GGGCAGTACCTGGCAGACAGAGG + Intergenic
1120968963 14:90191707-90191729 TTCCAGTGCCTGGCACAGAGAGG - Intergenic
1121220598 14:92282156-92282178 ATGCAGTGCCAAGGATAAAGAGG + Intergenic
1121229430 14:92345801-92345823 TCCCAGTGCCTGGCATACAGGGG - Intronic
1122123172 14:99565367-99565389 ATGCAATGCCTGGCACAATGTGG + Intronic
1122173144 14:99893408-99893430 ACGCAGTGGCTGGCACACATAGG + Intronic
1122516786 14:102314523-102314545 AAACAGTGCTTGGCACACAGCGG - Intergenic
1123628138 15:22241625-22241647 AGGCAGAGCCTGGGATCCAGAGG - Intergenic
1124427333 15:29572699-29572721 CTTCAGTGCCTGGCACATAGTGG - Intergenic
1124585727 15:31004680-31004702 CTACAGTGCCTGTGATACAGAGG - Intronic
1125147146 15:36484955-36484977 ATGCAATGCTTGGCATAAAAAGG + Intergenic
1125723721 15:41857399-41857421 AGGCAGGGCCTGGCCCACAGTGG + Exonic
1125735769 15:41924561-41924583 ATCCAGTGCCTGGCATACAGGGG + Intronic
1126238031 15:46408359-46408381 ATACAATGCCTGGCACATAGTGG + Intergenic
1126650587 15:50917671-50917693 CTGCAGTATCTGGCATACAGTGG - Intronic
1127647167 15:60970428-60970450 ATACAATGCCTGGCACGCAGTGG - Intronic
1127861045 15:62994591-62994613 AGGCTGGGCCTGGTATACAGAGG + Intergenic
1128345383 15:66849701-66849723 TTGCAGAGACTGGCATAGAGTGG + Intergenic
1128381473 15:67116293-67116315 TTGCAGTGCCTAGCACACAGTGG + Intronic
1128623957 15:69180287-69180309 GAGCAGTGCCTGGCATAAAATGG - Intronic
1128707352 15:69846594-69846616 ATGCAGTGCCTGGCATATAGTGG + Intergenic
1128861604 15:71078730-71078752 ATGCAGTGCCTGCTCAACAGAGG + Intergenic
1129106317 15:73309782-73309804 CCTCAGTGCCTGGCATATAGTGG - Intergenic
1129704178 15:77785169-77785191 ACTCAGGGCCTGGCACACAGTGG + Intronic
1129760509 15:78126562-78126584 ATGGAGTGGCTGGTGTACAGTGG - Intronic
1130389230 15:83440435-83440457 TTGCAGTGCCTGGCAGACCTCGG - Intergenic
1133064392 16:3195781-3195803 CCCCAGTGCCTGGCACACAGAGG + Intergenic
1133139834 16:3735621-3735643 CTGCACTGCCTGGCACTCAGGGG + Intronic
1133142177 16:3754045-3754067 ATGCAGTGGCTGGGAAACTGAGG + Intronic
1133367808 16:5224884-5224906 ATTCAGTGCCTGGTACACATAGG - Intergenic
1133811631 16:9165379-9165401 AAACAGTGCCTGGCGCACAGTGG - Intergenic
1133920342 16:10147133-10147155 ATACTATGCCTGGCATACACAGG - Intronic
1134452613 16:14372700-14372722 GGGCAGTGCCTGGCCCACAGGGG - Intergenic
1134528926 16:14967149-14967171 ATCCAGTGCCTAGGATGCAGTGG - Intergenic
1134677227 16:16099205-16099227 ATGAAGTGCCTGGCACACAGTGG + Intronic
1135100452 16:19600591-19600613 GATCAGTGCCTGGCACACAGGGG - Intronic
1135400609 16:22163958-22163980 ATGTAGGGCCTGGCGCACAGAGG + Intergenic
1135725219 16:24849064-24849086 ATGTAGTGCCTGGCACATAGAGG + Intronic
1136621679 16:31433636-31433658 GTGCAGGGCCTGGCTCACAGTGG - Intronic
1138142574 16:54581501-54581523 GCACAGTGCCTGGAATACAGTGG - Intergenic
1138222384 16:55263673-55263695 ATGCAGAGACAGCCATACAGAGG - Intergenic
1138265151 16:55655307-55655329 GAACAGTGCCTGGCACACAGCGG + Intergenic
1139241192 16:65393987-65394009 ATGCAGAGCCTGGGATTCATAGG - Intergenic
1139657325 16:68396946-68396968 ACACAGTGCCTGGCACACAGTGG - Intronic
1139867440 16:70073829-70073851 ATCCAGTGCCTAGGATGCAGTGG + Intergenic
1139973885 16:70793566-70793588 ATCATGTGCCTGGCACACAGTGG - Intronic
1140989472 16:80194734-80194756 ACCTAGTGCTTGGCATACAGTGG + Intergenic
1141008075 16:80371791-80371813 ACACAGTGCCTGGAATGCAGTGG + Intergenic
1141517744 16:84557631-84557653 GCCCAGTGCCTGGCAAACAGTGG - Intergenic
1141770947 16:86089361-86089383 ATACATGGCCTGGCACACAGTGG - Intergenic
1141975803 16:87515709-87515731 ATGCAGAGCCTGGCATCCAGAGG + Intergenic
1142897713 17:2992681-2992703 GCCCAGTGCCTGGCACACAGCGG + Intronic
1144444560 17:15314927-15314949 CTGCACTGCCAGGCAGACAGGGG + Intronic
1144743036 17:17594978-17595000 CAAAAGTGCCTGGCATACAGTGG + Intergenic
1144783810 17:17820975-17820997 GAGCAGTGCCTGGCATAGTGTGG - Intronic
1145981925 17:29017948-29017970 GGGAAGTGCCTGGCATAAAGTGG + Intronic
1146057154 17:29587229-29587251 ATGCTGGCCCTGGCATGCAGCGG - Intronic
1146265854 17:31452236-31452258 GCACAGTGCCTGGCATAGAGAGG + Intronic
1146541832 17:33702855-33702877 GTACATCGCCTGGCATACAGAGG - Intronic
1147246865 17:39127418-39127440 ATTCAGGGCCTAGCACACAGTGG - Intronic
1147817544 17:43221023-43221045 GTGCAATGGCTGGCCTACAGTGG - Intergenic
1148137630 17:45304964-45304986 GCACAGTGCCTGGCATGCAGTGG + Intronic
1148865330 17:50625394-50625416 CGCCAGTGCCTGGCACACAGAGG - Intronic
1148990470 17:51661751-51661773 ATTCAGTGTCTGGAACACAGTGG - Intronic
1149265993 17:54928264-54928286 CCACAGTGTCTGGCATACAGAGG - Intronic
1149300478 17:55300765-55300787 AGGCAGAGCTTGGCTTACAGGGG - Intronic
1149530286 17:57389594-57389616 ATGCAGTGCTTGGCACATAGTGG + Intronic
1149852892 17:60051546-60051568 GTGCAGGGCCTGGTACACAGTGG + Intronic
1150497078 17:65616196-65616218 AATCAGTGCCTGACACACAGAGG + Intronic
1151768423 17:76144167-76144189 ACCCAGTGCTTGGCACACAGAGG + Exonic
1151781493 17:76249486-76249508 ACACAGTTCCTGACATACAGCGG + Intergenic
1151889881 17:76945791-76945813 GCACAGTGCCTGGCATACAGTGG - Intronic
1151983869 17:77529499-77529521 CTGCAGGGCCTGGCAAGCAGGGG - Intergenic
1153781741 18:8500851-8500873 GGGTGGTGCCTGGCATACAGTGG + Intergenic
1155026258 18:21943523-21943545 ATACATTGCCTGACACACAGCGG + Intergenic
1155911210 18:31506117-31506139 ATCCAGTGACTGGCACACAGCGG - Intronic
1155937774 18:31772092-31772114 AAGCAGTGTCTGGTTTACAGTGG - Intergenic
1156275457 18:35579814-35579836 ATGCAGTATATGCCATACAGTGG - Intergenic
1156659170 18:39326403-39326425 GAGCAGTGCCTGACCTACAGAGG + Intergenic
1157056819 18:44239187-44239209 ATCCAGTGCCTGGCATTTAAAGG + Intergenic
1157221968 18:45834710-45834732 CCCCAGTGCCTGGCATAAAGTGG + Intronic
1157290933 18:46409098-46409120 TAACAGTGCCTGGCATACAGGGG + Intronic
1157320743 18:46631970-46631992 CTCCTGTGCCTGGCAGACAGTGG - Intronic
1157415937 18:47502873-47502895 GTCCAGTGCCTGGCACATAGTGG - Intergenic
1157579349 18:48764454-48764476 ATGCAGCCCCTGGGATACAGAGG - Intronic
1157712984 18:49862814-49862836 ATGCAGTGTGTGTCACACAGTGG - Intronic
1158265987 18:55661261-55661283 ATACAGTGTCTGGTAAACAGAGG + Intronic
1159936383 18:74371356-74371378 ATGCAGTGAGTGGAGTACAGGGG + Intergenic
1160126260 18:76175147-76175169 AGACAGTGCCTGGCATCCAGTGG - Intergenic
1160356305 18:78230452-78230474 ATGCAGTGCCGGGCACAGTGGGG + Intergenic
1161319993 19:3636700-3636722 CCACAGTGCCTGGCACACAGAGG + Intronic
1161548662 19:4898158-4898180 CTTCAGTGCATGGTATACAGTGG + Intronic
1161881172 19:6954045-6954067 AAACAGTGCCTGGCACATAGCGG + Intergenic
1162831522 19:13287415-13287437 CTGCAGTGCCTGGAATTGAGAGG + Intronic
1162947674 19:14053752-14053774 AAGCAGTGGCTGGCATTCGGCGG + Exonic
1163277171 19:16292275-16292297 ATGCAGGGCCTGGCATATACTGG + Intergenic
1163598971 19:18236727-18236749 GTACAGGGCCTGGCACACAGTGG + Intronic
1163735803 19:18979835-18979857 GCTCAGTGCCTGGCACACAGTGG - Intergenic
1164181141 19:22819855-22819877 ATGCAGGGCCTGGGAAAAAGAGG - Intergenic
1165750628 19:38257131-38257153 AAGCAGTGTCTGGTATAGAGTGG - Intronic
1165990245 19:39807160-39807182 ATTCAGTGGCTGGGATACTGAGG - Intergenic
1166222290 19:41373466-41373488 AAACAGTGCCTGGCACAAAGTGG - Intronic
1166364898 19:42273377-42273399 ATGGAAGGCCTGGCAGACAGTGG + Intronic
1166992058 19:46698498-46698520 GTACAGTGCCTGGCATACAGAGG + Intronic
1167050630 19:47075762-47075784 ATGCATTCCCTGGAATCCAGAGG + Intronic
1167194680 19:48019954-48019976 ACTCAGTGCCTGGCTCACAGTGG - Intronic
1167374329 19:49103049-49103071 CTGCAGAGGCTGGCACACAGGGG - Intronic
1167747736 19:51362595-51362617 GAACAGTGCCTGGCACACAGTGG - Intronic
1167851127 19:52203199-52203221 GTGCAGTGACTCGCCTACAGTGG + Intronic
1168639255 19:58019917-58019939 CTGCAGTGCCTGGCAGGCCGAGG - Intergenic
1202703833 1_KI270713v1_random:6233-6255 ATGGAGAGCCAGGCCTACAGCGG + Intergenic
925632839 2:5913218-5913240 CTTCAGTGCCTGGCATGGAGTGG - Intergenic
925755600 2:7128739-7128761 GTACAGTGTCTGGCATACAGAGG - Intergenic
926748676 2:16181181-16181203 GCCCAGTGCCTGGCATAGAGAGG + Intergenic
927211721 2:20642835-20642857 CAGCAGTGCCTGGCACACGGGGG - Intronic
927918150 2:26949679-26949701 ATGAAGCGCATGGCCTACAGTGG - Exonic
928413777 2:31074356-31074378 ATGCAGCGCTAGGCACACAGGGG + Intronic
928723257 2:34143836-34143858 ATACAGTGCCTGGTATTTAGTGG - Intergenic
929051623 2:37841883-37841905 CTGCATTTCCTGGCATACAATGG - Intergenic
929254335 2:39793024-39793046 AAACAGTGCCTGTCATAGAGTGG - Intergenic
929694545 2:44103009-44103031 ATGCTGTCCCTGTGATACAGTGG + Intergenic
929728585 2:44460584-44460606 ATGCAGTGCCTGAAATAAATGGG - Intronic
929913423 2:46113652-46113674 TTGCAGTCCCTGGCTTGCAGTGG + Intronic
930274733 2:49298241-49298263 ACACAGTGCCTGGTATAGAGCGG + Intergenic
930886476 2:56332415-56332437 AGGCAGTGCCTGCCATGAAGGGG + Intronic
931216857 2:60253290-60253312 GAACAGTGCCTGGCACACAGTGG - Intergenic
931667939 2:64623615-64623637 ATGGAGTGCTTGGAACACAGAGG + Intergenic
931759686 2:65405891-65405913 ATGGAGTGCCTGACAGAAAGTGG - Intronic
931827056 2:66011959-66011981 ATGTAGTGCCTGGTACATAGAGG + Intergenic
932178052 2:69620671-69620693 ATGCAGTGTCTCGCAGACATGGG - Intronic
932180069 2:69638934-69638956 ATACAGTGCCTGCCACAAAGAGG + Intronic
932290039 2:70569385-70569407 ATCCAGGGCCTGGCACAGAGTGG + Intergenic
932727991 2:74196111-74196133 TTGCAGTCCTTGGCTTACAGAGG - Intergenic
932782822 2:74572892-74572914 CAACAGTGCTTGGCATACAGTGG + Intronic
932841413 2:75086449-75086471 GTGCAGTACTTGGCACACAGTGG + Intronic
934872635 2:97881173-97881195 ATGCAGTGCCTAGGATACTGCGG - Intronic
935120682 2:100180914-100180936 ATGCCGTGCCTTGCACACAGAGG + Intergenic
935946982 2:108295689-108295711 AAGCAGTGCCTGACACTCAGAGG + Intronic
937375341 2:121332442-121332464 AGGCAGTGCCTGGGGCACAGCGG + Intergenic
938107410 2:128542761-128542783 ACCCAGGGTCTGGCATACAGGGG - Intergenic
938263640 2:129911657-129911679 TTGCTGTGCCTGGAATACAGGGG + Intergenic
939571976 2:143851100-143851122 GAGCAGTGACTGGCAAACAGGGG + Intergenic
939884161 2:147662993-147663015 GCACAGTGCCTAGCATACAGTGG + Intergenic
939938029 2:148315721-148315743 ATGCAGTGCCTGGTACATGGTGG - Intronic
940134880 2:150424991-150425013 ACACAGTGCCTGGCACACAGTGG - Intergenic
940135131 2:150426885-150426907 CTGTGGTGCCTGGCACACAGTGG + Intergenic
940460936 2:153961914-153961936 AAACAGTGCCTGGCTTATAGTGG + Intronic
942070200 2:172309219-172309241 ATCCTGTGCCTGGCACACATAGG + Intergenic
942575805 2:177362224-177362246 ATGAAGTTGCTGGCATGCAGAGG - Intronic
943607080 2:189988294-189988316 ATGTAGTTACTGGCATACAAAGG + Intronic
944230908 2:197391410-197391432 GCACAGTGGCTGGCATACAGTGG + Exonic
944318317 2:198307115-198307137 GCCCAGTGCCTGGCACACAGTGG - Intronic
944853974 2:203748750-203748772 GTGCAGTGCCTGGCATGGAATGG - Intergenic
945101431 2:206265822-206265844 TTGCAGTACCTGGCATAGAAGGG + Intergenic
945679900 2:212901628-212901650 ATTAATTGCCTGGGATACAGAGG + Intergenic
945951096 2:216039651-216039673 GTGCAGTGCTTCGCATACTGTGG + Intronic
946131553 2:217610693-217610715 ACCCAGTGCCTGGCACAGAGCGG + Intronic
946735519 2:222750780-222750802 CCACAGTGCCTTGCATACAGCGG - Intergenic
947182202 2:227421292-227421314 GTACAGTGCTTGGCACACAGTGG - Intergenic
948353345 2:237358774-237358796 CTCCAGTGCCTGGCACAAAGTGG - Intronic
948655610 2:239475252-239475274 ATGCAGAGCCTGCCATACTCTGG - Intergenic
1168837835 20:889699-889721 AAGCAGTGCCTGGCACACGGGGG + Intronic
1168862039 20:1052538-1052560 GCTCAGTGCCTGGCACACAGTGG - Intergenic
1168925791 20:1577904-1577926 GGGCAGAGCCTGGCACACAGTGG + Intronic
1168929669 20:1610923-1610945 GGGCAGAGCCTGGCACACAGTGG + Intronic
1168971711 20:1935746-1935768 GTCCAGTGCGTGGCACACAGTGG - Intronic
1169556002 20:6750684-6750706 AAACAGTGCCTGGCACATAGTGG - Intergenic
1169854396 20:10087763-10087785 ATTTAGTGCCTGGCATACACTGG - Intergenic
1170842267 20:19933586-19933608 TTGCAGTACCTGGCATGAAGCGG + Intronic
1170942314 20:20858692-20858714 GTGCAGAGCCTGGTATACAGTGG - Intergenic
1171071538 20:22073397-22073419 GTGCAGTGTCTGCCATGCAGAGG + Intergenic
1172062902 20:32199049-32199071 ATGCAGAGCCTGGCAAACAGTGG - Intronic
1172394046 20:34586652-34586674 ATGCAGAGCCTGGCACGCAGAGG + Intronic
1172487781 20:35309133-35309155 ATACAGAACCTGGCATAGAGTGG + Intronic
1172629439 20:36368094-36368116 GCCCCGTGCCTGGCATACAGTGG + Intronic
1172945126 20:38681457-38681479 GTGCAGTGCCTGGCACACACAGG - Intergenic
1173163802 20:40671899-40671921 ACACAGTGCCTGGCACAGAGGGG - Intergenic
1173419900 20:42891762-42891784 ATACAGTGCCTGGCACACAGTGG - Intronic
1173606857 20:44337668-44337690 GTGCAGTGCCTGGCGCACAGTGG - Intronic
1174202929 20:48819806-48819828 GCACAGTGCCTGGCACACAGTGG + Intronic
1174335751 20:49859237-49859259 CAGCAGTGTCTGGCACACAGAGG - Intronic
1174421069 20:50399487-50399509 CTGACGTGCCTGGCATCCAGTGG - Intergenic
1174569898 20:51494019-51494041 GTACAGTGCCTGGCAAAGAGTGG + Intronic
1174830620 20:53808885-53808907 GTTCAGTGCCTGGCACAGAGTGG + Intergenic
1174955660 20:55095015-55095037 ATCCAGAGCCTGGTACACAGTGG - Intergenic
1175606839 20:60318122-60318144 ACACAGTACCTGGCATGCAGTGG - Intergenic
1175722818 20:61297608-61297630 GGGCGGTGCCTGGCACACAGTGG + Intronic
1176305187 21:5119505-5119527 GCACAGTGCCTGGCACACAGGGG - Intronic
1177946130 21:27471766-27471788 AAGCAGTGCCTGTCATACAGAGG - Intergenic
1178049480 21:28732329-28732351 TCACAGTGCCTGGCACACAGTGG - Intergenic
1178425358 21:32474651-32474673 AAGCAGTGCCAGGCATAGAGTGG + Intronic
1178993243 21:37373047-37373069 CTCCAGTGCCTGGCACATAGGGG + Intronic
1179434127 21:41348446-41348468 CTGCAGTGCATGACACACAGTGG - Intronic
1179851867 21:44142525-44142547 GCACAGTGCCTGGCACACAGGGG + Intronic
1181784891 22:25219871-25219893 GCACAGTGCCTGGCACACAGTGG + Intronic
1181978191 22:26747405-26747427 GAACAATGCCTGGCATACAGTGG - Intergenic
1181990984 22:26836520-26836542 ATGCAGTGCTTGTCATACAAGGG + Intergenic
1182129688 22:27841932-27841954 CTCCAGTGCCTGGCACACAGTGG - Intergenic
1182150819 22:28026045-28026067 ATGCAGTGACTGTAATACACAGG - Intronic
1182966716 22:34528499-34528521 ATACAGTGCTTGGCACACACAGG - Intergenic
1183069088 22:35383829-35383851 AATCAGTACCTGGCATATAGTGG - Intronic
1183231144 22:36582876-36582898 AAAGAGGGCCTGGCATACAGGGG + Intronic
1183262696 22:36806088-36806110 GCACAGTGCCTGGCACACAGTGG + Intronic
1183450252 22:37890185-37890207 GTGCAGTGCCTGGCCTATAATGG + Intergenic
1183480194 22:38059640-38059662 GTACAGTGCCTGGCACATAGTGG + Intronic
1183548922 22:38469733-38469755 CAGCAGTGTCTGGCAGACAGCGG - Intronic
1183934111 22:41252397-41252419 ATGCAGTGCCTGGCAGAAAATGG + Intronic
1184280890 22:43436770-43436792 ACCCCGTGCCTGGCACACAGCGG - Intronic
1184310212 22:43636409-43636431 ACACAGTGCCTGGCACACACGGG - Intronic
1184362435 22:44026409-44026431 TTGGGGTGCCTGGCAAACAGAGG + Intronic
1184427759 22:44423222-44423244 GTGCAGGGCCTGGCACACACTGG + Intergenic
1184607682 22:45583495-45583517 CAGCAGTGCCTGGCACACAGTGG + Intronic
1185017479 22:48353167-48353189 GGGCAGTGCCTGGCATAGAATGG + Intergenic
1185170833 22:49293004-49293026 ATGCACTGTCTTGCATGCAGGGG - Intergenic
949948866 3:9212803-9212825 ATCCACTGCTGGGCATACAGTGG + Intronic
950159566 3:10750069-10750091 GTGCAGGGCCTGGCTTACAGTGG - Intergenic
950681114 3:14585724-14585746 AGTCAGTGCCTGGTATGCAGTGG - Intergenic
950738823 3:15033381-15033403 ACCCAGTGCCTGGCATGCAAGGG + Intronic
951746600 3:25984924-25984946 ATGCAGTGTCAGGAATACATTGG + Intergenic
952859598 3:37802018-37802040 CTGCAGTGCCTGGTTGACAGTGG - Intronic
953131441 3:40143161-40143183 ACACAGTGCCTGGCACATAGTGG + Intronic
953282982 3:41576445-41576467 GTGCAGTCCCTGGTACACAGTGG + Intronic
953647671 3:44769934-44769956 ATACAGTGCCTGTCATCCAGAGG - Intronic
955290856 3:57691362-57691384 ATGCAGTGCCTGGCACCTAGTGG - Intronic
955481296 3:59393245-59393267 GTACAGTGCCTGGCACACAGTGG - Intergenic
955510823 3:59678745-59678767 ATGGATGGCTTGGCATACAGAGG + Intergenic
956478392 3:69647966-69647988 ATGCAGTGTCTGGTACCCAGTGG - Intergenic
956652699 3:71519900-71519922 ATGCAGTCCCTCCCATAAAGGGG + Intronic
957029780 3:75227050-75227072 ATACAATGCCTGGAATGCAGTGG - Intergenic
957361762 3:79168719-79168741 AAACAGTGCCTGAAATACAGGGG - Intronic
957370307 3:79285519-79285541 ATGCCTTGCCTGGTATCCAGAGG + Intronic
957573182 3:81975337-81975359 GCGCAGTGCCTGGCACAGAGTGG - Intergenic
957980019 3:87496983-87497005 TTTTAATGCCTGGCATACAGTGG - Intergenic
959766693 3:110039357-110039379 ATACAGTGCCTGGCATGTTGTGG - Intergenic
961042770 3:123689023-123689045 TGGCAGTGCCTGGCACAGAGTGG + Intronic
961363336 3:126381971-126381993 AGCCAGTAGCTGGCATACAGAGG + Intergenic
961434639 3:126908383-126908405 AAGCAGGGCCTGGCACAGAGTGG + Intronic
961681551 3:128603383-128603405 ATGAAGTGCCTGGCTGAAAGTGG - Intergenic
961801734 3:129455941-129455963 ATGCTGTGCCAGGGAGACAGAGG + Intronic
961804529 3:129479794-129479816 CTGCAGTGCCTGTCCTTCAGCGG + Exonic
962149642 3:132879350-132879372 GCACAGTGCCTGGCACACAGAGG + Intergenic
962650273 3:137481478-137481500 TCACAGTGCCTGGCATACAGTGG + Intergenic
963128462 3:141836425-141836447 ACACAGTGCCTGGCACAGAGTGG + Intergenic
964066974 3:152592075-152592097 AGACAGTGACTGGCACACAGAGG - Intergenic
964191820 3:154011825-154011847 GCACAGAGCCTGGCATACAGTGG - Intergenic
965641612 3:170834784-170834806 ATACAGTGCCTGGCATGTTGTGG - Intronic
966152901 3:176884356-176884378 GCACAGTGCCTGGCATACAGTGG - Intergenic
966675492 3:182582958-182582980 ACACAGTGCCTGGTATACAGCGG - Intergenic
966773350 3:183523216-183523238 ATGCAATGCCTGGGACATAGCGG - Intronic
967440091 3:189497353-189497375 GTACAGTGCCTGGAATAGAGCGG - Intergenic
968799464 4:2732726-2732748 CTGCTCTGCCTGGCACACAGAGG - Intergenic
968982404 4:3857352-3857374 ATCCTGTGCCTAGTATACAGTGG - Intergenic
969103967 4:4791194-4791216 AGGCTGTGCCTGGCACACATGGG - Intergenic
969960975 4:10944587-10944609 CTGCAGAGCCAGGCAAACAGAGG - Intergenic
970006645 4:11417334-11417356 AACCAATGCCTGGCAGACAGTGG - Intronic
970600605 4:17638596-17638618 AAGCAGTGCTGGGCATACAATGG + Intronic
970616844 4:17775642-17775664 ATGCAGTGCCTGTCCTAGATTGG - Intronic
970795719 4:19910572-19910594 AAACAGTGCCTGGTAAACAGAGG - Intergenic
971291847 4:25349947-25349969 AAACAGTGCCTGGCACACAGTGG - Intronic
971722148 4:30258448-30258470 AAGCAGTGCACAGCATACAGTGG - Intergenic
972689273 4:41381101-41381123 ATTCAGTGCCTGGCATTCAGTGG - Intronic
973202171 4:47516188-47516210 ATGCAGTGGCTGGAGTGCAGTGG - Intronic
974421815 4:61685471-61685493 ATGAAGGGGCTGGCTTACAGAGG + Intronic
975095558 4:70453072-70453094 ATCCAGTGCTGTGCATACAGTGG - Intronic
975757718 4:77587585-77587607 GTACTGTACCTGGCATACAGTGG - Intronic
977174872 4:93807799-93807821 ATACAGTGCTTGGCACATAGTGG - Intergenic
978079190 4:104571136-104571158 ATGCAGGGCCTGACCTATAGTGG + Intergenic
978167179 4:105623242-105623264 GTGCATTGGCTGGCACACAGAGG + Intronic
979110664 4:116751100-116751122 ATGCAATGCCTGTCAAAGAGTGG + Intergenic
979227744 4:118308810-118308832 GAACAGTGCCTGGCATACAGAGG + Intronic
980240347 4:130165379-130165401 TTACAGTGACTGGCACACAGTGG + Intergenic
982972317 4:162004827-162004849 CAACAGTCCCTGGCATACAGTGG + Intronic
983257509 4:165416856-165416878 GGACAGTGCCTGGCACACAGTGG + Intronic
983637877 4:169916642-169916664 AGGCAGTGCCATGCACACAGTGG - Intergenic
984331548 4:178327149-178327171 ATACAGTGCCTGGCACATACTGG - Intergenic
984707057 4:182855320-182855342 GCTCAGTGCCTCGCATACAGTGG - Intergenic
985045106 4:185932702-185932724 AGGCAGGGCCTGGCCTAAAGCGG + Intronic
985209536 4:187577460-187577482 AAGCACAGCCTGGCAGACAGAGG + Intergenic
985624844 5:979965-979987 CCCCAGTGCCTGGTATACAGTGG + Intronic
985988949 5:3539246-3539268 ATCCAGCGCCTGGTACACAGTGG + Intergenic
986489177 5:8271852-8271874 AGGGACTGCCTGGCCTACAGAGG - Intergenic
986887596 5:12258848-12258870 ATGCAGGGCCTGGCATAAGAAGG + Intergenic
988335832 5:29908178-29908200 TTTCAGTTCCTGGCAGACAGTGG + Intergenic
988387587 5:30585758-30585780 ATGCAGAGAATGACATACAGGGG - Intergenic
988573184 5:32392255-32392277 ATACAGTTCCTGGCACACTGTGG + Intronic
988734106 5:34003378-34003400 GAACAGTGCCTGGCGTACAGTGG - Intronic
988842561 5:35097301-35097323 AAACAGTGCCTGGCATGCAGTGG - Intronic
990326144 5:54677263-54677285 CTACAGTGCCTGGCATAAAGGGG + Intergenic
990354508 5:54952807-54952829 CTGCAGTGGCTGAAATACAGAGG - Intergenic
991561527 5:67958608-67958630 ACACAGTGCCTGGCATACGTAGG - Intergenic
992758270 5:79929646-79929668 GAACAGTGCCTGGCACACAGTGG - Intergenic
993048407 5:82895592-82895614 ACTCAGTGCCTGGCATAGAGTGG - Intergenic
993448400 5:88043178-88043200 GTACAGTGCCTGACATACAATGG + Intergenic
995274842 5:110266410-110266432 AGTTAGTGCCTGGTATACAGAGG + Intergenic
995738010 5:115324209-115324231 TTACAGTGTCTGGCATATAGTGG - Intergenic
996636427 5:125694869-125694891 ACACAGTCCCTGGCCTACAGAGG - Intergenic
997408855 5:133674705-133674727 ATACCATGCCTGGCACACAGTGG + Intergenic
997699300 5:135885264-135885286 ATCCAGTGCCAGGCATACAATGG + Intronic
997749312 5:136329308-136329330 TCTCAGTGCCTGGCATACAGTGG - Intronic
997851523 5:137337046-137337068 GAACAGTGCCTGGCACACAGTGG + Intronic
997879807 5:137579508-137579530 GTACAGGGCCTGGCATATAGTGG - Intronic
998147725 5:139739745-139739767 AAGCAGGGCCTGGAACACAGTGG - Intergenic
998478652 5:142442895-142442917 ACACAGTGCCTGGCACATAGAGG + Intergenic
998500757 5:142630619-142630641 ATGCAGTGGCTGGAATAGAGGGG - Intronic
998529574 5:142872170-142872192 ATGCACTGCCAGGTACACAGAGG + Intronic
998554544 5:143110317-143110339 AAGCAGTCCCTGGCACACAAGGG + Intronic
998775448 5:145595529-145595551 GTCCAGTGCCTGGCACACTGAGG - Intronic
1000048311 5:157540124-157540146 ATGCCATGCCTGGCACAAAGTGG + Intronic
1001117004 5:168948224-168948246 ATGCACTGCCTGGCACACAGTGG + Intronic
1001445027 5:171776293-171776315 CTGCAGAGCCTGGCATCCTGAGG - Intergenic
1001542781 5:172551052-172551074 AGGCAGTGCCGGGCAGGCAGAGG - Intergenic
1001576260 5:172765931-172765953 GTAAAGTGCCTGGCACACAGTGG - Intergenic
1002174607 5:177394477-177394499 GTGTAGTGCCAGGTATACAGAGG + Intronic
1002191497 5:177480276-177480298 TGTCAGTGCCTGGCATATAGTGG - Intergenic
1002548066 5:179965274-179965296 GCACAGTGCCTGGCACACAGTGG + Intronic
1002878163 6:1229365-1229387 GTTCAGTGCCTGGCACATAGTGG - Intergenic
1002994144 6:2267384-2267406 TCACAGTGCCTGGTATACAGTGG - Intergenic
1004065395 6:12239062-12239084 ACCCAGTTCCTGGCACACAGTGG + Intergenic
1004433784 6:15570104-15570126 GCAGAGTGCCTGGCATACAGTGG + Intronic
1004762820 6:18689196-18689218 ACACAGTGCCTGAAATACAGTGG - Intergenic
1004869551 6:19890839-19890861 AGTGAGTGCCTGGTATACAGTGG - Intergenic
1006130705 6:31867778-31867800 ACCCAGTGCCTGGCACATAGTGG + Intronic
1006737189 6:36282620-36282642 ATACAGTGCCTGGCACTCACAGG - Intronic
1006737611 6:36285668-36285690 ATATAGTGCCTGGAATACGGTGG - Intronic
1007246767 6:40468875-40468897 GTGCAGTGAGTGGCATGCAGGGG + Intronic
1008703272 6:54127358-54127380 ATGCAGTGCCTTACATATAAAGG + Intronic
1008703457 6:54129364-54129386 ATACAATGCCTGGAATACTGTGG + Intronic
1008831390 6:55766987-55767009 ATGCTGTGCCTGGCATATAATGG + Intronic
1009289780 6:61868331-61868353 ATGGAGTGCCTGGCAGGGAGGGG - Intronic
1009361819 6:62824317-62824339 AGGCAGTGTCTGACATACATAGG - Intergenic
1009675815 6:66819212-66819234 ATTCAGTGCCTGTTATAAAGTGG - Intergenic
1011070942 6:83382284-83382306 GTAAAGTGCCTGGCATGCAGTGG + Intronic
1011703208 6:89974352-89974374 GGGCAGTGCCTGGCATACCCTGG + Intronic
1011960825 6:93087780-93087802 ACACGGTACCTGGCATACAGTGG + Intergenic
1012265967 6:97143592-97143614 TTGCAGTGCCTTGCATCCACTGG - Exonic
1012425591 6:99110793-99110815 ATGCATGGCCTGGCACATAGGGG + Intergenic
1012476928 6:99624094-99624116 GTGCTGTGCCTGGCATGTAGTGG - Intergenic
1013022630 6:106234338-106234360 ATGCATGGCCTGAAATACAGGGG - Intronic
1014635962 6:123846902-123846924 GTACAGTGCCTGGAATAGAGTGG - Intronic
1014639989 6:123897707-123897729 AAGCAATGTCTGGCATAGAGAGG + Intronic
1014903939 6:127003530-127003552 ATAATGTGCCTGGCATACACTGG - Intergenic
1015471484 6:133611504-133611526 AAGCATTGCCTGGCATAGAGTGG + Intergenic
1017540514 6:155397505-155397527 GAACAGTGCCTGGCATACAGTGG + Intronic
1019120574 6:169800861-169800883 CTGCAGGGCCTGGCACACACAGG - Intergenic
1019501232 7:1365739-1365761 GAACAGTGCCTGGCACACAGGGG - Intergenic
1019917138 7:4140754-4140776 ATGAAGTGCCTGGAATATAGAGG + Intronic
1020432181 7:8125705-8125727 TCCCAGTGCCTGGCACACAGTGG + Intronic
1021441549 7:20682677-20682699 AGACAATGCCTGGCACACAGTGG + Intronic
1021450934 7:20783884-20783906 ATCCAGTGCCTGGTAGACAGCGG - Intronic
1021606348 7:22413128-22413150 GCACAGTGCCTGGCACACAGAGG + Intergenic
1021764443 7:23932727-23932749 GCACAGTGCCTGGCATACAGTGG - Intergenic
1021781684 7:24113190-24113212 ATGCAATGACTGGCATGTAGTGG + Intergenic
1022470662 7:30680258-30680280 GTGCAGTGGCTGGCACATAGTGG + Intronic
1022798663 7:33753848-33753870 ACTATGTGCCTGGCATACAGGGG + Intergenic
1023851941 7:44155337-44155359 ATGCAGGGCCTGGCATATGGAGG - Intronic
1024193396 7:47035076-47035098 GTTCAGTGCCTGGCACATAGAGG - Intergenic
1026256556 7:68716943-68716965 CTTCAGTCCCTGGCATGCAGTGG + Intergenic
1026773908 7:73219407-73219429 AGCTAGTGCCTGGCACACAGAGG - Intergenic
1027014765 7:74772797-74772819 ATCTAGTGCCTGGCACACAGAGG - Intergenic
1027073266 7:75173158-75173180 ATCTAGTGCCTGGCACACAGAGG + Intergenic
1027480568 7:78691363-78691385 TTGCAGGGTCTGGCATGCAGTGG + Intronic
1027977228 7:85174304-85174326 TTACAGTGCCTGGCATGCAGCGG + Intronic
1028411778 7:90537924-90537946 ATGAAGGGCCTTGCAGACAGTGG - Intronic
1030670905 7:112335717-112335739 TTCCAGAGCCTGGCATACAGTGG - Intronic
1031406169 7:121390164-121390186 ATTAAGTGCCTGGCAACCAGAGG - Intronic
1031915681 7:127560664-127560686 ATGCAGTACCTGACATATATTGG + Intergenic
1031979381 7:128114959-128114981 GCCCAGTGCCTGGCACACAGTGG + Intergenic
1032283964 7:130527303-130527325 AGAGAGTGCCTGGCATACATGGG + Intronic
1032847919 7:135767805-135767827 GTGCAGGGTCTGGCACACAGAGG - Intergenic
1033354841 7:140591255-140591277 GTGCAGTGGCTGGAATGCAGTGG - Intronic
1033605737 7:142927369-142927391 GTGCAGTGCCTGACATACAGCGG + Intronic
1034049032 7:147962142-147962164 AGGCAGTGCCTGGAATGTAGTGG + Intronic
1034478733 7:151303713-151303735 AGCCAGTGCCTGGCATGGAGTGG - Intergenic
1034761481 7:153676176-153676198 GAGCAGTGCCTGGCATATAATGG + Intergenic
1035188871 7:157148143-157148165 CTGGAGTGCCTGGAGTACAGTGG + Intronic
1035424604 7:158760835-158760857 ATCCAGTGCCTGGCACACCCAGG + Intronic
1035968115 8:4217312-4217334 AGGCAGCACCTGGCACACAGGGG - Intronic
1036157025 8:6351911-6351933 AAGCAGTGCCTGGCCTAAAAGGG - Intergenic
1036753558 8:11457602-11457624 GAGCAGTGCCCGGCACACAGCGG + Intronic
1037660685 8:20924055-20924077 AGGCAGAGCCTGGCATTAAGTGG + Intergenic
1038075247 8:24065950-24065972 ATAGAGTGCCTGGCACATAGGGG + Intergenic
1038260705 8:25991394-25991416 GTTCAGTTCCTGGCATACAATGG - Intronic
1040060053 8:43096091-43096113 CCCCAGTGCCTGGCACACAGCGG - Intronic
1040752157 8:50723664-50723686 ATGGAGTTACTGGCATGCAGGGG - Intronic
1042701217 8:71617033-71617055 ATGCAGTGTCTGGCACAGAGAGG - Intergenic
1042809486 8:72808428-72808450 ATATAGTGCCTGGCATATAATGG + Intronic
1045054906 8:98360409-98360431 GTCCAGTGCCTGTCATACTGTGG + Intergenic
1045593069 8:103620774-103620796 AGAAAGTGCCTGGCATATAGTGG + Intronic
1046690232 8:117275676-117275698 ATGAAGTGCTTGGCACATAGTGG - Intergenic
1047221018 8:122918280-122918302 TTGCAGTGCCTGGCACACATGGG - Intronic
1048487778 8:134864859-134864881 GTGCAGTTCCTGGCATAGACTGG + Intergenic
1048848730 8:138623989-138624011 TTGCAGTATCTGGCATATAGTGG + Intronic
1049045480 8:140148004-140148026 AGCCAGTGCCTGGCACACAGTGG - Intronic
1049277137 8:141725510-141725532 ATACAGCACCTGGGATACAGTGG - Intergenic
1049592967 8:143471002-143471024 TTGCAGAGCCTGACATCCAGCGG - Intronic
1051589402 9:18761029-18761051 ATACAGTGCCTAGCACTCAGTGG + Intronic
1051909555 9:22137908-22137930 ATACAGTGCCTGGCACATATAGG - Intergenic
1054586964 9:66977514-66977536 ATGAAGGGGCTGGTATACAGAGG - Intergenic
1055415949 9:76083249-76083271 AACCAGTGCTTGGCATATAGTGG - Intronic
1056076673 9:83048505-83048527 GTGCAGTCCTGGGCATACAGTGG + Intronic
1057427926 9:94968803-94968825 ATCCAGTGCCTGATACACAGAGG - Intronic
1057748502 9:97771439-97771461 ACCCAGTGCCTGGCTCACAGGGG - Intergenic
1057839807 9:98477151-98477173 CTACAGTGCCTGGTATACAGGGG + Intronic
1057866802 9:98687809-98687831 ACACAGTGCCTGGCACACAGAGG + Intronic
1057891874 9:98875739-98875761 GCCCAGTGCCTGGCACACAGAGG - Intergenic
1057955475 9:99403795-99403817 ATGCAGTGGCAGACATAAAGTGG - Intergenic
1058933500 9:109745957-109745979 CTGCAGAGCTTGGCATTCAGAGG + Intronic
1059774713 9:117463554-117463576 GCCCAGTGCCTGGCACACAGTGG - Intergenic
1059956728 9:119523644-119523666 ATGCTATGCCTTGCATTCAGAGG - Exonic
1060256327 9:122034440-122034462 AGGAAGTGCCTGGCTTCCAGGGG - Intronic
1060260657 9:122071117-122071139 ATCCAGTGCCTGGCTTAGAGTGG + Intronic
1060265153 9:122107785-122107807 AAGCAGTGCCTGGCACGCAGTGG - Intergenic
1060791467 9:126488478-126488500 GTGGAGAGCCTGGCATCCAGGGG + Intronic
1061164627 9:128915208-128915230 CTGCAGTGCCAGGCATCCACGGG - Intronic
1061905825 9:133696333-133696355 AAGGAGTGCCTGGCCTGCAGAGG - Exonic
1061934785 9:133851340-133851362 GTATAGTGCCTGGCACACAGTGG - Intronic
1185472213 X:390784-390806 ATCCAGAGCATGTCATACAGTGG - Intergenic
1185723463 X:2400558-2400580 ATTCAGTGCCTGAAACACAGTGG - Intronic
1186589871 X:10918528-10918550 GTATAGTGTCTGGCATACAGTGG + Intergenic
1187280939 X:17858342-17858364 GTGAAGTGCCTAGCAGACAGAGG + Intronic
1189222109 X:39381404-39381426 GTACAGTGCCTGGCACACAGTGG - Intergenic
1189337620 X:40179855-40179877 GTACAGTGCCTGGCACAAAGTGG - Intergenic
1190623897 X:52317394-52317416 ATGAAGTGTCTGGCACAGAGTGG - Intergenic
1190736655 X:53259912-53259934 GCACTGTGCCTGGCATACAGAGG - Intronic
1192085703 X:68095178-68095200 AAACAGTACCTGGCATAAAGTGG + Intronic
1193996148 X:88367488-88367510 CTGGAGTGGCTGGGATACAGGGG + Intergenic
1195599509 X:106729184-106729206 GTAGAGTGCCTGGCATATAGTGG - Intronic
1196150430 X:112367651-112367673 CCCCAGTGCCTGGCATATAGTGG - Intergenic
1196504462 X:116424975-116424997 TTGCAGGGCCTGGCAAAAAGGGG + Intergenic
1196776350 X:119341388-119341410 ATGCAGTGGCTGACTTCCAGAGG - Intergenic
1198126238 X:133646803-133646825 ATGCTGTGGCTATCATACAGTGG - Intronic
1198729727 X:139716551-139716573 GTGCAGTGCCAGCCACACAGTGG - Intergenic
1198754830 X:139971543-139971565 ATTCCATGCCTGGCATACGGTGG - Intergenic
1198951507 X:142077712-142077734 ATGCAGTGCCTGACAGGCAAAGG + Intergenic
1199418565 X:147616022-147616044 ATGCTGTGCCTGGCACAAAGTGG + Intergenic
1199473465 X:148220554-148220576 ATGAAGTGCCTGGGAGTCAGGGG - Intergenic
1199784276 X:151090449-151090471 ATACAGTGCCTGGCACAGAGTGG + Intergenic
1201364087 Y:13184979-13185001 AGGGAGTGCCTGCCAGACAGTGG - Intergenic