ID: 906747245

View in Genome Browser
Species Human (GRCh38)
Location 1:48230702-48230724
Sequence GCAGGTAGGCAGAGGGAAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1026
Summary {0: 1, 1: 0, 2: 6, 3: 82, 4: 937}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906747233_906747245 23 Left 906747233 1:48230656-48230678 CCTCTCCACAGGGATCCTGCTGG 0: 1
1: 0
2: 4
3: 25
4: 303
Right 906747245 1:48230702-48230724 GCAGGTAGGCAGAGGGAAGAGGG 0: 1
1: 0
2: 6
3: 82
4: 937
906747232_906747245 29 Left 906747232 1:48230650-48230672 CCTGTACCTCTCCACAGGGATCC 0: 1
1: 0
2: 1
3: 15
4: 183
Right 906747245 1:48230702-48230724 GCAGGTAGGCAGAGGGAAGAGGG 0: 1
1: 0
2: 6
3: 82
4: 937
906747239_906747245 -9 Left 906747239 1:48230688-48230710 CCGTCTACACCATTGCAGGTAGG 0: 1
1: 0
2: 0
3: 10
4: 72
Right 906747245 1:48230702-48230724 GCAGGTAGGCAGAGGGAAGAGGG 0: 1
1: 0
2: 6
3: 82
4: 937
906747236_906747245 18 Left 906747236 1:48230661-48230683 CCACAGGGATCCTGCTGGTGGTG 0: 1
1: 0
2: 1
3: 35
4: 256
Right 906747245 1:48230702-48230724 GCAGGTAGGCAGAGGGAAGAGGG 0: 1
1: 0
2: 6
3: 82
4: 937
906747237_906747245 8 Left 906747237 1:48230671-48230693 CCTGCTGGTGGTGACTGCCGTCT 0: 1
1: 0
2: 0
3: 17
4: 123
Right 906747245 1:48230702-48230724 GCAGGTAGGCAGAGGGAAGAGGG 0: 1
1: 0
2: 6
3: 82
4: 937

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906747245 Original CRISPR GCAGGTAGGCAGAGGGAAGA GGG Exonic
900666718 1:3820510-3820532 GGAGGAAGGCAGATGGAAGTGGG + Intronic
900838998 1:5032183-5032205 ACAGGTAAGCAGAGGGAAGAGGG - Intergenic
901129737 1:6954834-6954856 CCAGGCAAGCAGAGGGAAGGCGG - Intronic
901131020 1:6962635-6962657 GCAGGTCCACAGAGGAAAGAGGG - Intronic
901316787 1:8315116-8315138 GAAGGATGGCAGAGGGAGGAGGG - Intergenic
901735194 1:11307985-11308007 GACAGGAGGCAGAGGGAAGAGGG - Intergenic
902653958 1:17854700-17854722 GTAGGAGGGCAGAGGGGAGAAGG - Intergenic
902780499 1:18701829-18701851 AGGGATAGGCAGAGGGAAGAAGG + Intronic
902841243 1:19075325-19075347 GGAGGTGGGCAGAGGAAGGAGGG - Intronic
902937817 1:19777221-19777243 GCAGGAAGGAAGAGGGCAGAGGG - Intronic
903223307 1:21880920-21880942 TCAGGTAGGCAGAGTGAGGGAGG - Intronic
903373713 1:22852880-22852902 GCTGGTAGGAGGAGGGGAGATGG + Intronic
903672467 1:25044959-25044981 GAAGGAAGGAAGAAGGAAGAAGG + Intergenic
903888510 1:26554987-26555009 TCTGGTTGGCAGAGGCAAGAGGG + Intronic
903965851 1:27088934-27088956 GGAGGGAGGCAGAGGGAGAAGGG + Intergenic
904200841 1:28818144-28818166 GCAGGTGGGCAGAGTGCAGGTGG + Intronic
904277698 1:29394978-29395000 GCAGGTGGACAGAGGCAGGAAGG + Intergenic
904432018 1:30470371-30470393 GCAGGGAGGCAGAGGGACAGTGG + Intergenic
904576263 1:31506977-31506999 TCAGGTAGGCTGAGGGGAGGTGG + Intergenic
904690035 1:32286963-32286985 GCAGTCAGCCAGAGGGAACAGGG + Intergenic
904748412 1:32725468-32725490 GCAGGAAGGGAGAGGGAAGGAGG + Intergenic
904750331 1:32737809-32737831 GCAGGTAGGGAGAGGAAGAAGGG - Intergenic
904787824 1:32995845-32995867 GCAGGTTGGCAGAGGGTGCAAGG + Intergenic
905007458 1:34721333-34721355 GCTGGAAGGCAGAGGCTAGAGGG - Intronic
905542094 1:38767939-38767961 CAAGGGAGGCAGAGGGAAGCTGG - Intergenic
905717082 1:40161381-40161403 GCTGGTGGGCCGTGGGAAGATGG + Exonic
905853534 1:41291558-41291580 GCAGAAAGGCAGGGAGAAGATGG - Intergenic
906191708 1:43903355-43903377 GGAGGCTGGCAGAGGCAAGAGGG - Intronic
906206949 1:43992001-43992023 GGAGGTGGGGAGAGGGAAGGTGG + Exonic
906209925 1:44007084-44007106 GCAGGTGAGCAGAGGCCAGAAGG - Intronic
906747245 1:48230702-48230724 GCAGGTAGGCAGAGGGAAGAGGG + Exonic
906927833 1:50138138-50138160 TGAGGTAGGTAGAGGGCAGAGGG + Intronic
907257312 1:53189703-53189725 CCAGGTAGGCAGAAGCAAGAAGG + Intergenic
907268585 1:53277216-53277238 GCAGTTAGGCATAGCGAAGGCGG + Intronic
907303774 1:53502934-53502956 GCAGGGAGAGAGAGGGGAGAGGG + Intergenic
907861144 1:58354660-58354682 GGAGGAAGGGAGAGGGAGGAGGG + Intronic
908085239 1:60625281-60625303 GCAAATGGGAAGAGGGAAGAGGG + Intergenic
909023098 1:70453402-70453424 GCAGGTGAAAAGAGGGAAGAAGG + Intergenic
909023181 1:70454510-70454532 GCAGGTGAGAAGAGAGAAGAAGG + Intergenic
909292837 1:73905871-73905893 GGAGGGAGGAAGAGAGAAGAGGG - Intergenic
909916754 1:81329106-81329128 GCAGTTAGACAGTGGGAACATGG - Intronic
911582732 1:99653017-99653039 GGAGGAAGGCAGAGGAAAAAGGG - Intronic
912558892 1:110536152-110536174 GGAGCTAAGCAAAGGGAAGAGGG + Intergenic
912626111 1:111205307-111205329 AGAGGTAGGCAGAGGGAAGAAGG + Intronic
912681936 1:111734310-111734332 AAAGGTGGTCAGAGGGAAGAGGG - Intronic
912697464 1:111852235-111852257 GAAGGTTGGCAGGGAGAAGATGG + Intronic
912861427 1:113217189-113217211 GCAGGAAGACAGAGCCAAGAGGG - Intergenic
913047777 1:115088968-115088990 GCTGGTAGGCAGAGTGAAAAGGG + Intronic
914847966 1:151293242-151293264 GCATGTGGGCAGAGGAAGGAAGG + Intronic
914947094 1:152077544-152077566 GCAGGGAGGCAGAGGCAGGCAGG - Intergenic
915300202 1:154947398-154947420 GCAGGTGGGCACAGGCAGGAGGG - Exonic
915571826 1:156749046-156749068 GAAGTTAGGCAGGCGGAAGAGGG + Intronic
915936333 1:160092240-160092262 GGAGGAAGGCAGAGTGAGGAGGG + Intronic
916267104 1:162901606-162901628 GGAGGCAGGGAGAGGGCAGAAGG - Intergenic
916536303 1:165706776-165706798 GAAGGTTGGGAGAGGGATGAGGG + Intergenic
916698029 1:167260608-167260630 GCAGGAAAGCTGAGGAAAGAGGG - Intronic
916771445 1:167912669-167912691 GCAAGAAGGAAGAGGAAAGAGGG - Intronic
916884063 1:169049850-169049872 GCAGAGTGGCAGAGGCAAGAAGG + Intergenic
916971999 1:170030784-170030806 GGAAGAAGGCAGAAGGAAGAAGG + Intronic
917007912 1:170436012-170436034 GGAGGTAGGTGGAGAGAAGAGGG - Intergenic
918082823 1:181220844-181220866 GCTGGTAGGCAGGGGCCAGAGGG - Intergenic
918157463 1:181863179-181863201 GCAGCTGGGGAGAGGCAAGAAGG + Intergenic
918237442 1:182593927-182593949 GGAGGGAGCCAGAGGGAAGGAGG - Intergenic
918521658 1:185421350-185421372 GAAGGAAGGCAGAGGAGAGAGGG - Intergenic
919297068 1:195715841-195715863 GCAGGGAGTCAGAGGAAAAATGG + Intergenic
919630364 1:199954871-199954893 GCTGGAGAGCAGAGGGAAGAGGG - Intergenic
919896537 1:202012804-202012826 GCTGGGAGCCAGAGGGAACAAGG - Intronic
920307873 1:205030647-205030669 GAAGGCAGGCACAGGCAAGATGG + Intergenic
920430014 1:205912736-205912758 AAAGGTATGCAGAGGGATGATGG + Intergenic
920659339 1:207902152-207902174 TCAGGTAAGCAGTGGGGAGAAGG + Intronic
920688869 1:208130718-208130740 GCAGGATGGCAGAGGGGTGATGG - Intronic
920940258 1:210475374-210475396 GTAGTTAGGCAGAGTGAAGGAGG - Intronic
921350328 1:214228050-214228072 ACAGATAGGGAGAAGGAAGAAGG + Intergenic
921572868 1:216799460-216799482 GCAGGGAGGCACAATGAAGAGGG + Intronic
921621764 1:217333302-217333324 GCAGCTGGGCACAGAGAAGAGGG + Intergenic
922650047 1:227330040-227330062 ATAGGTAGGCAGAGGAAAAAGGG - Intergenic
922664095 1:227454233-227454255 GCAGACAGGCAGAGAGAAGCTGG + Intergenic
922737652 1:227996910-227996932 TCAAGAAGGCAGAGGAAAGATGG + Intergenic
923251663 1:232184153-232184175 ACAGATAGACAGAGGGAAGAGGG + Intergenic
923669286 1:236026172-236026194 GCAGGGAGACAGAGGGAAGATGG + Intronic
924130731 1:240905397-240905419 ACAGGTAGGCGGAGAGAGGAAGG + Intronic
924261658 1:242237711-242237733 GCAAGGAAGCAGAGGGAATAGGG - Intronic
924324832 1:242885213-242885235 GCAGGGAGGAAAAGGGAGGAGGG + Intergenic
924423955 1:243933858-243933880 GAAGGGAGGGAGAGGGAAGGAGG - Intergenic
924762154 1:246997890-246997912 GGAGGTAGGAAAATGGAAGATGG + Intronic
1062886509 10:1020705-1020727 CCAGGTTGGCAGCGGGCAGACGG - Intronic
1063316183 10:5008648-5008670 GGAGGAAAGCAGATGGAAGATGG + Intronic
1063365203 10:5486387-5486409 GCAGGGAGACTGAAGGAAGAAGG + Intergenic
1063390918 10:5649414-5649436 GCAGGTAGACACAGGGCAGGGGG - Intronic
1063464630 10:6234823-6234845 TTAGGTAGTCAGAGGGGAGAGGG - Exonic
1063498028 10:6528094-6528116 GCAGGAGGGAAGAGGGAGGAGGG - Intronic
1063819686 10:9819945-9819967 GCAGTTTGGCGGAGGGAGGAGGG - Intergenic
1064148298 10:12842456-12842478 GCACGTAGACACAGGGAGGACGG - Intergenic
1064154324 10:12891079-12891101 TCAGGTAGGAAGGGGGAAGCTGG + Intergenic
1064249201 10:13693879-13693901 TCAGGTAGGCAGAGGCCAGCTGG - Exonic
1064378008 10:14814633-14814655 GGAGGTAGGTAGAGGGAGGGAGG + Intergenic
1065111528 10:22444705-22444727 GCTGGAACGGAGAGGGAAGAAGG + Intronic
1065179842 10:23113824-23113846 GAAGGTAGGAAGAGGCAAGGAGG + Intronic
1065325354 10:24545866-24545888 GCAGGTAAGGAGGGGGAAGTAGG - Exonic
1065350540 10:24791800-24791822 GGAGGTTGGCAGAGGGATGAGGG - Intergenic
1065356241 10:24844890-24844912 GGAGGGAGACAGAGAGAAGAAGG - Intergenic
1066226313 10:33386874-33386896 CCTGACAGGCAGAGGGAAGATGG + Intergenic
1066350895 10:34636070-34636092 GAAGGAAGGAAGAAGGAAGAAGG + Intronic
1066523125 10:36244789-36244811 GAAGGTTGGCAAGGGGAAGATGG + Intergenic
1067188980 10:44054062-44054084 GCAGGTGGGCAGGGGCAAGCAGG - Intergenic
1067304708 10:45050943-45050965 GAGGGTAGGCAGAGGGTATATGG + Intergenic
1067523642 10:47026010-47026032 GCAGGGAGGCAGAGGGCAGATGG - Intergenic
1067537700 10:47126693-47126715 GAAGGAAGGCAGATAGAAGATGG - Intergenic
1067911937 10:50355281-50355303 GCAAAGAGGGAGAGGGAAGAGGG - Intronic
1068658554 10:59599697-59599719 GCAGTTGGGCAGAGGGATGGGGG + Intergenic
1068830674 10:61491272-61491294 GCAGGGAGGGAGAGGGAGGCAGG + Intergenic
1069048817 10:63770734-63770756 ACAGGTAGGCAGCAGGAAGAAGG - Intergenic
1069650629 10:70044779-70044801 GCAAGTTTCCAGAGGGAAGAAGG + Intergenic
1069821880 10:71233518-71233540 GTGGGGAGGCAGAGGGAAGGGGG - Intronic
1069964993 10:72107452-72107474 GGAGGTAGGAAGAGGCAAGAAGG + Intronic
1070105420 10:73426459-73426481 ACAGGTTGGCAGAGTGAACATGG - Intronic
1070159652 10:73858531-73858553 GAGGGTGGGCAGAGGGAAGGGGG - Intronic
1070431961 10:76349285-76349307 GCAGGTAGTCATAGGCAATATGG + Intronic
1070490244 10:76969263-76969285 GGAGGGAGGGAGGGGGAAGAAGG + Intronic
1070629059 10:78071441-78071463 GCAACCAGGCAGAGGGGAGAAGG - Intergenic
1070775578 10:79107958-79107980 GCAGGCAGGCAGAAAGAAGGTGG - Intronic
1070850501 10:79558849-79558871 GCAGGTGGGCAGTGGAAACATGG - Intronic
1070856716 10:79612446-79612468 GCAGGTGGGCAGTGGAAACATGG + Intronic
1070921069 10:80186694-80186716 GCAGGCAGGAGGAGAGAAGATGG - Intronic
1072222307 10:93336806-93336828 GCAGGTAGGAGGGAGGAAGAAGG + Intronic
1072293842 10:93991417-93991439 GCAGAAAGAAAGAGGGAAGATGG + Intergenic
1072745551 10:97936615-97936637 GCAGGGTGGCAGAGGGGAGTGGG + Intronic
1073250649 10:102118801-102118823 GCTGGTAGAAAGAGGGACGACGG + Intronic
1073484745 10:103809648-103809670 GGAGGGAGGGAGAGGGAAGGAGG - Intronic
1073944006 10:108730069-108730091 GGAGGGAGGTAGAGGGAAGGAGG + Intergenic
1073944036 10:108730165-108730187 GGAGGGAGGTAGAGGGAAGGAGG + Intergenic
1073944054 10:108730227-108730249 GGAGGTAGGTAGAGGGAAGAAGG + Intergenic
1073988835 10:109240646-109240668 GAAGGAAGGAAGGGGGAAGAGGG + Intergenic
1074291307 10:112139839-112139861 GCAGAAAGGCTCAGGGAAGATGG + Intergenic
1074578107 10:114689987-114690009 TCAGCTAGGCATAGGGAACAAGG + Intergenic
1074842122 10:117364921-117364943 GGAGGGAGGGAGAGGGAAGAAGG + Intronic
1074899558 10:117804406-117804428 GCAGGGGTGCAGAGAGAAGAGGG + Intergenic
1074919323 10:117991370-117991392 GCAGAGGGGCAGAGGGAAGGAGG + Intergenic
1075148929 10:119908630-119908652 GAAGCTAGGAAGAGGGAAGGAGG + Intronic
1075162279 10:120034732-120034754 GGAGAGAGACAGAGGGAAGAAGG + Intergenic
1075168990 10:120095827-120095849 GCAGGTATCCACAGGGAACACGG - Intergenic
1075312312 10:121424708-121424730 GAAGGAGGGTAGAGGGAAGAGGG + Intergenic
1075406207 10:122197451-122197473 GAAGTTAGGCAGAAGGAAGAAGG - Intronic
1075559518 10:123458441-123458463 GAAGGGAGGCAGAGAGAGGAGGG - Intergenic
1075962970 10:126585295-126585317 GCAAGCAAGCAGAGGGAGGAAGG + Intronic
1076555420 10:131318129-131318151 GCAGGGAGGTAGAAGGGAGAGGG + Intergenic
1076594485 10:131617444-131617466 GAAGGTGGGCAGAGGGCAGAAGG + Intergenic
1076680381 10:132168616-132168638 GTAGGGAGGCAGAGGGTTGATGG - Exonic
1076806342 10:132861048-132861070 GCAGGCAGAGAGAAGGAAGAGGG + Intronic
1077094209 11:792516-792538 GCAGGTGGGGGGAGGGAAGGGGG - Intronic
1077116913 11:889333-889355 GCTGGTCGGCCGAGGGAAGAGGG - Intronic
1077425006 11:2471327-2471349 GCAGATGGGGAGAGGGAGGAGGG - Intronic
1078015260 11:7607973-7607995 GGAGGTAGGGAAAGGAAAGAAGG + Intronic
1078541559 11:12217508-12217530 TCTGTGAGGCAGAGGGAAGAAGG - Intronic
1078604306 11:12761638-12761660 GAGGGTGGGCAGAGGGATGATGG + Intronic
1078962648 11:16296424-16296446 GCAGCTGAGCAGAAGGAAGATGG + Intronic
1079090295 11:17476202-17476224 GCAGCTGGGCCTAGGGAAGAGGG - Intronic
1079253829 11:18809329-18809351 GCAGGAAGGAAGAGGAAGGAAGG - Intergenic
1079840991 11:25399107-25399129 AGAGGAAGGGAGAGGGAAGAAGG - Intergenic
1079945693 11:26738142-26738164 GCAGATAGCTAGATGGAAGAAGG + Intergenic
1080054800 11:27895376-27895398 GGAGGTATGAAGAAGGAAGAAGG + Intergenic
1080240499 11:30121951-30121973 GCAGGTAGGCAGAGAGAGGCCGG - Intergenic
1080309618 11:30874502-30874524 GCAGGGAGGAAGAGGGAGGAGGG + Intronic
1080421342 11:32113716-32113738 GGACGTTGGCAGAAGGAAGAAGG - Intergenic
1080597452 11:33786517-33786539 GGAGGATGGCAGAGGGATGAGGG + Intergenic
1080691972 11:34565877-34565899 CCTGGTGGGCACAGGGAAGAGGG + Intergenic
1080770089 11:35332701-35332723 GCAGATGGGGAGAGGGAGGATGG - Intronic
1080943254 11:36943059-36943081 GCTGGAAGGCAGAGTGATGAAGG + Intergenic
1081079230 11:38718851-38718873 GCAGGTCAGCAGAGGGGAGCAGG - Intergenic
1081265869 11:41020519-41020541 ACAGACATGCAGAGGGAAGATGG + Intronic
1081601955 11:44501446-44501468 TGGGGTAGGCAGAGGGCAGAGGG - Intergenic
1081630843 11:44688558-44688580 GCGGGAAACCAGAGGGAAGAAGG + Intergenic
1081650189 11:44818596-44818618 GCAGGCAGGCAGAGGGGAATGGG - Intronic
1081666753 11:44921133-44921155 GCAGGAAGGCAGGGTGATGAGGG - Intronic
1081990030 11:47332756-47332778 GCAGGGAGGCTGTGGGAACAGGG - Intronic
1082782667 11:57299832-57299854 GCAGAGAGGGAGAGGGAAGGAGG + Exonic
1083272404 11:61579081-61579103 GGAGGGAGGGAGAGGGGAGAGGG + Intronic
1083399688 11:62415015-62415037 GTAGCTGGGCAGAGGGGAGAGGG - Intronic
1083758480 11:64803433-64803455 GCCAGAAGACAGAGGGAAGAGGG + Intergenic
1083881768 11:65552452-65552474 GCAGCTGGGCAGAGGGACGTGGG - Intronic
1084099149 11:66934034-66934056 GGAGGAAGGCAGTGGGAAGCCGG - Intronic
1084581881 11:70029268-70029290 GCCTGTGTGCAGAGGGAAGAGGG - Intergenic
1084742841 11:71150286-71150308 GGAGGGAGGGAGAAGGAAGAGGG + Intronic
1084954193 11:72682915-72682937 GCTGGGGGGCAGAGGGGAGAGGG - Intergenic
1085219789 11:74864340-74864362 GCAAAAAGGCAGAGAGAAGATGG + Intronic
1085392672 11:76190404-76190426 GGGGGTCGGCAGAGGGAAGATGG - Intronic
1085681085 11:78575450-78575472 GTTGGAGGGCAGAGGGAAGAGGG - Intergenic
1085888721 11:80552219-80552241 GCAGGTAGACTGAGTGAAGCAGG + Intergenic
1086131225 11:83404590-83404612 GGAGGGAGGCAGCAGGAAGATGG + Intergenic
1086152150 11:83623812-83623834 GCAGTTGGGCAGGGGGAAGAGGG + Intronic
1086571624 11:88291439-88291461 GAAGGAAGGAAGAAGGAAGAAGG + Intergenic
1086889988 11:92246282-92246304 GCATGTAGGCAGAGAGGAGAGGG + Intergenic
1086945623 11:92841258-92841280 GCAGGTATGCAGAGTATAGAAGG + Intronic
1087161120 11:94949084-94949106 GAAGGAAGTGAGAGGGAAGAAGG + Intergenic
1088470577 11:110184535-110184557 GGAAATCGGCAGAGGGAAGAAGG + Intronic
1088990453 11:114949032-114949054 GGAGGCAGGAAAAGGGAAGAAGG + Intergenic
1089399707 11:118157353-118157375 GGAGGAGGGCAGAGGGAGGAGGG + Intergenic
1089539286 11:119180309-119180331 ACAGGCATGAAGAGGGAAGAGGG + Intronic
1089612890 11:119679446-119679468 CCAGCTAGGCAGAGGGAAGTGGG + Intronic
1089638121 11:119829638-119829660 GCTGGTAGGGGGAGGGAAGGAGG + Intergenic
1089767898 11:120781878-120781900 GCAGGGAGGCACAGGGAGCAGGG - Intronic
1090456673 11:126855998-126856020 GGCTGCAGGCAGAGGGAAGATGG - Intronic
1090654364 11:128831661-128831683 GGAGGCAGGCACAGGGAGGAAGG + Intergenic
1091057793 11:132435120-132435142 TCAGGCAGGCAGAGGTAGGAAGG + Intronic
1091386572 12:99793-99815 ACAGGGAGGCAGAGGGCAGGAGG - Intronic
1091841277 12:3622993-3623015 CCAGGAAGGGAGAGGGAAGTGGG + Intronic
1092118127 12:6024059-6024081 GGAGGTAGGCAGAGGGACAGAGG - Intronic
1092119554 12:6034478-6034500 CCAGGTGAGCAGAGGGAAAATGG + Intronic
1092148718 12:6232539-6232561 GGAGTTAGGCAGAGGGAAACAGG + Intronic
1092273810 12:7044118-7044140 GGAGGGAGGCAAAGGGAGGAGGG - Intronic
1092495961 12:8995463-8995485 GTGGGGAGGGAGAGGGAAGAAGG - Intronic
1093182974 12:15988192-15988214 GCAGGTAACGAGAAGGAAGAAGG - Intronic
1095451588 12:42337196-42337218 GCAGAGTGGCAGAGGGGAGAGGG - Intronic
1095848616 12:46775537-46775559 GCAGGTAGGGACAGGGGAGGTGG - Intronic
1095925643 12:47576403-47576425 GCAGGTAGGAAGCTGGAAGGAGG - Intergenic
1096944182 12:55385981-55386003 GGAGGGAGGGAGAGGGAAGGAGG - Intergenic
1097029298 12:56080064-56080086 GGAGGAACGCAGAGGGAAGGGGG - Exonic
1097125340 12:56770139-56770161 GGAGAGAGACAGAGGGAAGAGGG + Intronic
1097707517 12:62883165-62883187 GCAGGTAGGCAGAAGTGAGCAGG - Intronic
1097751579 12:63360253-63360275 GGAGATTAGCAGAGGGAAGATGG - Intergenic
1097961474 12:65535704-65535726 GAAGGTAAGCACAGGGAACACGG + Intergenic
1098572391 12:72003088-72003110 CCAGGTAGGCAAAGACAAGAGGG - Intronic
1100002277 12:89851527-89851549 GAAGGTAGGCAGAAGGGAGAAGG - Intergenic
1100147234 12:91692820-91692842 GCAGGTAGTCAGGTGAAAGATGG - Intergenic
1100591060 12:96030027-96030049 GCAAGAAGCCAGATGGAAGAAGG - Intronic
1101298671 12:103454484-103454506 GCTGGTGGGAATAGGGAAGATGG - Intronic
1101779204 12:107820764-107820786 GCAGGTAGGCAAGGGGAGGATGG - Intergenic
1101838381 12:108310838-108310860 GCGGGTAGGCAGAGACAGGAGGG + Intronic
1102024086 12:109703636-109703658 GCAGGCGGGGAGAGGGCAGATGG - Intergenic
1102463588 12:113115131-113115153 CCAGGTAGGCACTGGGAAGGAGG + Intronic
1102484617 12:113247382-113247404 GCGGGAAGGCAGGGGGCAGAAGG - Intronic
1102531147 12:113547428-113547450 AGAGGGAGGCAGAGGGAGGAGGG + Intergenic
1102690569 12:114757303-114757325 GCAGGAAGGGAGAGGGATGCTGG + Intergenic
1103193713 12:119024416-119024438 GCAGGATGGCAGAGGGAATGTGG + Intronic
1103848520 12:123916114-123916136 CCTGGCAGGCTGAGGGAAGAGGG - Intronic
1103859882 12:124003749-124003771 TGAGGGAGTCAGAGGGAAGATGG + Intronic
1104048558 12:125181334-125181356 CCAAGAAGGAAGAGGGAAGAGGG + Intergenic
1105287961 13:19022778-19022800 GCAGGGAGGGGGAGGGAGGAAGG + Intergenic
1106171761 13:27294739-27294761 AGAGATATGCAGAGGGAAGATGG + Intergenic
1106174737 13:27320573-27320595 GCTGGTAAGCAGAGGGAAAAGGG + Intergenic
1107126208 13:36849648-36849670 GCAGGTATGGACAGGGAAAAAGG - Intronic
1108346432 13:49551153-49551175 GCAGGGAGGGAGAAGGAGGAAGG + Intronic
1108436645 13:50407159-50407181 GCAGCATGGCAGAGGGGAGAAGG + Intronic
1108503404 13:51087898-51087920 CCAGGAAGGCAGTGGGAAGATGG - Intergenic
1108731130 13:53236943-53236965 GTGGGTAGGCAGAGAAAAGAAGG + Intergenic
1111052285 13:82900408-82900430 GCAGGAAGCCAGAGAGAAAAGGG + Intergenic
1111096634 13:83524006-83524028 TCAGGAAGGCAGAAGGCAGAAGG - Intergenic
1111368952 13:87290552-87290574 GCAGGTAAGCAGAAGAAAAAAGG - Intergenic
1113431594 13:110255691-110255713 GCAGGAAGGGAGGGGGAAGGGGG + Intronic
1113431684 13:110255912-110255934 GCAGGAAGGGAGGGGGAAGGAGG + Intronic
1113432367 13:110261937-110261959 GCAGGTGGGCACAGGGCAGGTGG + Intronic
1113466604 13:110517846-110517868 GCAGGTGGGGTGGGGGAAGAGGG - Intergenic
1113618497 13:111697375-111697397 GAAGGGAGGCAGAGAGAGGAAGG - Intergenic
1113624026 13:111782636-111782658 GAAGGGAGGCAGAGAGAGGAAGG - Intergenic
1114557425 14:23570031-23570053 GCAGTAAGGCAGAGGGATGAAGG + Intronic
1114559257 14:23578759-23578781 GGAGGCAGGCAGAGAGGAGAAGG + Exonic
1114752371 14:25219379-25219401 GGAGCTAGGGAGAGGGAACATGG - Intergenic
1114792812 14:25679079-25679101 GCAGGTGGGGAGTTGGAAGAGGG - Intergenic
1116367383 14:44084194-44084216 TCGGGTAGGCAGAGCGGAGAGGG + Intergenic
1116940348 14:50784945-50784967 GAGAGTAGGCAGAGGGGAGAAGG + Intronic
1118147399 14:63155470-63155492 GCAGGCAGACAGAGATAAGAAGG + Intergenic
1118788993 14:69071596-69071618 GGAGGGAGGGAGGGGGAAGAGGG + Intronic
1119197284 14:72726456-72726478 GCTGATGGGCAGAGGGAGGATGG - Intronic
1119325092 14:73755131-73755153 GGAGAAAGGCAGAGGGAACAGGG + Intronic
1119532596 14:75373456-75373478 GAAGTTGGGGAGAGGGAAGAAGG + Intergenic
1119664323 14:76473693-76473715 GGAGGGAGGTGGAGGGAAGAAGG + Intronic
1119775838 14:77248320-77248342 GCAGTGAGGGAGAGGGAAGGTGG - Intronic
1119996467 14:79258827-79258849 ACAGATAGGCAGAGAAAAGAAGG + Intronic
1120042189 14:79766792-79766814 GCAGGCAGGCAGGAAGAAGAAGG + Intronic
1120178609 14:81320996-81321018 GAAGGGAGGTAGAGTGAAGAGGG - Intronic
1120598113 14:86465581-86465603 GGAGGGAGGGAGAGGGAGGAAGG + Intergenic
1121576103 14:94989515-94989537 GGAGGTAACCAGAGGGAATAAGG + Intergenic
1121854878 14:97258852-97258874 TTAGGGAGGCAGAGGCAAGAGGG + Intergenic
1122221007 14:100239139-100239161 GAAGGAAGGCAGAGGGAGGAAGG - Exonic
1122796269 14:104207685-104207707 GGAGGTAGGGGGAGGGGAGAGGG - Intergenic
1123990423 15:25679536-25679558 GAAGGTAGGCAGGCTGAAGAGGG + Exonic
1124408186 15:29410585-29410607 TCAGGAAGGCAGAGGGAGGCAGG - Intronic
1124440699 15:29684165-29684187 GCAGATTGGCAGAGGAAAGATGG - Intergenic
1124824388 15:33079377-33079399 GCAGGAAGGCTGAGGGAGGGAGG + Intronic
1124898957 15:33804731-33804753 GCAGGGAGGCAAAGGCAATAGGG - Intronic
1125525441 15:40371233-40371255 GCAGGTAGCCAAAGGGAAACTGG - Intergenic
1125786611 15:42323850-42323872 GTAAGCAGGGAGAGGGAAGAGGG + Intronic
1125856693 15:42956750-42956772 GCAGGTAGCCATGGGGATGATGG + Intronic
1126150218 15:45517175-45517197 GAAGTCAGGCAGAGGGAAAAAGG - Intronic
1126753259 15:51898831-51898853 AGAGGTAGGAAGAGAGAAGAAGG - Intronic
1126773074 15:52076935-52076957 GCAGGGAGGGGCAGGGAAGATGG - Intergenic
1126967567 15:54072645-54072667 TAAGGTAGGCAGAGATAAGATGG + Intronic
1127259643 15:57318860-57318882 GAAGGAAGGAAGAGGGAGGAAGG + Intergenic
1127259657 15:57318902-57318924 GGAGGAAGGAAGAGGGAAGGAGG + Intergenic
1127579845 15:60328204-60328226 GGAGGGAGGGGGAGGGAAGAGGG + Intergenic
1127655433 15:61051161-61051183 GAAGGATGGCAGAAGGAAGAGGG + Intronic
1128328555 15:66741075-66741097 GCCGGAAGGCAGAGGGATGAGGG - Intronic
1128355140 15:66921074-66921096 CCAGAGACGCAGAGGGAAGATGG + Intergenic
1128431413 15:67598504-67598526 GCAGGGAGGAGGAGGGGAGAGGG - Intronic
1128433949 15:67627037-67627059 ACAGGGAGGCTGAGGCAAGAGGG - Intronic
1128727939 15:70001525-70001547 GGAGGGAGAAAGAGGGAAGATGG + Intergenic
1130021555 15:80235705-80235727 GCAGGTGGGTAGAGGGGAGTTGG - Intergenic
1130573020 15:85065804-85065826 GCAGGGAGAGAGAGGGAAGGAGG + Intronic
1130936667 15:88476847-88476869 ACAGGGAGGCAAAGGGCAGATGG - Intronic
1131293620 15:91128650-91128672 ACAGAAAGGCAGAGGGAAGTGGG - Intronic
1131400344 15:92120440-92120462 GCAGGGAGACAGAAGGCAGATGG - Intronic
1131442683 15:92470858-92470880 ACAGGGAGCCAGAGGGAGGAGGG - Intergenic
1131833512 15:96368912-96368934 GCTGGATGGCGGAGGGAAGACGG + Intergenic
1131965775 15:97840754-97840776 ACTGGTGGGCAAAGGGAAGAGGG + Intergenic
1132590111 16:722903-722925 GCAGGTGGGCAGAGGGAGCTGGG - Exonic
1132760995 16:1508672-1508694 CCAGGTGGGGAGAGGGGAGATGG - Intronic
1132884267 16:2175696-2175718 GAAGGTAGGAACAGGGCAGATGG - Intronic
1133287334 16:4696749-4696771 GCCGGCAGACAGAGGCAAGACGG - Exonic
1133720364 16:8488966-8488988 GGGGGGAGGCAGAGGGAGGAAGG + Intergenic
1133923706 16:10177867-10177889 GAACGTAGGCAGAGAGAAGCCGG - Intronic
1134108229 16:11499127-11499149 GAAGGGAGGCAGAGGGGAGGGGG + Intronic
1134108240 16:11499150-11499172 GAAGGGAGGCAGAGGGGAGGGGG + Intronic
1134108251 16:11499172-11499194 GGAGGGAGGCAGAGGGGAGGGGG + Intronic
1134108262 16:11499195-11499217 GAAGGGAGGCAGAGGGGAGGGGG + Intronic
1134108273 16:11499218-11499240 GAAGGGAGGCAGAGGGGAGGGGG + Intronic
1134108284 16:11499241-11499263 GAAGGGAGGCAGAGGGGAGGGGG + Intronic
1134108295 16:11499264-11499286 GAAGGGAGGCAGAGGGGAGGGGG + Intronic
1134108306 16:11499287-11499309 GAAGGGAGGCAGAGGGGAGGGGG + Intronic
1134108316 16:11499310-11499332 GAAGGGAGGGAGAGGGGAGAGGG + Intronic
1134523643 16:14929199-14929221 ACAGGGAGGCAGAGGGAGGGTGG - Intronic
1134549254 16:15131737-15131759 ACAGGGAGGCAGAGGGAGGGTGG + Intronic
1134646446 16:15871376-15871398 GGAGTTAGGGAGAGGCAAGAAGG + Intronic
1134659334 16:15971906-15971928 GAAGGAAGGGAGAAGGAAGAAGG + Intronic
1134711235 16:16327684-16327706 ACAGGGAGGCAGAGGGAGGGTGG - Intergenic
1134719089 16:16370986-16371008 ACAGGGAGGCAGAGGGAGGGTGG - Intergenic
1134948338 16:18340899-18340921 ACAGGGAGGCAGAGGGAGGGTGG + Intergenic
1134955594 16:18381009-18381031 ACAGGGAGGCAGAGGGAGGGTGG + Intergenic
1135163698 16:20120159-20120181 GGAGGGAGGGAGAGGGAGGAAGG - Intergenic
1135899238 16:26441514-26441536 GCTGGAAGGCAGAAGGGAGATGG - Intergenic
1136240280 16:28939051-28939073 TCAGGGAGGGAGAGGGAACAGGG + Intronic
1136513820 16:30756052-30756074 GAAGGCAGACAGAAGGAAGATGG + Intronic
1136516089 16:30769158-30769180 GCAAGTGGGCAGAGACAAGATGG - Intronic
1136627764 16:31472349-31472371 GCAGGAAGGGAGAGGCAGGAAGG - Intronic
1137704957 16:50528595-50528617 GCAAGAAGGCAGGGAGAAGATGG + Intergenic
1138026160 16:53523910-53523932 TGAGGTAGGCAGAGAGAAGGAGG - Intergenic
1138076690 16:54049725-54049747 GAATGTAGGCAAAGGGAAGAGGG + Intronic
1138153965 16:54685865-54685887 GGAGGGAGGAGGAGGGAAGAGGG - Intergenic
1138272544 16:55706013-55706035 GCAGAGAGACAGAGGGATGAGGG - Exonic
1138287392 16:55820793-55820815 GGAGGCAGGCAGAGGAAGGAGGG - Intronic
1138514944 16:57530830-57530852 GCAGGTAGACGGAGTGGAGACGG - Intronic
1138609364 16:58110662-58110684 CCAGTGAGGCTGAGGGAAGAGGG - Intergenic
1138710219 16:58962584-58962606 CCAGATAGGAAGAGAGAAGAGGG - Intergenic
1139004190 16:62551239-62551261 GCAGGGAGGGAGGGGGAGGAAGG - Intergenic
1139526436 16:67519544-67519566 GAAAGTGGGCATAGGGAAGAGGG + Intronic
1139558510 16:67727625-67727647 CCAGGTCTGCAGAGGGAAGTGGG - Intronic
1139946044 16:70642910-70642932 GCTGGGAGGAAGAGGGAATAGGG + Intronic
1140094246 16:71861360-71861382 GCAGGTAGTGTGAGGGAAGGAGG - Intronic
1141049529 16:80747850-80747872 CCAGGTGGGCAGAGGTAGGAAGG - Intronic
1141235261 16:82210090-82210112 GAAGGAAGGAAGAGGGAAGGGGG - Intergenic
1141585058 16:85028078-85028100 GCTGGGAGGCAAAGGGAATAGGG + Intronic
1141606063 16:85154080-85154102 GCAGGTAGGCAGGAGGAGGGGGG - Intergenic
1141948043 16:87323678-87323700 GCAGGTCTGCAGAGGACAGACGG - Intronic
1141955292 16:87366749-87366771 GAGGGGAGGCAGAGGGCAGACGG + Intronic
1142008260 16:87700639-87700661 GCTGGAGGGCAGAGGGAGGAGGG + Intronic
1142065928 16:88062754-88062776 GCCGGCAGGGAGAGGAAAGAAGG + Intronic
1142198405 16:88749471-88749493 GCAGGCAGGCTGCGGGGAGATGG + Exonic
1142691998 17:1612291-1612313 TCAGGGAGGCAGAAGGAAGGTGG - Intronic
1142848848 17:2694738-2694760 CCAGGGAGTCAGAGAGAAGAGGG - Intronic
1142958214 17:3535351-3535373 GCAGGAAGGATGAGGGAGGAAGG - Intronic
1143365453 17:6405622-6405644 GCTTGTGGGCAGAGGGAAGGAGG - Intronic
1143370653 17:6436898-6436920 GGAGGAGGGAAGAGGGAAGAGGG + Intergenic
1143374931 17:6461842-6461864 GGAGGGAGGCACAGGGAACAGGG - Intronic
1143392510 17:6568186-6568208 GCAGGAAGGCAAAGGCAAAAAGG + Intergenic
1143712866 17:8745931-8745953 GGAGGGAGGCAGAGAGAAGAGGG - Intergenic
1143879813 17:10021469-10021491 GCAGCTACGCAGAGGGCAGAAGG - Intronic
1144246339 17:13369488-13369510 ACAGGTAGACAGAGAGGAGAGGG + Intergenic
1144246479 17:13371004-13371026 ACAGGTAGACAGAGAGGAGAGGG + Intergenic
1144568819 17:16382043-16382065 GCAGGCAAGCAGCTGGAAGATGG + Exonic
1144568855 17:16382271-16382293 GCAGGCAAGCAGCTGGAAGATGG + Exonic
1144568891 17:16382499-16382521 GCAGGCAAGCAGCTGGAAGATGG + Exonic
1144730438 17:17522917-17522939 GCACTTGGGCAGAGGGAGGAGGG - Intronic
1144738189 17:17566543-17566565 TCAGGAAGGCACAGGGAGGAGGG + Intronic
1145124009 17:20285743-20285765 ACAGGGAGGGGGAGGGAAGAAGG - Intronic
1145298299 17:21612170-21612192 GCAAGTGGGCGGAGGAAAGAGGG - Intergenic
1145306229 17:21676794-21676816 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1145360014 17:22204228-22204250 GCAGGCAAGCAGCGGGAAGATGG + Exonic
1145360050 17:22204456-22204478 GCAGGCAAGCAGCTGGAAGATGG + Exonic
1145360083 17:22204683-22204705 GCAGGCAAGCAGCTGGAAGATGG + Intronic
1146634701 17:34495256-34495278 GCAGGGAGGCAGAGCCAAGGTGG + Intergenic
1147002492 17:37373930-37373952 GCAGGCAGCCAGAGGCAAGAGGG + Intronic
1147158544 17:38557895-38557917 GAAAGTAGGCAGAGGGCAGAGGG + Intronic
1147360068 17:39924810-39924832 TCAGGTAGAAAGAGGGAAGTGGG + Intronic
1147563768 17:41524360-41524382 CCGGGTAGGTAGAGGGAAGCAGG - Exonic
1147575138 17:41594626-41594648 GGAGGAAGGGAAAGGGAAGAGGG + Intergenic
1147919065 17:43905558-43905580 CCAGGAAGGCAAAGGGAAGAAGG - Intronic
1148003811 17:44408500-44408522 GCAGGTGGCTAGAGAGAAGATGG - Intronic
1148073385 17:44921591-44921613 TCAGGGAGGCAGAGGGGAGTGGG - Intergenic
1148157355 17:45431752-45431774 GCTGGCAAGCAGAGCGAAGAGGG + Intronic
1148184199 17:45629787-45629809 GCACGGAGGGAAAGGGAAGAGGG + Intergenic
1148203336 17:45764303-45764325 AAAGGAAGGAAGAGGGAAGAGGG + Intergenic
1148682149 17:49480458-49480480 GCTGGGAAGCAGAGGGGAGAAGG + Intergenic
1148772977 17:50077514-50077536 GCAGGCAGGCAGAGGCTGGAAGG - Intronic
1149040376 17:52181521-52181543 GCATGGAGGCAGAGGCAAGATGG + Intergenic
1149484903 17:57034991-57035013 GCAGGCTGGCAGAAGGAAGCTGG - Intergenic
1149597387 17:57872396-57872418 GCAGGTGTGCAAAGGGAAGAAGG + Intronic
1150200394 17:63350296-63350318 GGGGGAAAGCAGAGGGAAGAGGG - Intronic
1150823974 17:68457881-68457903 GCTGGGAGGGAGAGGGAAGAAGG + Intergenic
1151158799 17:72147232-72147254 GAAGGAAGGAAGAAGGAAGAAGG + Intergenic
1151183340 17:72345533-72345555 CCAGGAAGGCAGAAAGAAGAGGG + Intergenic
1151204287 17:72494345-72494367 GCAGTCAGGTAGAGGGAAGGAGG - Intergenic
1151266436 17:72959569-72959591 GAAGGGTGGCAGAGGGAGGAGGG + Intronic
1151420525 17:73994095-73994117 GCTGGGAGGAAGATGGAAGAGGG + Intergenic
1151444301 17:74153182-74153204 ACAGGCAGGCAGAGGGGAGCAGG - Intergenic
1151762322 17:76112290-76112312 GGAGGGAGACAGAGGGAGGAAGG + Intronic
1152301015 17:79495407-79495429 GGAGGTAGGAAGGGGGAACAGGG + Intronic
1152763617 17:82122798-82122820 GCCGGTAGGCAGTGGGAAATGGG - Intronic
1152937999 17:83151923-83151945 GCAGGGAGACAGTGGGCAGAAGG + Intergenic
1153762447 18:8344907-8344929 GGAGGTAGGGAGAGGGAGGAGGG + Intronic
1154432786 18:14321129-14321151 GGTGGTGGGCAGAAGGAAGAGGG + Intergenic
1155750994 18:29422215-29422237 GCAGGTAATCAGAGGAAAGGCGG - Intergenic
1156069861 18:33193959-33193981 GCAGACAGGCAGAGGCAAAAGGG + Intronic
1156448886 18:37255303-37255325 GCAGGTAGGGAAAGTGAGGAAGG - Intronic
1156491987 18:37501714-37501736 GTAGGTAGGAAGAAGGAGGAGGG + Intronic
1156859021 18:41815071-41815093 GGAGAAAGGAAGAGGGAAGAAGG + Intergenic
1157106759 18:44781089-44781111 GCAGGTAGGAACAGGGTACAGGG + Intronic
1158053660 18:53254554-53254576 CCAGTTAGGAATAGGGAAGAAGG - Intronic
1158102436 18:53844230-53844252 GGAGGTGGGCAGGGAGAAGAGGG + Intergenic
1158633341 18:59135066-59135088 TCAGGTAAGGAGAGGGAATATGG + Intergenic
1158934127 18:62349041-62349063 GATGGAAGGCAGAGGGGAGAGGG + Intronic
1159626988 18:70706779-70706801 GTAGGAAGGCTGAGGGATGAGGG - Intergenic
1160172544 18:76566952-76566974 ACAGGTAGGGGAAGGGAAGAGGG - Intergenic
1160509839 18:79447232-79447254 GTCAGTGGGCAGAGGGAAGATGG - Intronic
1161255987 19:3310029-3310051 GGAGGGAGGGAGGGGGAAGAAGG - Intergenic
1161403952 19:4081646-4081668 GCAGGGAGGAGGAGGGAGGAGGG - Intergenic
1161640066 19:5416931-5416953 GCAAGAAGGAAGAGGAAAGAAGG + Intergenic
1161643367 19:5437303-5437325 GAGGGTAGGCAGAGGCAGGAGGG + Intergenic
1161833370 19:6627014-6627036 GGAGGGAGGCAGGGGAAAGAAGG - Intergenic
1162299180 19:9834726-9834748 ACAGGTGGGAAGAGGGAGGATGG + Intergenic
1162958318 19:14112167-14112189 GCAGGCAGAGAGAGGGATGATGG + Intronic
1163093283 19:15036123-15036145 GAAGGAAGGAAGAGGGAAGAAGG + Intergenic
1163302649 19:16457597-16457619 GCAGCCATGCAGAGGGCAGAAGG + Intronic
1164442658 19:28291284-28291306 GCAGGGAGGGAGGGGGCAGAGGG - Intergenic
1164744120 19:30599000-30599022 GGAGGAAGGAAGAGGGAAGGAGG - Intronic
1164932939 19:32189136-32189158 GAAGGAAGGAAGAAGGAAGAAGG + Intergenic
1165720149 19:38073285-38073307 GGAGGGAGGCAGAGGGAATGGGG + Intronic
1166083159 19:40457868-40457890 GGAGGCAGGCAGAGGGGATAGGG - Intronic
1166373508 19:42314920-42314942 GCAGGAAGGCAAAGAGAAGGTGG - Intronic
1166428236 19:42698717-42698739 GCAGGTAGGAAGAGACAAGTAGG - Intronic
1166818898 19:45564299-45564321 GGGGGCAGGTAGAGGGAAGAAGG + Intronic
1167052970 19:47090897-47090919 GGGGGCAGGCAGAGGGGAGAAGG + Intronic
1167112850 19:47472027-47472049 GGAGGCGGGCAGAGGGAAGGCGG + Exonic
1167359978 19:49024743-49024765 ATAGGTTGGCACAGGGAAGAGGG + Intronic
1167361106 19:49031028-49031050 ATAGGTTGGCACAGGGAAGAGGG - Intronic
1167363584 19:49043415-49043437 ATAGGTTGGCACAGGGAAGAGGG - Intergenic
1167698778 19:51030221-51030243 GCAGGGAGAGAGAGGGAGGAAGG - Intronic
1168099627 19:54134160-54134182 GGAGGGAGGGAGAGGGAAGGTGG - Intergenic
1168099635 19:54134181-54134203 GGAGGGAGGGAGAGGGAAGGTGG - Intergenic
1168312205 19:55465996-55466018 GCTGGCAGGCAGAGGGACCAAGG - Intergenic
1168350594 19:55673829-55673851 GCAGGAAGGGACAGGGAGGAGGG - Intronic
925366203 2:3313854-3313876 CGAGGAAGGCAGAGGCAAGAGGG + Intronic
926313898 2:11695695-11695717 GCGGGTGGCCAGAGGGAAGCTGG + Intronic
926604899 2:14887578-14887600 GGAATGAGGCAGAGGGAAGACGG - Intergenic
926610004 2:14937119-14937141 GGAAGTAGGAAGAGTGAAGAGGG + Intergenic
926629199 2:15121396-15121418 GCAGGAAGGCAGACTGATGATGG + Intergenic
926734288 2:16060910-16060932 TCAGGGAGGAAGAGAGAAGATGG - Intergenic
927042130 2:19240368-19240390 GCAGGCAGTCAGAGGGAGGAGGG - Intergenic
927517259 2:23679764-23679786 GGAGGAGGGCAGAGGGCAGAGGG + Intronic
928094366 2:28394557-28394579 GGAGACCGGCAGAGGGAAGAGGG + Intronic
928201329 2:29249479-29249501 GGAGGCATGCAGAGGGCAGAAGG - Intronic
928995227 2:37282335-37282357 ACAGGTGGCCAGAGGAAAGACGG + Intronic
929011308 2:37447752-37447774 GCAGGGAGGCAGAAGGCAGGTGG + Intergenic
929305210 2:40353678-40353700 GCAGGTAGGCAGCATAAAGAAGG - Intronic
929731181 2:44494414-44494436 GTACGTAAACAGAGGGAAGAGGG - Intronic
930034927 2:47079408-47079430 TGAGGTAGGCAGAGGGAAGCGGG + Intronic
930589587 2:53311725-53311747 GAAGGAAGGGAGAAGGAAGAAGG - Intergenic
931423754 2:62152109-62152131 GGAGGTGAGCAGAGGGAAGATGG - Intergenic
931482513 2:62656132-62656154 GAAGGAAGGAAGAAGGAAGAAGG - Intergenic
931571169 2:63670703-63670725 GCAAGTTGGCAAAGGGCAGATGG - Intronic
932208202 2:69902886-69902908 GGAGGAAGGAAGAGGGAAGTAGG - Intronic
932863898 2:75321723-75321745 GCAGGGAGGCTGAGGGAGGAGGG - Intergenic
933431495 2:82185882-82185904 GAAGGAAGGAAGAGGAAAGAAGG + Intergenic
933949857 2:87319631-87319653 CCAGGTTGGCAGCTGGAAGAGGG + Intergenic
934715286 2:96539467-96539489 GCAGGTATGCAAAGGCAGGAAGG - Intronic
934792149 2:97070478-97070500 GTAGGAAAGCAGAAGGAAGAAGG - Intergenic
934814473 2:97313231-97313253 GTAGGAAAGCAGAAGGAAGAAGG + Intergenic
934823220 2:97395252-97395274 GTAGGAAAGCAGAAGGAAGAAGG - Intergenic
935606926 2:104980860-104980882 GCAGGTAGTGAGAGAGAAAAGGG - Intergenic
935676379 2:105598083-105598105 GGAGGCAGGCAGAGGGAGGCAGG - Intergenic
936330335 2:111541966-111541988 CCAGGTTGGCAGCTGGAAGAGGG - Intergenic
936341617 2:111638727-111638749 GCAGGCAGGGAGAGGGGAGTAGG - Intergenic
937047547 2:118859613-118859635 GCAGGTGTGCAGAGAGAAGCGGG + Intergenic
937123222 2:119455173-119455195 GGAGGTGGGCAGAGGGTAGAGGG - Intronic
937221514 2:120345322-120345344 GCAGGCAGGCGGAGGGAAGGAGG + Intergenic
937284337 2:120740853-120740875 GCAGGCAGCTAGAGGGAGGAGGG + Intronic
937308321 2:120885667-120885689 GCAGGTGGGCAGAGGGACTCAGG + Intronic
937340318 2:121086936-121086958 TCAGGGATGTAGAGGGAAGATGG + Intergenic
938252906 2:129829434-129829456 GCAGTTAGGCAGAAAGCAGAAGG + Intergenic
938592296 2:132751302-132751324 GCTGGAAGGCAAAGGGAAGCAGG - Intronic
938694679 2:133824511-133824533 GGAGAGAGGCAGAGGGAACATGG + Intergenic
938797620 2:134731531-134731553 TCAGGAAGACAAAGGGAAGAAGG - Intergenic
938821055 2:134960573-134960595 GCTGGTAAGGAGAGGGAAGCTGG - Intergenic
938959613 2:136329517-136329539 GCAGGCAAGCAGCTGGAAGATGG - Intergenic
939950589 2:148468238-148468260 TCAGGAAGGGAGAGGGAGGATGG - Intronic
940635254 2:156291494-156291516 GCAGCCAGGCTGAGGAAAGAGGG + Intergenic
941001711 2:160209121-160209143 CCAGACAGGCAAAGGGAAGAGGG + Intronic
941010847 2:160297831-160297853 GCAGGAAGGCAGAGGATGGAGGG + Intronic
941376452 2:164737234-164737256 CCAGGAAAGCAAAGGGAAGAGGG + Intronic
941474878 2:165938725-165938747 GGAGGGAGGGAGAGGGAAGAGGG + Intronic
941569214 2:167148478-167148500 GGAGGGAGGGAGAGGAAAGAAGG + Intronic
943272745 2:185828339-185828361 TCAGCTAGGAAGAGGGAACAGGG - Intronic
944398635 2:199299549-199299571 CAAGGTAGCCAGAGGGAAAATGG + Intronic
944633568 2:201652829-201652851 GCAGGGAGGGAGAGGAAAGCAGG + Intronic
945795922 2:214363672-214363694 GCAGGGGGGCTGAGGAAAGAGGG + Intronic
945958699 2:216109702-216109724 GCAGGTAGAGAGGGAGAAGAGGG - Intronic
946020671 2:216637771-216637793 CCTGTCAGGCAGAGGGAAGAGGG + Intronic
946021683 2:216644449-216644471 CCAGGAAGTCAAAGGGAAGAGGG + Intronic
946231150 2:218292045-218292067 GCTGGTGAGAAGAGGGAAGAGGG - Intronic
946239593 2:218345497-218345519 GCAGGGAGGCTGTGGGAAGAGGG - Exonic
946276085 2:218632912-218632934 GAAGGGAGGCAGAGGGAGAAGGG + Intronic
946346928 2:219118456-219118478 GGGGGTAGGCAGTGGGAAGATGG + Intronic
946528524 2:220546524-220546546 GAAGGAAGGAAGAAGGAAGAAGG - Intergenic
947360766 2:229343202-229343224 GATGGTAGGAAGTGGGAAGACGG - Intergenic
947501742 2:230675879-230675901 ACAGGTGGGCAGAGGAAAGAGGG - Intergenic
947741967 2:232488708-232488730 GCAGGCAGGCAGGTAGAAGAGGG - Intergenic
947751653 2:232535712-232535734 GTAGGTAGGAAGAGGGAGGCTGG - Exonic
947776806 2:232718831-232718853 GTAGGTAGGCAGTGGGAATGGGG + Intronic
948062522 2:235052183-235052205 ACAGAGAGGCAGAGAGAAGAAGG - Intronic
948657641 2:239486583-239486605 GCAGGTAGGGAGAGGGTGGTGGG - Intergenic
948741830 2:240053441-240053463 TCAGGTAAGCAGTGGGCAGACGG - Intergenic
948762946 2:240203948-240203970 GCAGGGAAGCAGAGGGCTGAGGG + Intergenic
948847149 2:240688509-240688531 ACAGGTAGGCAGAGGGTTCAGGG + Intergenic
1168808277 20:685810-685832 ACCGGGAGGCAGAGGTAAGAGGG + Intergenic
1168909931 20:1439690-1439712 GCAGGGAGGGACAGGGAAAACGG - Intergenic
1169190983 20:3659299-3659321 GCAGGAAACCAGGGGGAAGATGG + Intronic
1169346632 20:4834176-4834198 GCAGGTAGGGAGAGGTGAGCTGG + Intergenic
1169413189 20:5392260-5392282 TCAACTATGCAGAGGGAAGAGGG - Intergenic
1169890741 20:10449419-10449441 GGCGTGAGGCAGAGGGAAGAAGG + Intronic
1170465751 20:16621141-16621163 ACAGGTAGCCTGAGGGAGGATGG - Intergenic
1170497389 20:16939568-16939590 GCAGGTAGGCAGACATAAGCAGG + Intergenic
1170700421 20:18698679-18698701 GCAGGCAGGGAGCGGGAGGAGGG - Intronic
1170819446 20:19743989-19744011 GTAGGTGGGCTAAGGGAAGAAGG - Intergenic
1171027077 20:21640590-21640612 GCAGGAAGACAGAGCCAAGATGG + Intergenic
1171151885 20:22834781-22834803 GGAGGGAGGGAGAGGGAGGAAGG - Intergenic
1171178985 20:23077589-23077611 GAAGGGAGGGAGAGGGAGGAGGG - Intergenic
1171178993 20:23077607-23077629 GAAGGGAGGGAGAGGGAGGAAGG - Intergenic
1171342996 20:24445179-24445201 GTGGGTAGGAAGAGGGAAGGGGG - Intergenic
1171523723 20:25794296-25794318 GGAGGGAGGCAGAGGGCTGAGGG - Intronic
1171524186 20:25796739-25796761 GGAGGGAGGCAGAGGGTTGAAGG - Intronic
1171531472 20:25856255-25856277 GAAGGGAGGCAGAGGGCTGATGG - Intronic
1171532560 20:25862097-25862119 GGAGGGAGGCAGAGGGTTGAAGG - Intronic
1171532890 20:25863754-25863776 GAAGGGAGGCAGAGGGCTGATGG - Intronic
1171533322 20:25866255-25866277 GGAGGGAGGCAGAGGGCTGATGG - Intronic
1171552641 20:26059144-26059166 GGAGGGAGGCAGAGGGTTGAAGG + Intergenic
1171553104 20:26061587-26061609 GGAGGGAGGCAGAGGGCTGAGGG + Intergenic
1171573540 20:26276649-26276671 GGAGGGAGGCAGAGGGCTGATGG + Intergenic
1171806723 20:29687752-29687774 GGAGGGAGGCAGAGGGCTGATGG + Intergenic
1171807035 20:29689364-29689386 GGAGGGAGGCAGAGGGCTGATGG + Intergenic
1171837325 20:30168777-30168799 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1171847067 20:30283751-30283773 GGAGGGAGGCAGAGGGCTGATGG + Intergenic
1172026656 20:31953253-31953275 GCAGGAGGTCAGAGGGAAGGAGG + Intergenic
1172195271 20:33087253-33087275 GGAGGGAGGCAGAGGGAGGTGGG - Intronic
1172436042 20:34929613-34929635 GGAGGTAGGCAGAGGGTCCAGGG - Intronic
1172612149 20:36260298-36260320 GGAAGTGGACAGAGGGAAGAGGG - Intronic
1173531295 20:43771767-43771789 GCTGATAGGCTGGGGGAAGAGGG + Intergenic
1173581866 20:44152675-44152697 ACAGGTCACCAGAGGGAAGAGGG - Intronic
1174045191 20:47728183-47728205 GCAGCTGGACCGAGGGAAGAAGG + Intronic
1174297766 20:49561189-49561211 GCAGCCAGGTAGAGGGAAAAAGG - Intronic
1174597182 20:51693378-51693400 GCTGGTAGGCAGAGGAGAGAGGG + Intronic
1174864213 20:54119947-54119969 GGAGGAAGGCAGGGAGAAGAAGG + Intergenic
1175244284 20:57572286-57572308 GCTGCTAGGGAGAGGGGAGAAGG - Intergenic
1175246381 20:57584786-57584808 GCAGGGAGTCAAAGGGGAGATGG + Intergenic
1175693275 20:61081894-61081916 GCAGGTAACTTGAGGGAAGAGGG - Intergenic
1175722137 20:61293927-61293949 GCCCGTAGGCACAGGGAAGCTGG + Intronic
1176057097 20:63154711-63154733 GGAGGGAGGAAGAGGGAGGAGGG - Intergenic
1176057114 20:63154763-63154785 GGAGGGAGGAAGAGGGAGGAGGG - Intergenic
1176099902 20:63360212-63360234 CCAGGCAGGAAGAGGGAGGAAGG + Intronic
1176679477 21:9811708-9811730 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1176679765 21:9813116-9813138 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1176680047 21:9814525-9814547 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1176680331 21:9815934-9815956 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1176680615 21:9817343-9817365 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1176680900 21:9818748-9818770 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1176681183 21:9820155-9820177 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1176681468 21:9821574-9821596 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1176681756 21:9822983-9823005 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1176682030 21:9824392-9824414 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1176682311 21:9825793-9825815 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1176682591 21:9827202-9827224 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1176682870 21:9828621-9828643 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1176683149 21:9830018-9830040 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1176683428 21:9831428-9831450 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1176683709 21:9832837-9832859 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1176683987 21:9834240-9834262 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1176684266 21:9835649-9835671 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1176684544 21:9837050-9837072 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1176684826 21:9838453-9838475 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1177482571 21:21709766-21709788 GCAGGAAGGAAGAGAGAGGAGGG + Intergenic
1177996875 21:28111282-28111304 GCTGGTAAGCAAAGAGAAGACGG - Intergenic
1178054054 21:28779504-28779526 TCAGTTAGGCAGAAGGAATAAGG + Intergenic
1178286275 21:31328045-31328067 GCATCGAGGCAGAGGGCAGAGGG - Intronic
1178791591 21:35705183-35705205 GAAGGAAGGGGGAGGGAAGAAGG + Intronic
1178914412 21:36698813-36698835 GCAGGGAGGGCGAGGGAAGGAGG - Intergenic
1179106474 21:38404984-38405006 GAAGGAAGGAAGAGGGAAGGAGG - Intronic
1179489128 21:41728708-41728730 GAAGGCGGGTAGAGGGAAGAAGG + Intergenic
1179572689 21:42287183-42287205 AGATGTAGGCAGAGGGAAGGAGG + Intronic
1180186868 21:46144560-46144582 GGAGGGAGACAGAGGGAGGAGGG - Intronic
1180824495 22:18853307-18853329 GCAGCTGCGCAGAGGGAAGCAGG - Intronic
1180979588 22:19872335-19872357 GCAGGTGGGCAGAGGCCAGCAGG + Intergenic
1181124918 22:20696462-20696484 GCAGCTGCGCAGAGGGAAGCAGG - Intergenic
1181188239 22:21121241-21121263 GCAGCTGCGCAGAGGGAAGCAGG + Intergenic
1181210957 22:21289252-21289274 GCAGCTGCGCAGAGGGAAGCAGG - Intergenic
1181349188 22:22243347-22243369 CCAGAGAGGCAGTGGGAAGAAGG + Intergenic
1181533567 22:23530532-23530554 TCAGGTGGGCTGAGGGCAGAGGG + Intergenic
1181545439 22:23599688-23599710 GCTGGAGGGCAGAGGGAGGAAGG - Intergenic
1181728409 22:24827379-24827401 GCAGGTGGGGAGAGGGAGGGAGG + Intronic
1181814871 22:25430211-25430233 GCTGGAGGGCAGAGGGAGGAAGG + Intergenic
1182511984 22:30826404-30826426 CCAAGTAGGCAGAGGGAGGCTGG - Intronic
1182551307 22:31102254-31102276 GGTGGGAGGGAGAGGGAAGATGG + Intronic
1182845414 22:33426954-33426976 GCAGGTCGGTAGAAAGAAGATGG - Intronic
1183091792 22:35527210-35527232 GGAGGGGGGCAGAGGAAAGAGGG + Intergenic
1183191178 22:36322891-36322913 GCAAGGAGGTAGAGGGAAGCTGG - Intronic
1183416931 22:37688012-37688034 GGAGGTACGCAGGGGGAAGGTGG + Exonic
1184098590 22:42329807-42329829 GCAGGCAGGCAGGGGGAGGAAGG - Intronic
1184106736 22:42371745-42371767 CCAGGCAGGAAGAGGGAGGAGGG - Intergenic
1184186509 22:42868693-42868715 GCAGGGCAGGAGAGGGAAGATGG + Intronic
1184239346 22:43203770-43203792 GAAGGGAGGCAGAGGGAGGGAGG + Exonic
1184568290 22:45306604-45306626 GCAGGCAGGGGAAGGGAAGAGGG - Intergenic
1184605874 22:45574609-45574631 GAAGGTAGGCAGCGAGATGACGG - Exonic
1184644475 22:45888763-45888785 CCAGGCAGGGAGAGGGAAGGAGG - Intergenic
1184924177 22:47625868-47625890 GCAGGGAGGCAGGGCGAAGACGG - Intergenic
1185339292 22:50284393-50284415 CCAGGGAGGCAGAGGGCAGAGGG + Intronic
1203215988 22_KI270731v1_random:6178-6200 GCAGCTGCGCAGAGGGAAGCAGG + Intergenic
949276140 3:2284049-2284071 GCATGTTAGCAGAGGGAAAAAGG + Intronic
949896645 3:8772173-8772195 GCTGGTAGCCACAGGGAAGATGG + Intronic
950139258 3:10604040-10604062 GTATGGAGGCAGAGGGAGGAGGG - Intronic
950379476 3:12599263-12599285 GCAGTTAGGCATAGGAAAGCTGG - Intronic
950702821 3:14761806-14761828 GCAGGTGGGCAGGGGAGAGATGG + Intronic
950806969 3:15613513-15613535 GAAGGTAAGGAGGGGGAAGAGGG - Intronic
951607290 3:24450040-24450062 GGAAGTAAACAGAGGGAAGAAGG + Intronic
951738068 3:25889709-25889731 GCAGGCAGGCAGTGGGGAGCAGG - Intergenic
952881642 3:37989587-37989609 GCGGGTGGGCTGAGGGGAGATGG + Intronic
953113016 3:39961888-39961910 TCAGGTAGGCCCAGGGAATAAGG + Intronic
953230268 3:41058383-41058405 GGAGGGAGGAAGAGGGAGGAGGG + Intergenic
953747930 3:45589345-45589367 GTAGGTAGGCAGAGTGTAAATGG - Intronic
953916136 3:46922318-46922340 GCAGGGAGGCAGGGAGAAGCAGG + Intronic
954163855 3:48740514-48740536 GCAGTTCTGCAGAGGGAGGAAGG + Intergenic
954176916 3:48852096-48852118 GCAAGTATGCAGAGGGCATAAGG - Intergenic
954198374 3:49009355-49009377 GCAGTTAGCCAGAGGAAAGGAGG - Intronic
954396467 3:50295928-50295950 CAAGGTGGGCAGAGGAAAGAAGG - Intronic
954411576 3:50373512-50373534 GCAGGGAGGGGGAGGGAGGAGGG + Intronic
954411740 3:50374063-50374085 GGAGGAAGGGAGAGGGAGGAGGG + Intronic
954635419 3:52068407-52068429 GGAGGAAGGGAGAGGGAGGAAGG + Intergenic
954787328 3:53103610-53103632 GGAGGAAGGCAGAGGGCAGACGG - Intronic
954794225 3:53153345-53153367 GTGGGGAGGCAGAGGGAGGAAGG + Intergenic
955155306 3:56411315-56411337 GCAGGCAAGCAGATGGAAGGTGG - Intronic
956142342 3:66158738-66158760 GTAGAGGGGCAGAGGGAAGAAGG + Intronic
956160395 3:66345496-66345518 GCAGGGAGGTAGAGGGTAGGGGG - Intronic
956757715 3:72405584-72405606 GGAGGTAGAAATAGGGAAGAGGG - Intronic
957117969 3:76050691-76050713 TCAGGTATGGAGAGAGAAGAGGG - Intronic
957532311 3:81456009-81456031 GAAGGTAGCAAGTGGGAAGAGGG + Intergenic
957683440 3:83469760-83469782 GGAGGTTGGGAGAGGGGAGAGGG + Intergenic
958176964 3:90008196-90008218 GCAGGTAGGGAGGGGGGAGCTGG + Intergenic
959525053 3:107367456-107367478 GCAGGTAGGCAGGAAGAGGAAGG + Intergenic
960595262 3:119402394-119402416 GCAGGTAAGTAGAGGAGAGAGGG + Exonic
961013390 3:123449789-123449811 GCGGGGAGGCAGCGGGAGGAGGG - Intergenic
961151069 3:124638408-124638430 GCTGGTAGGAAAAGGAAAGATGG - Intronic
961324453 3:126102089-126102111 GCAGGTGGGAAGTGGGAAAAAGG + Intergenic
961381737 3:126500038-126500060 GCAGGTAGGAGGAAGGAGGAGGG - Exonic
962867771 3:139461837-139461859 CCTGGCAGGCAGAGGGAAGAGGG - Intronic
962916141 3:139905709-139905731 TCATGCAGGCTGAGGGAAGAGGG - Intergenic
963124130 3:141799196-141799218 GCAAATGGGGAGAGGGAAGAAGG + Intronic
963918851 3:150886726-150886748 CCAGGGAAGCAGAGGGAGGAGGG - Intronic
963977291 3:151495707-151495729 GCATCTAGCCAGAGGGGAGAAGG + Intergenic
964303116 3:155310806-155310828 GAAGGTAGGCACAGGGAAAGTGG + Intergenic
964377278 3:156060620-156060642 GCAGGAAGGCAGAGAGAGGCAGG - Intronic
965138728 3:164808012-164808034 GCTGGTAGGCAGTAGGAACATGG - Intergenic
965342391 3:167506147-167506169 GAAGGGAGGCAGAAGGAAGAGGG - Intronic
965927112 3:173995280-173995302 GCAGGTGGACAGAGAGAAGCAGG - Intronic
966596034 3:181725654-181725676 GCAGGTGGGAAGAGTGAAGGGGG - Intergenic
966636914 3:182145286-182145308 GGAGGTTAGGAGAGGGAAGAAGG - Intergenic
966831841 3:184017119-184017141 GCAGGTGGGCACAGGAACGACGG - Intronic
966905091 3:184516839-184516861 ACTGGTGGGCAGAGGGAGGAAGG + Intronic
967199840 3:187063255-187063277 GGCGGGAGTCAGAGGGAAGAAGG + Intronic
967375069 3:188792079-188792101 GGAGGATGGCAGTGGGAAGAAGG - Intronic
967456261 3:189689993-189690015 GCAGAGAGGTAGAGGGAAGGAGG - Intronic
968335879 3:197913150-197913172 GCAGATGGGAAGAGGGAAGCAGG - Intronic
968439626 4:616811-616833 GCAGGTAGGAGGATGGAAAATGG - Intergenic
968593965 4:1473032-1473054 GCAGGTAGGGAGTGGGCAGGTGG - Intergenic
968759858 4:2437090-2437112 GCAGGCAGGCAGCGGGCAGGCGG + Intronic
968943922 4:3653764-3653786 GCAGGCAGGCAGAGGAAGGGCGG - Intergenic
968985547 4:3872563-3872585 GCAGAGAGACAGAGGGAGGATGG + Intergenic
969335537 4:6507302-6507324 GCATGTAGTCAGAGGCAGGAAGG - Intronic
969568211 4:7992639-7992661 GCAGGGAGGCAGAGTGGGGAGGG + Intronic
969606002 4:8202609-8202631 GCAGGTGTGCAGATGGAAGGTGG + Intronic
971390541 4:26181428-26181450 GGAGGTATGGAGAGGGAGGAAGG - Intronic
971845267 4:31910976-31910998 GGAGAAAGGTAGAGGGAAGAAGG - Intergenic
972681161 4:41308242-41308264 GCAGGTAGGTAGGGGGGAGTAGG + Intergenic
972804297 4:42512373-42512395 GCAGGTAGGAATAGGGAAATAGG - Intronic
972813564 4:42618233-42618255 GCAAGTAGGCAGAGGAGACAAGG - Intronic
972997143 4:44894721-44894743 GCAGATGGGCAGAGAGAATATGG + Intergenic
973884977 4:55311805-55311827 GCAGGATTGCAGTGGGAAGAGGG - Intergenic
974907697 4:68077973-68077995 GCACGTTGGGAGATGGAAGACGG + Intronic
974913348 4:68149347-68149369 GCAGGCAGCCACAGTGAAGATGG + Intergenic
975480698 4:74876898-74876920 GGAGGTAGGAAGAGGGACAAGGG - Intergenic
976193056 4:82507357-82507379 GCAGGGAGGTAGAGTGAAGAGGG + Intronic
976262081 4:83155320-83155342 GCAGCAAAGCAGAGGGAAAATGG - Intergenic
976749030 4:88435204-88435226 GAAGGTAGGTAGAAGAAAGAAGG - Intronic
976759595 4:88533960-88533982 GGAGGTAGAAAGAGGGAGGAAGG - Intronic
977188936 4:93976118-93976140 ACAGATACACAGAGGGAAGATGG - Intergenic
977280691 4:95036340-95036362 GGGGGTAGGAAGAGTGAAGATGG - Intronic
977354984 4:95934084-95934106 GCAGGAGGGCAGAGGGCAAAAGG + Intergenic
978339420 4:107706874-107706896 GCAGGTAGGCAGAGCTCAGCTGG + Intronic
979524420 4:121702373-121702395 GGAGGAAGGCAGAAGGTAGAAGG + Intergenic
979871465 4:125828193-125828215 GCAGGCAGGCAGAGGGGTCATGG + Intergenic
981306322 4:143250368-143250390 GGAGGCAGGAATAGGGAAGAGGG - Intergenic
981659538 4:147149237-147149259 GCAGAGGGGCAGAGGGAAGTTGG - Intergenic
981662164 4:147180589-147180611 GGAAGTAGGCAGAGGGAGAAAGG - Intergenic
981839836 4:149098640-149098662 ACAGATAGGCAAGGGGAAGAGGG - Intergenic
981901479 4:149870204-149870226 GCAGATGTACAGAGGGAAGACGG - Intergenic
982170432 4:152656214-152656236 GCAGGTAGGCAGATTGACGTGGG - Intronic
982289364 4:153764343-153764365 CCAGTTAGGCAGAGGGACCAAGG - Intergenic
983308210 4:166021368-166021390 GGAGGGAAGCAGAGGGAGGAAGG - Intronic
984418417 4:179489377-179489399 GCAGGAAGGCAGAAGAAAAAGGG + Intergenic
984436278 4:179714010-179714032 AGAGGAAGACAGAGGGAAGAGGG - Intergenic
984933183 4:184866679-184866701 GCAGGCAGGAAGAAGGGAGAGGG + Intergenic
985089435 4:186348409-186348431 GCAGGTGGGAAGAGGGGAGTGGG - Intergenic
985570137 5:640276-640298 ACAGGTAGGGAGAGGGGAAAGGG - Intronic
985965844 5:3338371-3338393 GGCGGGAGGTAGAGGGAAGAGGG - Intergenic
985991024 5:3561432-3561454 GAGGGTAGGGAGTGGGAAGAGGG - Intergenic
986257050 5:6109349-6109371 GAGGGTAGGCACAGGGAATAGGG - Intergenic
986854502 5:11853233-11853255 GCAGGAAGGTAAAGGAAAGAAGG - Intronic
987207518 5:15642737-15642759 GTAGGTGGGAAGAGGGGAGAAGG + Intronic
987335854 5:16896988-16897010 ACGGGAAGGCAGAAGGAAGAAGG + Intronic
987393619 5:17400115-17400137 GCAGGCAGTGACAGGGAAGAGGG + Intergenic
988602547 5:32653428-32653450 GTTGGTAAGCAGAGGGCAGAGGG + Intergenic
989538733 5:42593932-42593954 GCAGCTAGGTGGAGGGAAGTTGG - Intronic
990044814 5:51416018-51416040 GAAGGAAGGGAGAGGAAAGAAGG - Intergenic
990310631 5:54534453-54534475 GCAGGCAGAAAGAGGGAAAACGG + Intronic
990314384 5:54570254-54570276 GAAGGTAGGCAGAGCCAAGGAGG + Intergenic
990754574 5:59054875-59054897 AAAGGGAGGAAGAGGGAAGAGGG - Intronic
990978975 5:61584751-61584773 GCAGGTAGGGAGAGGGAAGGAGG - Intergenic
991337891 5:65570740-65570762 GAAGGAAGGGAGAGGGAAGAAGG + Intronic
991610484 5:68444875-68444897 GCAGGTAAGCAAAGCGAAGTGGG - Intergenic
992143015 5:73818299-73818321 GTAAGTAGGCAGAGGTATGATGG + Intronic
993132125 5:83912131-83912153 GCAGGTAGCTAAAGGAAAGAGGG - Intergenic
993385948 5:87263174-87263196 GCAGGGAGAAAGAGGGAAGGAGG - Intergenic
993899905 5:93578450-93578472 CCAGGAAGGCAGAGGAAGGAAGG + Intergenic
994133211 5:96255111-96255133 GGGGGTTGGCAGGGGGAAGAAGG + Intergenic
994628532 5:102252018-102252040 AGAGGGAGGGAGAGGGAAGAAGG + Intronic
994732616 5:103511206-103511228 GCAGACAGGGTGAGGGAAGAAGG - Intergenic
995269015 5:110199766-110199788 GAAGCTAGGAAGAGGCAAGAAGG + Intergenic
996012191 5:118493261-118493283 GGAGGGTGGCAGAGGGGAGAGGG + Intergenic
996480307 5:123968570-123968592 ACATGTATGGAGAGGGAAGAAGG - Intergenic
997518302 5:134506238-134506260 GGAGCTGGGCACAGGGAAGAGGG - Intergenic
997521625 5:134527201-134527223 GAAGGGAGGGAGAGGGAGGAAGG - Intronic
998132880 5:139660043-139660065 GCAGGCAGGAGGAGGGAAGCTGG + Intronic
998205093 5:140152284-140152306 TGCGGTAGGCAGAGGCAAGAGGG + Intergenic
998629641 5:143883900-143883922 GGAGGAAGGCAGAGAGAAGAAGG - Intergenic
999135193 5:149314033-149314055 GCAAGAAGGATGAGGGAAGACGG + Intronic
999241738 5:150131909-150131931 GCAGGAAGGGAGAGGGAACGGGG + Intronic
999259331 5:150228293-150228315 GAAAGAAGCCAGAGGGAAGAGGG + Intronic
1000272820 5:159702741-159702763 GCAGGTGGGCAGGGGGAGGGAGG + Intergenic
1000822955 5:166007993-166008015 GCTGGAGGGCAGAGGGAAGAGGG - Intergenic
1001089391 5:168726349-168726371 GCAGGGAGGGAGAGGGAGGCAGG + Intronic
1001089398 5:168726367-168726389 GCAGGGAGGGAGAGGGAGGCAGG + Intronic
1001089404 5:168726385-168726407 GCAGGGAGGCAGAGGGAGGCAGG + Intronic
1001089410 5:168726403-168726425 GCAGGGAGGCAGAGGGAGGCAGG + Intronic
1001089416 5:168726421-168726443 GCAGGGAGGAAGAGGGAGGCAGG + Intronic
1001089449 5:168726501-168726523 GCAGGGAGGGAGAGGGAGGCAGG + Intronic
1001098152 5:168792178-168792200 GCTGGAAGGCAGATGGGAGATGG + Intronic
1001239070 5:170054346-170054368 GGAGGTAGGGAAAGGGAAGAGGG + Intronic
1001485720 5:172118354-172118376 GCAGGAAGGCAGATGGGACATGG + Intronic
1001485856 5:172119186-172119208 GCAGGCAGGGAGCGGGAAGGTGG + Intronic
1001546552 5:172574121-172574143 ACAGGCAGGCAGAGAGCAGAGGG - Intergenic
1001649358 5:173304395-173304417 GCAAATTGGCAGAGGGCAGAAGG - Intergenic
1002427722 5:179185907-179185929 GCAGGTAGCCAGGGAGAAGGAGG + Intronic
1002666696 5:180830769-180830791 GCAGCTTGCCACAGGGAAGAGGG + Intergenic
1003004782 6:2370391-2370413 GGAGGTACTCAGAGGGGAGAGGG + Intergenic
1003238144 6:4316994-4317016 GCAGGGAGGGAGAGTGAGGATGG + Intergenic
1003270561 6:4604141-4604163 GGAGGGAGGGAGAAGGAAGAAGG - Intergenic
1003324506 6:5082475-5082497 GCAGGGAGGCAGGGGGAGGGAGG - Intergenic
1003374446 6:5563036-5563058 GAAGGAAGGGAGAGGAAAGAAGG + Intronic
1003464861 6:6369256-6369278 GAAGGAAGGGAGAGGGAGGAGGG + Intergenic
1003518482 6:6837173-6837195 GCAGGAAGGAAGAAGGAGGAAGG + Intergenic
1003634815 6:7822448-7822470 GCAGGCATGAGGAGGGAAGAGGG - Intronic
1003867984 6:10381056-10381078 GAAGGGAGGCAGAGGAAGGAAGG - Intergenic
1003890069 6:10556143-10556165 ACGGGGAGGCAGAGGGAGGAGGG + Intronic
1003961157 6:11210732-11210754 GAAGGGAGGGAGAGGGAAGGAGG + Intronic
1004474037 6:15954467-15954489 GAAGCCAGGCAGAGAGAAGAGGG + Intergenic
1005115071 6:22327056-22327078 GCAGGAAGGCAGAAGCAAGAGGG + Intergenic
1006013483 6:31061890-31061912 CCAGGTAGGAAGAGGAACGAAGG - Intergenic
1006187758 6:32190338-32190360 GGAGGAGGGGAGAGGGAAGAGGG + Intergenic
1006212073 6:32404324-32404346 GCAGGAAGGAGTAGGGAAGAAGG - Intronic
1006338360 6:33432414-33432436 GCAGGGGGGCAGAGCCAAGAAGG - Intronic
1006365044 6:33610348-33610370 GGAGGTAGGGAGAGGCAGGAGGG - Intergenic
1006651021 6:35551650-35551672 GCCAGAGGGCAGAGGGAAGATGG + Intergenic
1006718125 6:36132860-36132882 GCAGGCAGGAAGAGGCAGGAAGG + Intronic
1006832947 6:36979812-36979834 ACAGGTGGGCAGATGGAAGAGGG - Intronic
1006910487 6:37560282-37560304 GCAGGGAGGGAGATGGATGATGG + Intergenic
1007028466 6:38603134-38603156 GTAGGAAGGCAGGGGGACGAAGG + Intronic
1007085299 6:39140134-39140156 GCAGGAAATCAGAGGGGAGAAGG + Intergenic
1007102566 6:39259840-39259862 GCAGATAGCCAGAGAGGAGAAGG - Intergenic
1007116952 6:39349541-39349563 GGAGGCAGGCAGAGGGCAGGGGG + Intronic
1007446267 6:41908755-41908777 GCAAGTAGGAAGCGGGAAGCTGG - Intronic
1007451159 6:41941134-41941156 GCCGGGAGGCGGAGGGAAGCGGG + Intronic
1007506615 6:42340329-42340351 GCAGGCAGAGAGAGGGATGAGGG + Intronic
1007616044 6:43180225-43180247 GTTGCTAGGGAGAGGGAAGAGGG + Exonic
1007736254 6:43984099-43984121 ACAGAGAGACAGAGGGAAGAAGG - Intergenic
1008438779 6:51508068-51508090 GGAGGGAGGAAGAGGGATGAGGG + Intergenic
1008875276 6:56319263-56319285 TCTGGTAGGCAGAGTCAAGAGGG + Intronic
1009398161 6:63226848-63226870 GCAGGTGGGAAGCGGGCAGAAGG + Intergenic
1010653888 6:78488723-78488745 GAAGGTAAGGAGAGGGGAGAGGG + Intergenic
1011057175 6:83217913-83217935 ACATTTAGGCAGAGGTAAGATGG + Intronic
1012448955 6:99334841-99334863 GCAGGTGGGCAGTGGCTAGATGG - Intronic
1012929582 6:105302947-105302969 GCAGGCAGGCAGGGATAAGATGG - Intronic
1013082174 6:106822341-106822363 TCAGGGAGGCAGAGGCAGGAGGG + Intergenic
1013262261 6:108456649-108456671 GTAGATTGGCAGAGGGTAGAGGG - Intronic
1013267157 6:108511151-108511173 GGAGGTAGGAGGAAGGAAGAAGG + Intronic
1013267158 6:108511158-108511180 GGAGGAAGGAAGAAGGAAGAAGG + Intronic
1013780172 6:113720082-113720104 GCAGGTAGGAAGAGGCAACCAGG - Intergenic
1013871435 6:114766536-114766558 TCAGGTGAGCAGAGGGATGATGG + Intergenic
1014152229 6:118070769-118070791 GGAGGTTGGGAGATGGAAGATGG - Intronic
1015294046 6:131570084-131570106 GCAGCTAGGAAGAGGTAGGAAGG + Intergenic
1015925714 6:138308529-138308551 GCAGCTCGGCAGAGAGATGAGGG - Intronic
1015970805 6:138741225-138741247 GCAGGGATGGGGAGGGAAGATGG - Intergenic
1017673262 6:156787999-156788021 GCAGGTAGGCAGAGAAGAGAGGG - Intronic
1018181463 6:161226931-161226953 GCAGGGAAGAAGAAGGAAGAAGG + Intronic
1018354970 6:163003750-163003772 GGTGGCAGGCAGAGAGAAGAAGG - Intronic
1018787454 6:167119167-167119189 CCAGGTAGGCAGGGGGAGGAAGG - Intergenic
1019484070 7:1280444-1280466 GGAGGAAGGAAGAAGGAAGAAGG + Intergenic
1019484126 7:1280738-1280760 GGAGGGAGGAAGAAGGAAGAAGG + Intergenic
1019609379 7:1929234-1929256 GGAGGGAGGCAGGGGGAGGATGG - Intronic
1019746260 7:2701899-2701921 GCAGGGAGGTGGAGGGAAGCGGG - Intronic
1019758585 7:2791528-2791550 GCAAGACGGCAGAGGGAACAGGG + Intronic
1019781393 7:2942316-2942338 GAAGGAAGGAAGAGGGAGGAAGG - Intronic
1020019432 7:4854069-4854091 GCAGGAAGAAAGAAGGAAGACGG - Intronic
1020080064 7:5282326-5282348 GGAGGGAGGGAGAGGGAGGAGGG + Intronic
1020120800 7:5502149-5502171 GCAGGTAGGCAGCGAGAGGTGGG - Intronic
1020685250 7:11286014-11286036 GGAGGGAGGGAGAGGGAAGGGGG - Intergenic
1020757074 7:12215992-12216014 GGAGATACCCAGAGGGAAGAAGG + Intronic
1021152387 7:17167404-17167426 GCAGGTAGACAGAGGAAATTGGG - Intergenic
1021289401 7:18824164-18824186 TGAGGGTGGCAGAGGGAAGACGG + Intronic
1022250827 7:28606538-28606560 ACTGAGAGGCAGAGGGAAGATGG - Intronic
1022365677 7:29713429-29713451 GGAGGTCGGCAGAGAGCAGAGGG - Intergenic
1022485391 7:30773662-30773684 GCAGGGTGGCAGAGGGAGGATGG - Intronic
1022695841 7:32704715-32704737 GGGGGTTGGCAGAGGGCAGAGGG + Intergenic
1022885785 7:34642289-34642311 GCAGGTAGGCTGGGGGAGGGAGG + Intergenic
1023266342 7:38410200-38410222 TCAGGTTGGCAGAAGGCAGAGGG + Intronic
1023333690 7:39146339-39146361 GCAGGAAGGCAGAGGGAGGCAGG + Intronic
1023444978 7:40222089-40222111 GCAAGCAGGCAGAAGGAAGCTGG + Intronic
1023450439 7:40278747-40278769 AAAGGGAGGGAGAGGGAAGAAGG - Intronic
1023629417 7:42148854-42148876 CCAGGCAGGCAAAGGGAAGCTGG - Intronic
1023949432 7:44830586-44830608 GCACTTAAGCAGAGAGAAGAAGG - Intronic
1024241664 7:47440484-47440506 GGAGGAGGGAAGAGGGAAGAGGG + Intronic
1024871827 7:53972267-53972289 GGAGGGAGGCAGAGAGAAGGAGG + Intergenic
1024977017 7:55122656-55122678 GGAGGTAGGCAGAGGAGAAAAGG - Intronic
1024995988 7:55273561-55273583 TCAAGTGGGCAGAGTGAAGAGGG + Intergenic
1025198856 7:56949890-56949912 GGAGGGAGGGAGAGGGAGGAGGG - Intergenic
1025284174 7:57649198-57649220 GGAGGGAGGCAGAGGGCTGACGG - Intergenic
1025673090 7:63627043-63627065 GGAGGGAGGGAGAGGGAGGAGGG + Intergenic
1026284966 7:68955025-68955047 GCAGGGAGACAGAGGGATGGGGG + Intergenic
1026354141 7:69542602-69542624 GCAGCTAAACAGAGGGAAGGTGG - Intergenic
1026915127 7:74115541-74115563 GCAGGTGGGGAGGGGGCAGAGGG + Intronic
1028124114 7:87091960-87091982 GAAGTTAGGCAGAGGAGAGAAGG - Intergenic
1029027779 7:97435578-97435600 GGAAAGAGGCAGAGGGAAGATGG + Intergenic
1029364993 7:100111044-100111066 ACAAGGGGGCAGAGGGAAGAGGG - Intronic
1029972163 7:104800444-104800466 GCACGTAGGAAGAGGAAAGTGGG - Intronic
1031102448 7:117498786-117498808 GAAGACAGGCAGAGGAAAGAGGG - Intronic
1031453993 7:121957149-121957171 GAAGGTACCCAGAGGGAAAAAGG - Intronic
1032025576 7:128439276-128439298 ACAGACAGACAGAGGGAAGATGG - Intergenic
1032119131 7:129144102-129144124 GCAAGTAGACCAAGGGAAGAGGG + Intergenic
1032240097 7:130153601-130153623 CCAGGCAGGGAGAGGGAGGAAGG - Intergenic
1032267852 7:130381176-130381198 GCAGGTCAGAAGAGGGGAGAAGG + Exonic
1032528730 7:132602409-132602431 GCTGGTAGACAGAGGCAACATGG - Intronic
1033229317 7:139584148-139584170 GGAGGGAGGCAGAGGGGAGAGGG + Intronic
1033267313 7:139897355-139897377 GCAGGCAGGCGGGGGGAATAAGG + Intronic
1033329200 7:140404113-140404135 GCAGCGAGGCAGGAGGAAGAAGG + Exonic
1033673033 7:143511392-143511414 GCAGAAAGGCAGGTGGAAGATGG + Intergenic
1033897134 7:146086890-146086912 GCACATAAGCAGAGAGAAGAAGG - Intergenic
1033955231 7:146839686-146839708 GAAGATGGGCAGAGGTAAGATGG - Intronic
1034264004 7:149772818-149772840 GCAGGTGGGAAGGGGGACGACGG - Intronic
1034773593 7:153803446-153803468 GCAGGTAGGCAGGGGCAGAAAGG - Intergenic
1035026756 7:155831344-155831366 TCAGGGAGGGAGAGGGAAGCCGG + Intergenic
1035661167 8:1349734-1349756 ACAGGTAGGAAGAGGAAGGATGG + Intergenic
1035899919 8:3448344-3448366 GGAGGAAGGAAGAAGGAAGAAGG + Intronic
1036229727 8:6989666-6989688 CAAGGTAGGCAGAGTGAAGAGGG + Intergenic
1036232178 8:7008769-7008791 CAAGGTAGGCAGAGTGAAGAGGG + Intronic
1036502845 8:9329239-9329261 GCAGGTAGAGAAAGGAAAGAAGG + Intergenic
1036597507 8:10227244-10227266 GCAGGTTGTCATAAGGAAGAGGG + Intronic
1036612968 8:10365904-10365926 GCAAGTATGCAGAGGTAGGAAGG - Intronic
1036654948 8:10671904-10671926 GCAGTGAGGCAGAGGAAGGAAGG + Intronic
1036682323 8:10884562-10884584 ACATGGAGGCAAAGGGAAGAAGG + Intergenic
1036754620 8:11464118-11464140 GCAGGCAGGCAGTGTGCAGAAGG + Intronic
1037337108 8:17801762-17801784 GCAGGTGGCCAGAGGCAAGCAGG - Intergenic
1037520284 8:19674425-19674447 GCAGGGGGGAAGACGGAAGAAGG + Intronic
1037608843 8:20459455-20459477 GCAGGCAGGCAGGGAGGAGAGGG + Intergenic
1037683292 8:21116747-21116769 GCAGGTGGTGAGTGGGAAGATGG - Intergenic
1037750494 8:21679059-21679081 GAAGGCAGACAGAGGGCAGAGGG - Intergenic
1037991253 8:23322821-23322843 GCAGGGAGGCAGAGGGTAACGGG - Intronic
1038332040 8:26616728-26616750 GCAGGAGGGAAGAGGGAGGATGG - Intronic
1038537930 8:28367931-28367953 ACAGGTAGACAGAAGGAAGCAGG + Intronic
1038552731 8:28483874-28483896 GCATGTTGGCAGAGGGAATGCGG + Intronic
1038839872 8:31174705-31174727 GAAGGAAGGAAGAAGGAAGAAGG - Intergenic
1039218885 8:35305838-35305860 GGAGGGAGGGGGAGGGAAGAAGG - Intronic
1039253940 8:35697971-35697993 GGAGGTTTGGAGAGGGAAGATGG - Intronic
1039719882 8:40151845-40151867 GCGAGTAGGCAGTGGAAAGAGGG - Intergenic
1039953917 8:42192984-42193006 GCAGAGAGGCACAGGGACGAGGG - Intronic
1040065269 8:43140172-43140194 GAAGGTGGGGCGAGGGAAGAAGG + Intergenic
1040289575 8:46117432-46117454 TAAGGCAGGCAGAGGGGAGAAGG - Intergenic
1040290365 8:46121111-46121133 TCAGGAAGGCAGAGGGGAGAAGG - Intergenic
1040293433 8:46137081-46137103 GGGGGCAGGCAGAGGGGAGAAGG - Intergenic
1040310686 8:46235263-46235285 TGAGGGAGGCAGAGGGGAGAAGG + Intergenic
1040323839 8:46331310-46331332 TGAGGCAGGCAGAGGGGAGAAGG + Intergenic
1040324925 8:46336880-46336902 TAAGGCAGGCAGAGGGGAGAAGG + Intergenic
1040337004 8:46421141-46421163 TAAGGCAGGCAGAGGGGAGAAGG + Intergenic
1040341245 8:46442264-46442286 TGAGGCAGGCAAAGGGAAGAAGG - Intergenic
1040341576 8:46443749-46443771 TGAGGTAGACAGAGGGGAGAAGG - Intergenic
1040862321 8:52012045-52012067 TCAGGAAGGAAGAAGGAAGAGGG - Intergenic
1041482754 8:58342002-58342024 GCACGCATGCTGAGGGAAGATGG - Intergenic
1041548667 8:59076061-59076083 TCAGGAAGTCAGAGAGAAGAAGG + Intronic
1041842483 8:62288382-62288404 TCAGGTAGGTGGAGGGAGGAGGG - Intronic
1042199457 8:66267332-66267354 GGAGGTAGGAAGTGAGAAGAAGG + Intergenic
1042949792 8:74189182-74189204 GCAGGGAGGGAGAGGGAAGTGGG - Intergenic
1043488841 8:80727578-80727600 GCAGGCAGGCAGGGGGTGGATGG + Intronic
1043534979 8:81192972-81192994 GGAGGTTGGGAGAGGGATGAAGG - Intergenic
1043602039 8:81952532-81952554 GGAGGGAGGGTGAGGGAAGAAGG - Intergenic
1043852812 8:85233888-85233910 GCAGGTATGCAGAGGGAGTTGGG + Intronic
1044910555 8:97053995-97054017 GGAGTTAGGCAGGGGGAAAAGGG + Intronic
1045015050 8:97994187-97994209 GGAGGGGGGAAGAGGGAAGAGGG + Intronic
1047428032 8:124764541-124764563 GAAGAAAGCCAGAGGGAAGAAGG + Intergenic
1048048562 8:130796050-130796072 ACAGGGAGGCAGAGGGAGGGAGG - Intronic
1048207135 8:132424270-132424292 GCAGTGAGACAGAGGGAGGAAGG - Intronic
1048222225 8:132552523-132552545 GCAGGTAGTCAGAGTAAAAAGGG + Intergenic
1049178309 8:141207115-141207137 CCAGGAAGGCAGAGGGCAGGAGG + Intergenic
1049271897 8:141700508-141700530 GAAGGGAGGAGGAGGGAAGAGGG + Intergenic
1049411294 8:142475138-142475160 GATGGTAAGCAGAGGGTAGAGGG - Intronic
1049451837 8:142666161-142666183 GCAGGCAGGCAGAGTGGAGAGGG - Exonic
1049587084 8:143437190-143437212 CCAGGCAGGCAGAGGGCACAAGG + Intergenic
1049998150 9:1050575-1050597 GAAGGTAGGTGGAGGGAAGGAGG - Intronic
1052433969 9:28402568-28402590 GGAAGGAGGGAGAGGGAAGAAGG - Intronic
1052558125 9:30047129-30047151 GCAGGCAGGCAGAAGAAAAAGGG + Intergenic
1052976778 9:34417016-34417038 GGAGGAGGGAAGAGGGAAGAAGG - Intronic
1053444709 9:38143116-38143138 GAAGGCAGGCTGAGGGAGGATGG - Intergenic
1053784934 9:41646815-41646837 GGAGGGAGGCAGAGGGCTGACGG - Intergenic
1054160077 9:61667367-61667389 GGAGGGAGGCAGAGGGCTGATGG + Intergenic
1054161008 9:61672055-61672077 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1054173030 9:61857497-61857519 GGAGGGAGGCAGAGGGCTGATGG + Intergenic
1054173659 9:61860760-61860782 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1054447883 9:65386547-65386569 GGAGGGAGGCAGAGGGCTGATGG + Intergenic
1054448514 9:65389825-65389847 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1054663881 9:67720021-67720043 GGAGGGAGGCAGAGGGCTGATGG + Intergenic
1054664512 9:67723284-67723306 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1055283026 9:74696719-74696741 GCCAGGAGGCAGAGGGAACAAGG + Intergenic
1056361383 9:85861138-85861160 GAAGTTACGAAGAGGGAAGAAGG + Intergenic
1057079667 9:92163480-92163502 GCAGGTTTTCAGAGGGAGGAAGG - Intergenic
1057080842 9:92173313-92173335 GCAGGTAGGGAGAGGGCACCGGG - Intergenic
1057701594 9:97366714-97366736 GCAGGAAGGCACGGGGAACAGGG + Intronic
1057786862 9:98094421-98094443 GCGGGAAGGGAGAGGGGAGATGG + Intronic
1057916867 9:99063387-99063409 GGAGAGAGGCAAAGGGAAGATGG + Intronic
1057939311 9:99266937-99266959 GCTAGGAGGCAGAGGAAAGAAGG - Intergenic
1058525802 9:105856793-105856815 GCAGGTAGGCTAGGGGAGGAAGG - Intergenic
1059610777 9:115890751-115890773 GCAGGTTAGCATAGGGAAGAAGG - Intergenic
1060395593 9:123314241-123314263 GCAGGGTGGCAGAGGGAGGCTGG - Intergenic
1060663164 9:125416092-125416114 GCAGACAGGCAGGGGGTAGATGG + Intergenic
1061147589 9:128808892-128808914 CCAGGGAGGGAGAAGGAAGAGGG + Exonic
1061865829 9:133491373-133491395 GCAGGTACGCAGACAGCAGATGG + Intergenic
1062167846 9:135117101-135117123 GCAGTTAGGCAGAGGGAGTCTGG - Intronic
1062356566 9:136167369-136167391 TCAAGAAGGCAGAGGGAAGATGG - Intergenic
1203742538 Un_GL000218v1:14717-14739 GAATGTGGGCAGAGGGTAGAGGG + Intergenic
1203567560 Un_KI270744v1:104702-104724 GAATGTAGGCAGAGGATAGAGGG - Intergenic
1203664646 Un_KI270754v1:14243-14265 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1203664930 Un_KI270754v1:15650-15672 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1203665215 Un_KI270754v1:17059-17081 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1203665495 Un_KI270754v1:18466-18488 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1203665776 Un_KI270754v1:19876-19898 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1203666064 Un_KI270754v1:21286-21308 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1203666353 Un_KI270754v1:22695-22717 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1203666642 Un_KI270754v1:24102-24124 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1203666922 Un_KI270754v1:25514-25536 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1203667212 Un_KI270754v1:26925-26947 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1203667502 Un_KI270754v1:28334-28356 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1203667791 Un_KI270754v1:29741-29763 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1203668070 Un_KI270754v1:31153-31175 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1203668360 Un_KI270754v1:32564-32586 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1203668650 Un_KI270754v1:33973-33995 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1203668933 Un_KI270754v1:35383-35405 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1203669209 Un_KI270754v1:36790-36812 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1203669496 Un_KI270754v1:38199-38221 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1203669782 Un_KI270754v1:39606-39628 GGAGGGAGGCAGAGGGCTGATGG - Intergenic
1185603856 X:1355785-1355807 GCAGGTGGGCAGAGGGGGCATGG + Intronic
1186011494 X:5139050-5139072 GAAGATGGGCAGAGGGGAGAAGG + Intergenic
1186253345 X:7692932-7692954 GCAGAAAGGCTGAGGGAAAAAGG + Intergenic
1186402653 X:9273908-9273930 GGAAGTAGGAAGAAGGAAGATGG + Intergenic
1186479020 X:9881716-9881738 TCGGGGAGGCAGAGGGAGGAAGG - Intronic
1186816810 X:13246278-13246300 GCAGGTAGGCAGATGAATGCAGG + Intergenic
1187106805 X:16251713-16251735 GAAGGTTTGCAGAGAGAAGAGGG + Intergenic
1187497492 X:19808141-19808163 GCAGGTGGGGTGAGGGAAGAAGG + Intronic
1188637455 X:32452088-32452110 GCTCATAGGGAGAGGGAAGAGGG + Intronic
1188769960 X:34141097-34141119 GCAGGCAGTCAAAGTGAAGAGGG + Intergenic
1188966602 X:36561069-36561091 GAAGGAAGGAAGAAGGAAGAAGG - Intergenic
1189206110 X:39240448-39240470 GAAGGAAGACAGAAGGAAGAGGG - Intergenic
1189397621 X:40637456-40637478 GCAGGTAGCCTGAGGGAAGCTGG + Intronic
1190002733 X:46705196-46705218 GGAGGTTGGCACAAGGAAGATGG + Intronic
1190098191 X:47499594-47499616 GGAGGGAAGAAGAGGGAAGATGG + Intergenic
1190417992 X:50199845-50199867 GGAGGGAGGGGGAGGGAAGAGGG - Intronic
1190618912 X:52265759-52265781 GCAGGTAGTGAGAGGGAGGAAGG + Intergenic
1190625692 X:52336633-52336655 GCAGGCAGGGGGAGGGAGGAGGG - Intergenic
1193109245 X:77710796-77710818 AGAGGTAGGCGGAGGGAAGTGGG + Intronic
1193215437 X:78857996-78858018 GGAGCTAGCCAGAAGGAAGAGGG - Intergenic
1193427861 X:81361643-81361665 GCAGGTTGGGAGGGGGATGAGGG + Intergenic
1193665014 X:84305480-84305502 GCAGGTTGGCAGGGGGAGGTGGG + Intergenic
1193787948 X:85783546-85783568 GGAGGTAGGGAGAGGGACAAAGG + Intergenic
1193941400 X:87683540-87683562 GGAGGAAGGCAGAGGTCAGATGG - Intergenic
1194695793 X:97048206-97048228 GCAGGAAAAGAGAGGGAAGAGGG - Intronic
1195306152 X:103585793-103585815 GCACGTAGGCAGTGGGCAGAGGG + Intronic
1195716148 X:107820206-107820228 GGAGGAAGACAGAGTGAAGAGGG - Intergenic
1195870553 X:109480967-109480989 GGAGGAAGGGAGAGGGAAGGAGG + Intronic
1195923268 X:110002916-110002938 GGAGGAAGCCAGAGGGAAGGCGG - Intronic
1195966651 X:110435119-110435141 GGAGGGAGGGAGGGGGAAGAAGG + Intronic
1196218884 X:113088293-113088315 GCAGGTTGTCGGAGGGAAGTGGG - Intergenic
1196381764 X:115098650-115098672 GCAGGCAGCCAGAGTGATGATGG - Intergenic
1196825866 X:119739751-119739773 GCAGGTTGGTAGAGGGTACAAGG - Intergenic
1196864705 X:120060341-120060363 GCTGGGAGCCAGAGGGGAGAGGG - Intergenic
1196878396 X:120175990-120176012 GCTGGGAGCCAGAGGGGAGAGGG + Intergenic
1197841311 X:130750046-130750068 GCAGACAGGCAGAGGGAGGAAGG - Intronic
1199356975 X:146874332-146874354 CCATGTAAGCAGAGGGAATATGG - Intergenic
1199607177 X:149586386-149586408 GAAGATCGGCAGAGGGAAGCGGG - Intronic
1199631947 X:149782982-149783004 GAAGATCGGCAGAGGGAAGCGGG + Intronic
1200182356 X:154158495-154158517 ACACGCAGACAGAGGGAAGAAGG - Intronic
1200188010 X:154195609-154195631 ACACGCAGACAGAGGGAAGAAGG - Intergenic
1200193660 X:154232749-154232771 ACACGCAGACAGAGGGAAGAAGG - Intronic
1200199415 X:154270553-154270575 ACACGCAGACAGAGGGAAGAAGG - Intronic
1201146263 Y:11067016-11067038 GGAGGGAAGGAGAGGGAAGAGGG + Intergenic
1201222365 Y:11784207-11784229 GCAGGGAGGAAAAGGGAGGAGGG + Intergenic
1201331042 Y:12821739-12821761 GCAGGGAGGCTGAGGCAGGACGG - Intronic
1201505741 Y:14697673-14697695 GTAGGTAGGTAGAGGACAGAGGG + Intronic