ID: 906748654

View in Genome Browser
Species Human (GRCh38)
Location 1:48239521-48239543
Sequence ACTTGCCTGTTCCTCAGGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906748654_906748657 -5 Left 906748654 1:48239521-48239543 CCATCCCTGAGGAACAGGCAAGT 0: 1
1: 0
2: 1
3: 18
4: 202
Right 906748657 1:48239539-48239561 CAAGTGTTGTGCTCATACTGAGG 0: 1
1: 0
2: 0
3: 3
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906748654 Original CRISPR ACTTGCCTGTTCCTCAGGGA TGG (reversed) Exonic
900773302 1:4562886-4562908 ACTTTCCCATCCCTCAGGGAAGG - Intergenic
901782316 1:11602211-11602233 ACTTGTCTGTTTCTCCAGGAGGG - Intergenic
901824020 1:11848727-11848749 ACTTGCCACGTCCTCAGGGAAGG - Intergenic
903479143 1:23640235-23640257 ACTTGCCTGTTCCTGGTAGATGG - Intronic
903737421 1:25538820-25538842 TCTTGGCTGGTCCCCAGGGAAGG - Intergenic
904650935 1:32005440-32005462 AATTGCCACTTCTTCAGGGAAGG - Intergenic
906454877 1:45986034-45986056 ACTTGCCTATTCCACTGGGCTGG + Intronic
906748654 1:48239521-48239543 ACTTGCCTGTTCCTCAGGGATGG - Exonic
907426583 1:54383443-54383465 TCTTATCTGTTCTTCAGGGAGGG - Intronic
909297739 1:73972274-73972296 ATTTTCCCTTTCCTCAGGGAAGG - Intergenic
912724685 1:112048439-112048461 AATTCCCTGTTACTCAGGAAAGG - Intergenic
914847190 1:151289763-151289785 AGCTGGCTGTTTCTCAGGGAGGG + Exonic
916089865 1:161299508-161299530 ACCTGCCTGCTCCTCTAGGAGGG + Intergenic
916845088 1:168642490-168642512 ACTTGCCTGGGCTTCAGGGAGGG - Intergenic
917485536 1:175451612-175451634 ACATGTCTGCTCCTCTGGGACGG - Intronic
918460226 1:184768702-184768724 ACTTGCACATTCCTCAGGGTAGG + Intergenic
919543202 1:198877261-198877283 ACTTTCCTCTTTCTCAGGTAAGG + Intergenic
920950449 1:210567333-210567355 ACTGACCAGTTCCTCAGGTAGGG + Intronic
921452971 1:215331611-215331633 ACCTGCTTTTGCCTCAGGGATGG - Intergenic
922169456 1:223142819-223142841 ACCTGCCTCTTCCACAGGGTGGG + Intronic
922708300 1:227804986-227805008 TCTTTCCTGTCTCTCAGGGATGG + Intergenic
1063981002 10:11451784-11451806 GCCAGCCTGGTCCTCAGGGAGGG - Intergenic
1069619755 10:69829616-69829638 ACTGGCCTGCTCCACAAGGAAGG + Intronic
1071757576 10:88560828-88560850 TCTTGCCTGTTCCTCCATGATGG - Intronic
1072043023 10:91627421-91627443 ACTGCCCTGTTCCCAAGGGATGG - Intergenic
1073695256 10:105859581-105859603 ATTTGCCTGTCCCTCATGGGAGG + Intergenic
1073695876 10:105866802-105866824 AATTGCCAGGTCCTAAGGGAAGG + Intergenic
1075894919 10:125986787-125986809 CCATGCCTGTTCCTCAGTGGGGG + Intronic
1076850388 10:133089489-133089511 GCTTGCTGGTGCCTCAGGGAGGG - Intronic
1077097803 11:806498-806520 ACCTGCCTGTCCCAGAGGGAGGG - Intronic
1078007030 11:7539855-7539877 GCTTGGCTGTTGCTCAGGGCAGG + Intronic
1078849104 11:15147954-15147976 ATCTGCATATTCCTCAGGGAGGG + Intronic
1081525093 11:43922468-43922490 ACTTTCCTGTTCATCAGGGCAGG + Intergenic
1083267538 11:61553715-61553737 ACCAGCCTGCTTCTCAGGGAGGG + Intronic
1088205743 11:107390411-107390433 ACTCTCCTCTTCCCCAGGGATGG + Intronic
1088402786 11:109439767-109439789 TCTTGCATGTTTCCCAGGGAGGG - Intergenic
1090646263 11:128768828-128768850 AATGGCCTGGTCCTCAAGGACGG + Intronic
1091085590 11:132718986-132719008 ACCTCTCTGTGCCTCAGGGAGGG - Intronic
1092911256 12:13146528-13146550 TTGTGCCTGTTCCTCATGGAAGG - Intergenic
1094123842 12:27001827-27001849 GCATGCCAGTTCCTCAGGGGAGG - Intronic
1097035322 12:56120060-56120082 CCTTTCCTTTTCCTCAGGTAAGG - Intronic
1097055873 12:56248814-56248836 CCCTGCCTGTCCCGCAGGGAGGG + Exonic
1097464350 12:59903946-59903968 ATTAGCCTGTCCCCCAGGGAAGG - Intergenic
1099380255 12:81944340-81944362 ACATGCCTATTCTTCAGGGAAGG - Intergenic
1100480332 12:94971784-94971806 ACATCCCTACTCCTCAGGGATGG + Intronic
1101110253 12:101479707-101479729 ATTTGCCTGTTATTAAGGGATGG - Intronic
1101144736 12:101830620-101830642 ACCTGCCTGTCCCACAGGTATGG - Exonic
1105337338 13:19486366-19486388 ACTGGGCTGTTTCTCAGGGTAGG + Intronic
1106030760 13:26000149-26000171 AGTTCCCTGTCCTTCAGGGAAGG - Intronic
1106098838 13:26676441-26676463 TCTTGTCTGTTCATCAGGCATGG + Intronic
1108633717 13:52311985-52312007 AGTTGCCTGTGTCTCATGGACGG - Intergenic
1108634129 13:52315686-52315708 AGTTGCCTGTGTCTCATGGATGG - Intergenic
1108880185 13:55103953-55103975 TCTTGCCTCATCCTCCGGGATGG - Intergenic
1109641695 13:65200041-65200063 ACATGCCTTTTCCACAGGCATGG - Intergenic
1112683787 13:101798718-101798740 ATTTGCCTGTGTCTAAGGGAAGG + Intronic
1113057939 13:106289730-106289752 AATTCCCTCTTCCTCAGGGGAGG + Intergenic
1114627040 14:24136593-24136615 TCTGGCCTTTCCCTCAGGGAGGG + Intronic
1117286188 14:54287749-54287771 AGATGCCTCTTCCTGAGGGAGGG + Intergenic
1118036837 14:61877270-61877292 TCTTGTCTGCACCTCAGGGAGGG + Intergenic
1118863133 14:69681106-69681128 ACATGCCTTTCCTTCAGGGAGGG + Intronic
1119396113 14:74327447-74327469 CCTTTCCTGATCCGCAGGGATGG + Intronic
1121494496 14:94382798-94382820 AATGGCCTGTTCCTCAGCGAGGG - Exonic
1121902373 14:97705495-97705517 ACTTCTCTGTTCCTCAGAGAAGG - Intergenic
1122878004 14:104677686-104677708 TCTCGCCTCTTCGTCAGGGAAGG - Intergenic
1122900749 14:104781423-104781445 ACTTCCCTGTGCACCAGGGAGGG - Intronic
1123034870 14:105467763-105467785 ACTTGTCTGTTCCTAATGGCAGG + Intronic
1123716896 15:23040110-23040132 CCTCGCCTGTTCCTCAGGGGCGG + Intergenic
1125500278 15:40235632-40235654 ATATGCCTGTCTCTCAGGGAGGG - Intergenic
1126102145 15:45125198-45125220 AGACGCCTATTCCTCAGGGATGG - Intronic
1128666265 15:69540430-69540452 ACTTGCCTCCTTCCCAGGGAGGG - Intergenic
1130458843 15:84142777-84142799 ACTTGGCTGTGCCTCAGGAGAGG + Intergenic
1132931879 16:2462800-2462822 GCTTGTCTGCGCCTCAGGGAAGG + Intronic
1133615358 16:7471234-7471256 ACTTAACTGTTCCTCACTGAGGG + Intronic
1134124583 16:11607804-11607826 GCTTGCCTGTGCATCATGGAAGG + Intronic
1134127408 16:11625830-11625852 ACTTGTCTGTGTCTCAGGGCTGG - Intronic
1134598974 16:15518595-15518617 TCTTGGCTGTTCCTCAGAGATGG + Intronic
1138265629 16:55657615-55657637 ACTGGCCTGGTCCTCAAGGCAGG + Intronic
1139646434 16:68334554-68334576 AGTTGCCTGTTCCCCAGAGCTGG + Intronic
1140132445 16:72175465-72175487 ACTTACCAGTTCCTTGGGGAGGG - Intronic
1140671437 16:77283806-77283828 ACCTGTCTGTTCCTCAGAGCAGG + Exonic
1140786926 16:78351427-78351449 CCTTGCCTGGCCCCCAGGGATGG + Intronic
1140871634 16:79112052-79112074 ACTTGCCTGATCCCCAGGGCTGG + Intronic
1141040412 16:80668120-80668142 ACTTAACTGTTCCTCTGTGATGG - Intronic
1141149293 16:81552974-81552996 ACTTTCCTGTCCCCCAGGGAGGG - Intronic
1142890616 17:2940367-2940389 ACTTCTGTGTTCCTCTGGGAAGG + Intronic
1143107108 17:4535366-4535388 CCTGGCTTGGTCCTCAGGGAGGG + Intronic
1143544962 17:7590310-7590332 AATTGCCTGTGCTTCAGGGAGGG - Intronic
1144044240 17:11440553-11440575 ACTTGCCTGTCCCACAGGTTTGG + Intronic
1148462422 17:47846345-47846367 AGTTGCCTTCCCCTCAGGGATGG - Exonic
1149282681 17:55125711-55125733 ACTTGCATGAGCCTGAGGGAGGG + Intronic
1149658009 17:58320358-58320380 ACTGGCCTATTTCTCAGGGTGGG - Intronic
1150221027 17:63496048-63496070 ACTTGCATATACCCCAGGGATGG + Intronic
1152586472 17:81191630-81191652 ACTTGCGTGTTGCTGAGGGCGGG + Intronic
1155940951 18:31801624-31801646 ACCTGCCTGCTCCCCAGGGTAGG - Intergenic
1158276024 18:55768366-55768388 ACTTGCCTGACCTCCAGGGAAGG - Intergenic
1160271728 18:77392837-77392859 GCGTTCCTGTTCCTCAGGCAAGG + Intergenic
1160685135 19:431074-431096 AAATGCCGCTTCCTCAGGGAAGG + Intronic
1163567869 19:18062314-18062336 TCCTGCCTCTTCCTCAGGGAAGG + Intronic
1166818938 19:45564483-45564505 ACAAGCCTGTTCCTCTGGCATGG + Intronic
925142004 2:1557336-1557358 GCCTGCCTCTTCCTCAGGGGAGG + Intergenic
927682038 2:25146170-25146192 ACTTACATGGTCCTCAGGCATGG + Intronic
928920379 2:36520692-36520714 GCTTTCCTGTCCCTCAGAGAAGG + Intronic
929807775 2:45162277-45162299 ACTTGTCTGGTCCTGAGTGAAGG - Intergenic
930673474 2:54176010-54176032 AAGGGCCTGTTCCTCATGGATGG - Intronic
931823160 2:65972778-65972800 ACTAGCTAGTTACTCAGGGAAGG + Intergenic
932566081 2:72910571-72910593 TCTTGCCTGACCCTCAGGGTGGG - Intergenic
934891093 2:98069995-98070017 AGTCCCCTGTTCCTCAGGGAAGG + Intergenic
936277550 2:111113533-111113555 ACCTGCCTGGCCCTCCGGGATGG + Intronic
936434798 2:112495204-112495226 AGTTGCTGGCTCCTCAGGGAAGG + Intronic
936535671 2:113309097-113309119 AGGTGCCTGTTCCTCTGGGAGGG - Intergenic
937025864 2:118696691-118696713 ACTTGCATCTTGCTCAGTGAGGG - Intergenic
937908411 2:127063927-127063949 CCTCACCTGTTCCACAGGGACGG + Exonic
938680379 2:133683787-133683809 ACTTACCTCTGCCCCAGGGAGGG + Intergenic
942782929 2:179667618-179667640 TCTTCCCAGTTCCTGAGGGATGG - Intronic
945498809 2:210542920-210542942 CCTAGCCTGATCCACAGGGAAGG + Intronic
945539791 2:211071062-211071084 AATGTCCTGTTCCACAGGGAAGG - Intergenic
947586128 2:231358075-231358097 ACCTGCCTCTGCCTAAGGGATGG + Intronic
948018098 2:234706535-234706557 CCTTGCCAGTTACTCAGGAAAGG + Intergenic
948375076 2:237515906-237515928 CCTTGCCTGCTCCTCTGTGAGGG - Intronic
948450081 2:238063810-238063832 ACTGGCCTCTTCCTTATGGAAGG - Intronic
948653582 2:239463811-239463833 ACTTTGATGTTCCCCAGGGAGGG - Intergenic
948684141 2:239659500-239659522 ACTTGCCTGCACCTCAGGCCTGG + Intergenic
948920816 2:241065066-241065088 CCCTCCCTGTTCCTCAGGGAAGG - Intronic
1172770289 20:37378660-37378682 ACCTACGTGTTCCTCAGAGAGGG - Intronic
1173524844 20:43723988-43724010 GCTTGCCTGTTGCCCAGGGTTGG + Intergenic
1175375023 20:58518334-58518356 TCTTGCATTTTGCTCAGGGAAGG + Intergenic
1176215606 20:63946287-63946309 GCCTGCCTGTTCCTCACAGAGGG - Intronic
1177457692 21:21363998-21364020 AATTACCTGTTCTTCATGGAGGG + Intronic
1178467187 21:32859167-32859189 TCTTGCATGCTCCTCAGAGAGGG - Intergenic
1181582689 22:23836896-23836918 TCCTGGCTGTTCCTCAGGGAGGG + Intronic
1182755312 22:32674255-32674277 TCTTGTCTGTCCCTGAGGGATGG + Intronic
1184930618 22:47678460-47678482 AGCTGCCTGTTTCTCAGGGATGG + Intergenic
1185083627 22:48723838-48723860 ACTTGTCTGTGCCTTAGGTAGGG - Intronic
1185422202 22:50741243-50741265 CCTCTCCTGTCCCTCAGGGAAGG + Intronic
950634095 3:14303056-14303078 AGATGCCTTTTCCTCAGGGTGGG - Intergenic
951147385 3:19244199-19244221 CCTTTCCTTTTCCTCTGGGATGG + Intronic
953141161 3:40230664-40230686 TCTTGTCTGTTCCTTAGGAATGG - Intronic
957245576 3:77711912-77711934 ACTTGCCTCTTGTTCAGGGGAGG + Intergenic
960519364 3:118637336-118637358 ACTTGCATTTTTCCCAGGGAAGG + Intergenic
961032896 3:123622075-123622097 TCTTACCTGTTCCTGAGGGCAGG - Intronic
961336636 3:126184284-126184306 CCCTGCCTGTGCCCCAGGGATGG + Intronic
961672977 3:128548282-128548304 AAAAGCCTGTTCTTCAGGGAAGG - Intergenic
966577302 3:181516856-181516878 TCTTGCCTGTTGCTCTGGGTAGG + Intergenic
966870219 3:184285395-184285417 ACTTGCATGTTCCTGGGGGCTGG + Intronic
966915439 3:184581911-184581933 ACTTGTCTGTTCTTCAGTGCTGG + Exonic
968864573 4:3199761-3199783 ACTAGGCTGTTCCGCAGTGATGG + Exonic
968915079 4:3493773-3493795 ACTCACCTGATCCTCAGGGGTGG - Exonic
969170942 4:5362792-5362814 AGGTGCCTTTGCCTCAGGGAAGG - Intronic
971599441 4:28573280-28573302 ACTTAACAGTTCCACAGGGATGG - Intergenic
976388396 4:84484552-84484574 ACTTGGCTTTTCCTGGGGGAGGG - Intergenic
978156778 4:105498851-105498873 TCTTGGGTGTTCCTCAGAGAGGG + Intergenic
979451379 4:120875100-120875122 CCTAGCCAGTTCATCAGGGAGGG - Intronic
979702647 4:123685722-123685744 TCTTGGCTGTTTCTCAGAGAGGG - Intergenic
983068742 4:163243715-163243737 ACCTGTCTGTTCCTGAGGCATGG + Intergenic
985786445 5:1897814-1897836 GCCTGCCTGTGCCTGAGGGAGGG + Intergenic
988331126 5:29841332-29841354 AATTCCCTCTTGCTCAGGGAAGG + Intergenic
988387180 5:30579708-30579730 AAGGGCCTGTTCCTCATGGATGG - Intergenic
989575306 5:42982272-42982294 TCTTGGCTGTTTCTCAGAGAGGG - Intergenic
990632214 5:57682758-57682780 ACTTGCCTGCTCATCCAGGACGG - Intergenic
994766866 5:103929391-103929413 CCTTGCCTCTTCTTCAGAGAGGG - Intergenic
996507536 5:124285223-124285245 CCTTGCCTGTTCCTTAAGGCTGG + Intergenic
998108336 5:139482398-139482420 TATTTCCTGTTCCTCAGGAAGGG + Intronic
1000699754 5:164434171-164434193 AATTGCGTGTTTCTCAGGCAAGG + Intergenic
1001064931 5:168529145-168529167 ACTTCCCTGGGCCACAGGGACGG - Exonic
1002842279 6:916394-916416 ACTTGTTTGTTCCTCTGGGTGGG - Intergenic
1003278871 6:4675055-4675077 AGTTGACGGGTCCTCAGGGAAGG - Intergenic
1003332856 6:5144262-5144284 ACTTGCCTGTATCTCAGTGCAGG - Exonic
1003860591 6:10319007-10319029 ATTTTCCTCCTCCTCAGGGAGGG - Intergenic
1004067844 6:12266620-12266642 TCTTGCCTGGTGCTAAGGGAAGG + Intergenic
1004712766 6:18188046-18188068 ACTCACACGTTCCTCAGGGAGGG - Intronic
1006794483 6:36722816-36722838 ACCTGCAGCTTCCTCAGGGAGGG - Intronic
1006874056 6:37280056-37280078 CTTTTCCTGTTCCTGAGGGAGGG + Intronic
1007352656 6:41285128-41285150 ATTTGCCAGCTCCCCAGGGAAGG + Intronic
1007352664 6:41285179-41285201 ACTTGCCTGTCTCTCACAGAAGG + Intronic
1011366222 6:86585156-86585178 ACCTTCATGTTACTCAGGGAGGG + Intergenic
1012555850 6:100510673-100510695 AATTGCCCATTCCTCAGAGAAGG - Intronic
1014781466 6:125569848-125569870 ATTTCCCTCTTCCTCAGGGGAGG - Intergenic
1017042952 6:150322507-150322529 ACTTCCAGGTCCCTCAGGGAGGG + Intergenic
1020003476 7:4768846-4768868 ACTGGGCTGTTTCTCAGGGCAGG - Exonic
1021323709 7:19241898-19241920 TCTTTCCTGTTCCCTAGGGATGG + Intergenic
1021571706 7:22072618-22072640 ACTTTCATGTGCCTCAGAGAGGG + Intergenic
1023274459 7:38502995-38503017 ACTTGGCTGTGACTCAGGGCAGG + Intronic
1028528156 7:91808457-91808479 ACTTGCCTTGTCCTTAGGCATGG - Intronic
1030061484 7:105624679-105624701 CCTTGCCAGTACCTCAGGGAGGG + Intronic
1031870234 7:127082988-127083010 AATTCCCTCTTGCTCAGGGAAGG + Intronic
1032074165 7:128828529-128828551 AATTGCCTGGTCCTTAGGTAGGG - Intergenic
1032710723 7:134458462-134458484 AGATGCTTATTCCTCAGGGAGGG + Intronic
1033638679 7:143238630-143238652 ACTTGCCTCTTCCACAAAGAAGG - Intergenic
1036678151 8:10851856-10851878 TCTTGCCTGATGCTCAGTGAGGG + Intergenic
1038947437 8:32376617-32376639 ACAGGCCTGCTCCTCAGGGCAGG - Intronic
1039888759 8:41670688-41670710 ACTAGCCTGGGCCTCAGGGTGGG + Intronic
1039895512 8:41714083-41714105 ACCTTCCAGTCCCTCAGGGAGGG - Intronic
1040138758 8:43885569-43885591 ACTTTCCTGTTTCCCAGGCATGG - Intergenic
1048302217 8:133260158-133260180 TCTTCCCTGTTCCCCAGGGCTGG + Intronic
1048333827 8:133488994-133489016 CCTTGGCTGTCCCACAGGGAGGG - Intronic
1048836704 8:138525514-138525536 ACTTGCCTTGTTCTCAGGGCTGG + Intergenic
1051044437 9:12856505-12856527 ACTTGCTTGTTGCTTAGAGAAGG + Intergenic
1051749707 9:20328358-20328380 ATTTGTCTTTCCCTCAGGGATGG - Intergenic
1053449457 9:38181010-38181032 AGCTGCCTGTTCTTTAGGGATGG + Intergenic
1053573004 9:39329321-39329343 TGTTGCCAGTTCCTGAGGGAGGG + Intergenic
1053624352 9:39853508-39853530 TGTTGCCAGTTCCTGAGGGAGGG + Intergenic
1053880516 9:42589719-42589741 TGTTGCCAGTTCCTGAGGGAGGG - Intergenic
1053892153 9:42704611-42704633 TGTTGCCAGTTCCTGAGGGAGGG + Intergenic
1054094568 9:60888030-60888052 TGTTGCCAGTTCCTGAGGGAGGG + Intergenic
1054116037 9:61163942-61163964 TGTTGCCAGTTCCTGAGGGAGGG + Intergenic
1054124140 9:61289690-61289712 TGTTGCCAGTTCCTGAGGGAGGG - Intergenic
1054219543 9:62397189-62397211 TGTTGCCAGTTCCTGAGGGAGGG - Intergenic
1054231171 9:62511984-62512006 TGTTGCCAGTTCCTGAGGGAGGG + Intergenic
1054591720 9:67018602-67018624 TGTTGCCAGTTCCTGAGGGAGGG - Intergenic
1055821560 9:80270868-80270890 AATTGCCTCTTATTCAGGGAGGG - Intergenic
1056632756 9:88307265-88307287 ACTTGCCTGGTTCCCAGGAAGGG - Intergenic
1057581749 9:96293351-96293373 AATTCCCTGTTCCTCCAGGAAGG - Intronic
1057759257 9:97859580-97859602 AATTGACTGTTGCTAAGGGAGGG - Intergenic
1059168966 9:112106476-112106498 ATTTGCCTGCTCCTCAGGGAGGG - Intronic
1185764527 X:2714986-2715008 ACTTGCCAGGTCCTTGGGGAGGG + Intronic
1189885697 X:45542275-45542297 ACTGGCCTGCTCCTCACAGATGG + Intergenic
1191851201 X:65587727-65587749 ACTGGCCCAATCCTCAGGGATGG + Intergenic
1192053176 X:67745806-67745828 ACTTGCCTTTTGCTCTTGGATGG + Intergenic
1198220228 X:134592535-134592557 AATTCCCTCTTCCTCAGGGGAGG - Intronic
1198469009 X:136928871-136928893 ACTAGCCTTTTCATCTGGGAGGG + Intergenic
1198686218 X:139230585-139230607 ACATGCCTATGCCTGAGGGATGG + Intergenic
1199848790 X:151710703-151710725 TCTTTCCTGATCCTCAGGAAGGG - Intergenic