ID: 906749663

View in Genome Browser
Species Human (GRCh38)
Location 1:48247668-48247690
Sequence GTTGAGTTGGATTCTCTTCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906749663_906749669 25 Left 906749663 1:48247668-48247690 CCCTGAAGAGAATCCAACTCAAC 0: 1
1: 0
2: 2
3: 12
4: 130
Right 906749669 1:48247716-48247738 AGAAGCCCAGAGAGAGCACTGGG 0: 1
1: 0
2: 4
3: 40
4: 390
906749663_906749666 -4 Left 906749663 1:48247668-48247690 CCCTGAAGAGAATCCAACTCAAC 0: 1
1: 0
2: 2
3: 12
4: 130
Right 906749666 1:48247687-48247709 CAACCTGCACACTTGACAAGTGG 0: 1
1: 0
2: 0
3: 13
4: 341
906749663_906749668 24 Left 906749663 1:48247668-48247690 CCCTGAAGAGAATCCAACTCAAC 0: 1
1: 0
2: 2
3: 12
4: 130
Right 906749668 1:48247715-48247737 CAGAAGCCCAGAGAGAGCACTGG 0: 1
1: 1
2: 4
3: 69
4: 564

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906749663 Original CRISPR GTTGAGTTGGATTCTCTTCA GGG (reversed) Exonic