ID: 906760291

View in Genome Browser
Species Human (GRCh38)
Location 1:48371040-48371062
Sequence CCATATATGGCCACAATTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 88}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906760291_906760295 8 Left 906760291 1:48371040-48371062 CCCTCAATTGTGGCCATATATGG 0: 1
1: 0
2: 0
3: 8
4: 88
Right 906760295 1:48371071-48371093 TAACTAAAATATTTTAATTCAGG 0: 1
1: 0
2: 4
3: 73
4: 752

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906760291 Original CRISPR CCATATATGGCCACAATTGA GGG (reversed) Intronic
901943169 1:12679444-12679466 CCATACCTGGCCAACATTGATGG - Intergenic
904054947 1:27663848-27663870 CCATGTTTGGTCACAAATGAGGG - Intergenic
906760291 1:48371040-48371062 CCATATATGGCCACAATTGAGGG - Intronic
909220357 1:72951435-72951457 TCTTATATGGCCACAGTTCATGG + Intergenic
910220047 1:84880806-84880828 CCCTCTGTGGCCACATTTGAAGG - Intronic
912064761 1:105723429-105723451 CCCAATATAGCCAGAATTGAAGG - Intergenic
917494325 1:175526343-175526365 CCATAGATTATCACAATTGAAGG + Intronic
917805302 1:178607678-178607700 CCCTATTTGGCCACAGCTGATGG - Intergenic
918511846 1:185320913-185320935 CCTTATGTGTCCACAATTGGGGG + Intergenic
918668432 1:187180486-187180508 CCAAATATTGACAGAATTGAAGG - Intergenic
921680010 1:218020397-218020419 CCATAGATGGCCAGACTTTAGGG + Intergenic
922240495 1:223752514-223752536 CCATATATTGTCACATTTGATGG + Intronic
1070805962 10:79270878-79270900 CAAAAGATGGCCACTATTGAGGG + Intronic
1072422010 10:95297127-95297149 CCATTTAGGTCCACAATTCATGG + Intergenic
1073520757 10:104126940-104126962 CCATATATGGCCAAAATGATAGG - Intergenic
1076700772 10:132271524-132271546 TCAGATTTGGCCACAATGGACGG - Intronic
1079533444 11:21482710-21482732 TCATATACGGCCATGATTGAGGG - Intronic
1080838715 11:35964629-35964651 CCAGATTTGGACACCATTGAGGG + Intronic
1091597061 12:1885292-1885314 ACATCCATGGCCACTATTGATGG + Intronic
1093719335 12:22420463-22420485 CCATATATCTCCACTCTTGAGGG + Intronic
1093719834 12:22427103-22427125 CCATATATCTCCACTCTTGAGGG + Intronic
1095355983 12:41275742-41275764 CCAAATATGGCCACAAGAGTAGG + Intronic
1095885540 12:47185187-47185209 CCAAATAAGGCCACATTTGCAGG - Intronic
1101150073 12:101876388-101876410 ACATATGTGGCCAAAATTGTTGG - Intergenic
1101429163 12:104612532-104612554 CCAAATAAGGTCACATTTGAAGG + Intronic
1107898026 13:44985659-44985681 TCTTATATGGCCACGATTCATGG - Intronic
1108788793 13:53941179-53941201 ATATATATGGACACAAATGAGGG + Intergenic
1110285645 13:73747219-73747241 CCTTACATGCACACAATTGAGGG + Intronic
1114333396 14:21660851-21660873 TCATAAATGGCCACAAAGGATGG + Intergenic
1114677957 14:24458127-24458149 CCATACTTGGCCACAATAGTTGG - Intergenic
1114980909 14:28162785-28162807 CCACATATGAACACAATTAATGG + Intergenic
1115054985 14:29113392-29113414 TCATATAAGGCCCCATTTGAAGG + Intergenic
1116129706 14:40839272-40839294 GCATATATGGCCACAACAGTGGG + Intergenic
1117548976 14:56815180-56815202 TTAAATATGGCTACAATTGATGG - Intergenic
1121687955 14:95853392-95853414 CCATAAATAGCCAAAATGGAAGG - Intergenic
1124397157 15:29312646-29312668 CCTTATATGGGCACAGTTCATGG - Intronic
1127987859 15:64088320-64088342 GTATATATGCCCACAATTAATGG - Intronic
1130127771 15:81108403-81108425 CCTTATCTGGCCACAACTGTGGG - Intronic
1136082159 16:27859337-27859359 CCATATATGGCCAGAATGACAGG + Intronic
1139735509 16:68984347-68984369 ACTAATATGGCCAGAATTGAAGG + Intronic
1141447425 16:84070450-84070472 TCCTCGATGGCCACAATTGATGG - Intronic
1145368399 17:22286274-22286296 TCAGATATGGACACTATTGATGG + Intergenic
1146078039 17:29750977-29750999 CCATATCTTGCCACACTGGAAGG + Intronic
1146801922 17:35831598-35831620 CCAAACCTGGCCACAATGGATGG - Intronic
1150641340 17:66951888-66951910 CCAAATAAGGCCACATTTGCAGG + Intergenic
1157508427 18:48249354-48249376 CCATAAATGGCCAACATTAAGGG + Intronic
1158581651 18:58689513-58689535 CCATATGTGGGCACAATTCTAGG + Intronic
1159777511 18:72620430-72620452 CCAGAGATGGCCAGACTTGAGGG - Intronic
930056124 2:47253342-47253364 CCACATAAGGCCACATTTCAAGG - Intergenic
931612453 2:64116995-64117017 CCTTATATGGACACAATTCAGGG - Intronic
932532928 2:72556773-72556795 ACTTATATGGCTAAAATTGATGG + Intronic
935687762 2:105699045-105699067 CCATATACAGCCACGACTGAGGG + Intergenic
936974664 2:118207144-118207166 CCACAAATGCCCACAATTGCTGG - Intergenic
937149297 2:119674791-119674813 CCATTTATGGGCACAATTGTGGG + Intergenic
939607640 2:144272176-144272198 CCATATATTGTCACAATAGGGGG + Intronic
940448054 2:153801558-153801580 TCTTGTATGGCCACAATTCATGG + Intergenic
945134186 2:206608787-206608809 CCATTTATGTACACAGTTGAGGG + Intronic
947639619 2:231699666-231699688 CCGTAAATGACCACAATTCAAGG + Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1179082745 21:38188391-38188413 CCAAAGATGGTCAAAATTGAAGG - Intronic
952298227 3:32080600-32080622 CCACATATGGTTACAATTTATGG - Intergenic
955036584 3:55274053-55274075 CCATATATGCCTACAATTTAGGG + Intergenic
955480527 3:59385134-59385156 CAATATTTGGCCACAAATGCAGG - Intergenic
958603058 3:96323854-96323876 CCATGTATTGTCACAATGGATGG - Intergenic
959498383 3:107076997-107077019 CCAAATATGGTCAAATTTGAGGG + Intergenic
963456151 3:145550616-145550638 CCATATATGGCTTCAAATGAAGG + Intergenic
967900978 3:194452062-194452084 CCATGCATAGCCACCATTGAAGG - Intronic
973960029 4:56100572-56100594 CCAAATATGGCCACATTCTAAGG - Intergenic
976466572 4:85376234-85376256 GCATATGTGGCCACAAATGCAGG - Intergenic
985369687 4:189272850-189272872 CCCTCTCTGGCCACAGTTGAGGG + Intergenic
986574241 5:9196222-9196244 CCATATACAGCCACACTGGAGGG - Intronic
992007131 5:72489083-72489105 CCACATCTGGCCAGAATTGTGGG - Intronic
997863698 5:137442808-137442830 CCTTTTCTGGCCACAATTCACGG + Intronic
998407831 5:141883783-141883805 CCCTATCTGGGCACAATTGAAGG + Intergenic
1003176207 6:3753396-3753418 CCATAAATGGCCAAATTTGAAGG + Intergenic
1003478848 6:6512554-6512576 CCATATTTGGCCACTGTAGAGGG + Intergenic
1008669249 6:53749959-53749981 CCATATATTTCCTCAAATGATGG + Intergenic
1011220335 6:85048427-85048449 CCAAAGATGGCCACCAATGATGG + Intergenic
1016323396 6:142872770-142872792 CCTTTAATGGCCACGATTGAGGG + Intronic
1019182682 6:170200878-170200900 CCATTTTTGGCTACAAGTGATGG + Intergenic
1028922973 7:96327135-96327157 CCAAATAAGGTCACAATTGGAGG - Intergenic
1030724214 7:112906351-112906373 CCATATATTTCCACTGTTGATGG + Intronic
1030886016 7:114938472-114938494 TGATATATGGCCAGACTTGAGGG - Intronic
1030908412 7:115214844-115214866 CCATATAAGGCAACATTTGCAGG + Intergenic
1031252002 7:119395964-119395986 CCATATATGTGCACAATGCAGGG + Intergenic
1032407959 7:131671130-131671152 CCATCTTTGGCCAAAATTGCAGG - Intergenic
1040793954 8:51268992-51269014 CCATATATTGGCACCATTCAGGG + Intergenic
1042115067 8:65422433-65422455 CCATATAAGGTCACAGTTGCAGG - Intergenic
1044786764 8:95802416-95802438 CCATATATGGCTACACCTGGGGG - Intergenic
1051777455 9:20651484-20651506 CCATGTAAGGCCACACATGATGG - Intergenic
1051995439 9:23210309-23210331 CTATAAATAGCCACAATTCAGGG - Intergenic
1055678078 9:78686368-78686390 CCATATAAGGTCACATTTGAAGG + Intergenic
1062151228 9:135020170-135020192 CCATATAAGGCAACATTTGCAGG - Intergenic
1186814705 X:13225055-13225077 CAATAAATGCCAACAATTGATGG - Intergenic
1192131413 X:68555168-68555190 CCAAATATGGGCACAGTTGCAGG - Intergenic
1199409321 X:147502184-147502206 ACTTATATGGGCACAATTCATGG - Intergenic
1201650937 Y:16285005-16285027 ACAAATATGGCCACATTAGAAGG + Intergenic