ID: 906760568

View in Genome Browser
Species Human (GRCh38)
Location 1:48373410-48373432
Sequence AAAAATTCTGATAGCGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 4, 3: 60, 4: 241}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906760568_906760571 4 Left 906760568 1:48373410-48373432 CCCATATCGCTATCAGAATTTTT 0: 1
1: 0
2: 4
3: 60
4: 241
Right 906760571 1:48373437-48373459 AAGCCATTCAACAAGTCACTAGG 0: 8
1: 1473
2: 1903
3: 1423
4: 1073

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906760568 Original CRISPR AAAAATTCTGATAGCGATAT GGG (reversed) Intronic
904958055 1:34305200-34305222 AAAATTTCTGAGAGAGATTTTGG - Intergenic
906760568 1:48373410-48373432 AAAAATTCTGATAGCGATATGGG - Intronic
907546539 1:55264674-55264696 AAAAACTCTGATAGTTATGTAGG + Intergenic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909236019 1:73153345-73153367 GAAAATGCTGATAGTGATAATGG - Intergenic
909752459 1:79179593-79179615 CAAAAGCCTGATAGTGATATGGG - Intergenic
911407731 1:97463659-97463681 AAAAATGCTGATAATGATAAGGG + Intronic
911877940 1:103193145-103193167 AAAAATACAGATAGCCATTTAGG - Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
918938976 1:190964985-190965007 CAAAATTCTTATAGCTCTATGGG - Intergenic
919002795 1:191855471-191855493 AAAAAATGTGATAGACATATTGG + Intergenic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
919569993 1:199236298-199236320 AAAAAATCTGATAACAATCTAGG + Intergenic
922310700 1:224387229-224387251 AAAACTTCTGATAGTGCTGTAGG - Exonic
1063860747 10:10305335-10305357 AACAATTATGATACCAATATAGG - Intergenic
1064412805 10:15122133-15122155 AAAAATTCTGATATTGAGAAAGG - Intronic
1065394876 10:25223912-25223934 AAAAATTTTTCTAGCGATGTTGG + Intronic
1065422733 10:25565060-25565082 AAGAATTTTGATAACAATATAGG - Intronic
1066179812 10:32950068-32950090 AAAGATTCTGATACCTATAGAGG + Intronic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1066625471 10:37401616-37401638 AGGAGTTCTGTTAGCGATATGGG + Intergenic
1067075928 10:43182158-43182180 AACAATTCTGATAGAGTGATGGG - Intronic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1068233839 10:54206400-54206422 TAAAATTCTGATAGTGATAAAGG + Intronic
1068710246 10:60126056-60126078 GAAAATTCTGTAAGTGATATTGG - Intronic
1070196039 10:74157319-74157341 AAAAAATCTGATGGAAATATGGG + Intronic
1071507687 10:86242554-86242576 AAAACTTTTGAAAGGGATATAGG + Intronic
1072296103 10:94010847-94010869 CAAAATACTGATAGAAATATGGG - Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073386958 10:103133805-103133827 AAAAATATTGATAGTGACATGGG + Intronic
1073670518 10:105582553-105582575 CAAGATTCTGATAATGATATTGG + Intergenic
1074133634 10:110607887-110607909 AAAAATTCTGCTAGGTATAGTGG + Intergenic
1074796533 10:116951246-116951268 AAAAATTTTTATAGAGATGTGGG - Intronic
1077736923 11:4801083-4801105 CAAAATGCTGATAGAAATATGGG - Intronic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1078932609 11:15924126-15924148 AAAAATTCTGTGAGATATATAGG + Intergenic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1079758631 11:24299621-24299643 AATAATTCTGATAGATATATTGG + Intergenic
1081122757 11:39286521-39286543 CAAAATACTGATAGCGATATGGG - Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1086862023 11:91935429-91935451 AAAAATACTGATAGGAATAGGGG - Intergenic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088195926 11:107273467-107273489 ATAAACTTTGATAGCAATATGGG + Intergenic
1090120954 11:124027650-124027672 AAAAGTTCTGATATCCATGTTGG + Intergenic
1090506603 11:127321514-127321536 TAAAATGCTGATAGTGTTATGGG - Intergenic
1091513611 12:1155171-1155193 AAAAAATCTGATGGGCATATTGG + Intronic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1093683387 12:22029209-22029231 AAAAATTTTGATAGCTTTAGGGG - Intergenic
1093721350 12:22445747-22445769 ATAAATTCAGATATCAATATAGG + Intergenic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095671325 12:44863438-44863460 AAAACTTCTGTTAGCTTTATTGG - Intronic
1095789570 12:46149689-46149711 AAAAAATCTGATAGGAAGATGGG + Intergenic
1096960340 12:55570708-55570730 CAAAATACTGATAGCAATATGGG - Intergenic
1097343751 12:58468239-58468261 AAAAATGGTGATAGTGATATGGG - Intergenic
1097921411 12:65078434-65078456 AAAAATTCTCTTAGGGAAATAGG + Intronic
1098110472 12:67116559-67116581 AAAAATTCAGATAATGAAATAGG - Intergenic
1098799943 12:74943205-74943227 AATAATTCTAAGAGCTATATGGG + Intergenic
1099337067 12:81376106-81376128 AATAATTCTGATAGCTAAGTTGG - Intronic
1099348119 12:81528268-81528290 AAGAACTCAGATAGTGATATGGG + Intronic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1100555171 12:95686191-95686213 GATAATTCTTATAGAGATATAGG + Intronic
1100650045 12:96576629-96576651 AATATTTCTGATAGGAATATAGG - Exonic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1105444438 13:20440528-20440550 AAAAAGTCTGCCAACGATATGGG + Intronic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1107771282 13:43789284-43789306 AAAAACTCTGATACCGAAAATGG + Intergenic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1111790703 13:92851342-92851364 AAAAATTCTGGGAGCCAAATGGG - Intronic
1112861455 13:103833063-103833085 CAAAATACTGATACTGATATTGG + Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114618169 14:24079514-24079536 AGAAATTCTGAGAGCGATGGAGG + Intergenic
1115012168 14:28562123-28562145 AATAATTCTGATATTGCTATAGG + Intergenic
1115345028 14:32333697-32333719 AAAAATACTAATTGCCATATTGG - Intronic
1115401660 14:32968455-32968477 TAAAATTCTGAAGGTGATATAGG + Intronic
1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG + Intergenic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1117838691 14:59834519-59834541 AAAAAATCTAATAGTGAAATGGG + Intronic
1120072723 14:80122036-80122058 CAAAATGCTGATAGAAATATGGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1120937999 14:89917708-89917730 AAAAATTCTGATTGCCCTAGGGG + Intronic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1124871020 15:33542739-33542761 AAAAATTCTGACACAGACATTGG + Intronic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1128775776 15:70319007-70319029 AAAAATAAAGATAGAGATATAGG - Intergenic
1129504072 15:76066410-76066432 AAAAATTCTAACAGCTTTATAGG - Intronic
1129594727 15:76953323-76953345 AGAAATTCTGGTAACAATATGGG - Intronic
1129990761 15:79960337-79960359 AGCAAATCTGATTGCGATATGGG - Intergenic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1131410101 15:92200401-92200423 CAAAATGCTGATAGAAATATGGG + Intergenic
1135894927 16:26390976-26390998 AAGAATTCTGATAGAAATGTTGG - Intergenic
1136495819 16:30643340-30643362 AAAAATTTTTATAGAGATAAGGG - Intergenic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1138240366 16:55422766-55422788 AATAATGCTGATAGAGTTATTGG - Intronic
1138919939 16:61515192-61515214 TATAATTCTTATAGTGATATAGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1142824585 17:2500763-2500785 CAAAATTATGATAACTATATGGG - Intronic
1149891941 17:60397792-60397814 AAAAATTCTGAGACAGAGATGGG + Intronic
1152411384 17:80125367-80125389 AACAATTCTGATATCCATAAAGG - Intergenic
1153360956 18:4196389-4196411 AAAAATGCTGATTGCCATGTGGG + Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156249682 18:35340566-35340588 AAAAATTCTGAGAGTGAAGTTGG - Exonic
1158536419 18:58312094-58312116 AAAAATTCATATTCCGATATTGG - Intronic
1158688829 18:59642168-59642190 AAACAATCTGATAGAGAAATAGG + Intronic
1159825634 18:73205780-73205802 AAAAATTCTAAAAGCTGTATAGG - Intronic
1161762727 19:6186338-6186360 AAAAATTATGATATTCATATTGG - Intronic
1166017420 19:39993266-39993288 TAAAATGCTGATAGTGATAACGG + Intronic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
926998033 2:18759407-18759429 CAAAATTATGATAACTATATTGG - Intergenic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
931636569 2:64345819-64345841 AAACATTCTCAAAGCGATATTGG + Intergenic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
933317679 2:80735511-80735533 AAAAATTATGATAGTGAAAGAGG + Intergenic
935404638 2:102696368-102696390 AAAAATTCTGTTAGCAAGTTAGG - Intronic
935483426 2:103621880-103621902 AAATCTGCTGATAGCCATATTGG - Intergenic
935932507 2:108143313-108143335 AGAAATTCTGATATAGATAAAGG + Intergenic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936908051 2:117559846-117559868 AAAAATTCTGAGATGGATACAGG + Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937755169 2:125528449-125528471 AAAAATTCTCATAACAATAGGGG + Intergenic
938587965 2:132710016-132710038 AAAAAATATCATAGCTATATAGG + Intronic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940387378 2:153089837-153089859 AAAAATTCAAAAAGCAATATGGG - Intergenic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
942905764 2:181179053-181179075 TAAAATTCTGATAGCAATGCTGG - Intergenic
943213065 2:184993300-184993322 CAACATTCTGATAGATATATTGG + Intergenic
943227620 2:185200116-185200138 CAAAATTATGATAGATATATAGG - Intergenic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
947569311 2:231219235-231219257 AAAAATACTGGTAGCTATAAGGG - Intronic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1174736100 20:52967628-52967650 TAAAATTCTGAGAAGGATATTGG + Intergenic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1180239514 21:46491352-46491374 AAAAATTTTAATAGGGATAATGG + Intronic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951503366 3:23415345-23415367 AAAAATACTGATACAGACATAGG - Intronic
951668909 3:25158917-25158939 AAAAATTCTGTAGGCGATTTGGG + Intergenic
952675674 3:36027380-36027402 AAAAATTCTGAGAGAGGTTTAGG - Intergenic
952799394 3:37274704-37274726 AAAAATTGTGATAGCAGTGTTGG + Intronic
952973928 3:38677977-38677999 AAAATTTCTGATAATGACATGGG + Intergenic
954102327 3:48384085-48384107 AAAAATTCTGAGATTTATATTGG + Intronic
957313654 3:78550160-78550182 AAAATCTCTGATAGGAATATGGG - Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
959028258 3:101267384-101267406 AAAAAGTCAGACAGTGATATTGG + Intronic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963464165 3:145657363-145657385 AAATATTCTGAAAGCCGTATTGG + Intergenic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
964944967 3:162210246-162210268 AACAATTTTGATAGCTAAATCGG - Intergenic
965232713 3:166073438-166073460 AAAAATGCTGATAGAAATATGGG - Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967390894 3:188953128-188953150 AATAGTTCTGGTAGAGATATAGG + Intronic
967788774 3:193524961-193524983 AAAAAATCAGATAGAGATAAAGG - Intronic
968095199 3:195924974-195924996 ATACATTCTGATAGCTATCTGGG + Intergenic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
971809397 4:31404702-31404724 AAAAATTTTTATTGGGATATGGG + Intergenic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
973946934 4:55967118-55967140 AAAAATTCTGACAGCCTGATGGG + Intronic
974477250 4:62399056-62399078 AAAAAACCTGATAGAAATATGGG - Intergenic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
974724105 4:65777061-65777083 CAAAATTCTGATAATGATACGGG + Intergenic
975243173 4:72086983-72087005 AAACATTCTGACAGAGAAATTGG + Intronic
975831045 4:78369125-78369147 AAAAGTTCTGAGAGTTATATCGG + Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977639320 4:99338157-99338179 AAAAATTGTGATATCAATATTGG - Intronic
977788828 4:101073728-101073750 AAAGATTCTTAAAGCCATATGGG - Intronic
979654150 4:123172268-123172290 AAAAATTGTTATAGCCCTATGGG + Intronic
979791229 4:124783901-124783923 AAGAATTCTGGTAGCAATCTGGG + Intergenic
981343249 4:143647051-143647073 TAAAATGTTGATAGTGATATGGG + Intronic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981416217 4:144497015-144497037 TAAAATTCTTATAGGGTTATAGG + Intergenic
981431184 4:144662987-144663009 AAAAATTCTTATAGCCAAGTTGG + Intronic
981485695 4:145283840-145283862 AAAAATTATGATAGAGCTTTAGG - Intergenic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
982210281 4:153029194-153029216 CAAAATGCTGATAGAAATATGGG - Intergenic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
984512358 4:180694017-180694039 CAAAATACTAATAGTGATATAGG - Intergenic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
987798123 5:22655808-22655830 TAAAATTCTGATTCCCATATGGG - Intronic
987933205 5:24428968-24428990 AAAAAATCTGATAGCTAATTTGG - Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
992183742 5:74223461-74223483 AAAAATTTTGATATAGCTATAGG - Intergenic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993792625 5:92225203-92225225 CAAAATACTGATAGTGAGATGGG - Intergenic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994849569 5:105036671-105036693 CAAAACCCTGATAGTGATATGGG - Intergenic
995211964 5:109550959-109550981 CAAAATGCTGATAGCCATATGGG + Intergenic
996412039 5:123169112-123169134 AAAAATTTTGAAAAGGATATTGG - Intronic
997204353 5:132034802-132034824 AAATTTTCTGGTAGCTATATTGG - Intergenic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000768416 5:165319765-165319787 CAAAAAGCTGATAGTGATATGGG - Intergenic
1004545058 6:16589706-16589728 AACAATACTGATAGTGATAATGG - Intronic
1006344060 6:33465786-33465808 CAAAATGCTGATAGCAATATGGG + Intergenic
1007545298 6:42688888-42688910 AAGAATTTAGATAGTGATATAGG + Intronic
1008445829 6:51589355-51589377 ATAAAATCTGATAGAAATATTGG - Intergenic
1009608812 6:65909612-65909634 AAAAATACTGATAACAATAAGGG - Intergenic
1009687001 6:66973890-66973912 AAAAATTTTGGTAGCTATATGGG - Intergenic
1009732082 6:67621728-67621750 AAAAATACTGATAATGATATGGG + Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1011521227 6:88209037-88209059 GAAAATTCTGAGAACGATTTTGG - Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012630108 6:101455385-101455407 AAAAATTCTTCTAAGGATATTGG + Intronic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1014691277 6:124566252-124566274 ACAAAATCTGGTAGAGATATTGG + Intronic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020518001 7:9149433-9149455 AAAAACTCTGATAGTAATACTGG - Intergenic
1020898968 7:13979020-13979042 AAAAATTCTCCTTGCAATATAGG - Intronic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1021443377 7:20705560-20705582 AAAAATTCTAGTAGAGTTATAGG + Intronic
1023351619 7:39325920-39325942 AAAAATTATGCTACCGGTATGGG - Intronic
1023498422 7:40822776-40822798 AGAAATCCTGAAAGAGATATGGG + Intronic
1023614781 7:42008846-42008868 AAAAATTATGATAACAACATAGG - Intronic
1026976933 7:74504681-74504703 AAAAATTCTGATGGCAGCATTGG - Intronic
1027337444 7:77167893-77167915 AAGAATTTTGATAATGATATTGG - Intronic
1027622788 7:80512402-80512424 ATATATTCTGATTGTGATATAGG - Intronic
1029415237 7:100438585-100438607 AAAATTTTTAATAGCGACATAGG + Intergenic
1029778298 7:102702905-102702927 AAGAATTTTGATAATGATATTGG + Intergenic
1030227921 7:107172712-107172734 AACAATTCTGATAGGTAGATAGG + Intronic
1030689048 7:112514124-112514146 CAAAACTCTGATAGAGATAAAGG + Intergenic
1031261928 7:119532438-119532460 CAAAATTCTGATAGTGATGTGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1032690239 7:134278496-134278518 AACACTTCTCATAGCAATATTGG + Intergenic
1032863903 7:135906774-135906796 AAAAATCCTGATGGTAATATGGG + Intergenic
1032981840 7:137292976-137292998 AAAAATTCTGATAGAGTGTTAGG - Intronic
1034029760 7:147747738-147747760 ACAAATACTGATGGGGATATGGG - Intronic
1034277978 7:149832081-149832103 AAAAATTCCGAAAGTGATTTGGG - Intergenic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1035064137 7:156093187-156093209 AAAAATTCTAATAGGGAAAAAGG - Intergenic
1038654777 8:29439208-29439230 TAAAATTTTGATAGCCAAATAGG + Intergenic
1039046588 8:33456055-33456077 AAAAATGCTGAGAGAGCTATTGG - Intronic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1043850849 8:85215163-85215185 AAAAATTCTTATAGTCTTATTGG + Intronic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044127104 8:88472209-88472231 CAAAATGCTGAGAGTGATATGGG - Intergenic
1044419122 8:91971210-91971232 AAAAATTATAATAATGATATAGG - Intronic
1044811393 8:96066768-96066790 AAAAACTCTGATAACTGTATTGG - Intergenic
1044865518 8:96567251-96567273 AAGAATTCTGGTAGCGAAAGGGG + Intronic
1045050589 8:98320677-98320699 CAAAATGCTGATAGCAATACGGG - Intergenic
1045229237 8:100285619-100285641 AAAAATTCTGACAATGATAAAGG - Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1046710185 8:117502512-117502534 AAAAATTTTTATAGCTATTTTGG - Intergenic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1050890625 9:10819845-10819867 AAAAATGCTGAGAGTGATATGGG - Intergenic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1052364435 9:27596155-27596177 AAAAATACTGATACTGTTATGGG - Intergenic
1055299829 9:74871371-74871393 AAAAATTCTTACATAGATATAGG + Intronic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189504854 X:41602468-41602490 AAAAAATCTAATAGCATTATAGG - Intronic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1189872161 X:45395227-45395249 AAATATGCTGATAGTCATATTGG + Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1197102161 X:122669126-122669148 AAAAATACTATTAGAGATATAGG - Intergenic
1197248135 X:124187634-124187656 AAAAATACTGATGGCCATAGAGG - Intronic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1198569189 X:137937314-137937336 CAAAATGCTGATAGAAATATGGG + Intergenic
1198588470 X:138149197-138149219 CAAAATGCTGATAGAAATATGGG + Intergenic
1199309507 X:146306828-146306850 AAAACTGCTGATGGCAATATAGG + Intergenic
1199775620 X:151008884-151008906 AAAAATATTGATAGCAATAGTGG + Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic