ID: 906760568

View in Genome Browser
Species Human (GRCh38)
Location 1:48373410-48373432
Sequence AAAAATTCTGATAGCGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 4, 3: 60, 4: 241}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906760568_906760571 4 Left 906760568 1:48373410-48373432 CCCATATCGCTATCAGAATTTTT 0: 1
1: 0
2: 4
3: 60
4: 241
Right 906760571 1:48373437-48373459 AAGCCATTCAACAAGTCACTAGG 0: 8
1: 1473
2: 1903
3: 1423
4: 1073

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906760568 Original CRISPR AAAAATTCTGATAGCGATAT GGG (reversed) Intronic