ID: 906760568 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:48373410-48373432 |
Sequence | AAAAATTCTGATAGCGATAT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 306 | |||
Summary | {0: 1, 1: 0, 2: 4, 3: 60, 4: 241} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
906760568_906760571 | 4 | Left | 906760568 | 1:48373410-48373432 | CCCATATCGCTATCAGAATTTTT | 0: 1 1: 0 2: 4 3: 60 4: 241 |
||
Right | 906760571 | 1:48373437-48373459 | AAGCCATTCAACAAGTCACTAGG | 0: 8 1: 1473 2: 1903 3: 1423 4: 1073 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
906760568 | Original CRISPR | AAAAATTCTGATAGCGATAT GGG (reversed) | Intronic | ||