ID: 906760568 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:48373410-48373432 |
| Sequence | AAAAATTCTGATAGCGATAT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 306 | |||
| Summary | {0: 1, 1: 0, 2: 4, 3: 60, 4: 241} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 906760568_906760571 | 4 | Left | 906760568 | 1:48373410-48373432 | CCCATATCGCTATCAGAATTTTT | 0: 1 1: 0 2: 4 3: 60 4: 241 |
||
| Right | 906760571 | 1:48373437-48373459 | AAGCCATTCAACAAGTCACTAGG | 0: 8 1: 1473 2: 1903 3: 1423 4: 1073 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 906760568 | Original CRISPR | AAAAATTCTGATAGCGATAT GGG (reversed) | Intronic | ||