ID: 906771662

View in Genome Browser
Species Human (GRCh38)
Location 1:48490436-48490458
Sequence CAGGGGCCCTGGCAGTATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906771654_906771662 15 Left 906771654 1:48490398-48490420 CCTTTTTCTAATTCACAAAAAGA No data
Right 906771662 1:48490436-48490458 CAGGGGCCCTGGCAGTATGAGGG No data
906771659_906771662 -10 Left 906771659 1:48490423-48490445 CCACACAGGCTATCAGGGGCCCT No data
Right 906771662 1:48490436-48490458 CAGGGGCCCTGGCAGTATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906771662 Original CRISPR CAGGGGCCCTGGCAGTATGA GGG Intergenic
No off target data available for this crispr