ID: 906772119

View in Genome Browser
Species Human (GRCh38)
Location 1:48494595-48494617
Sequence GAGTATACTCTGATGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906772119_906772125 12 Left 906772119 1:48494595-48494617 CCTTGCTCCATCAGAGTATACTC No data
Right 906772125 1:48494630-48494652 TGATGAATAAGAGTATAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906772119 Original CRISPR GAGTATACTCTGATGGAGCA AGG (reversed) Intergenic
No off target data available for this crispr