ID: 906772125

View in Genome Browser
Species Human (GRCh38)
Location 1:48494630-48494652
Sequence TGATGAATAAGAGTATAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906772118_906772125 13 Left 906772118 1:48494594-48494616 CCCTTGCTCCATCAGAGTATACT No data
Right 906772125 1:48494630-48494652 TGATGAATAAGAGTATAGTTAGG No data
906772119_906772125 12 Left 906772119 1:48494595-48494617 CCTTGCTCCATCAGAGTATACTC No data
Right 906772125 1:48494630-48494652 TGATGAATAAGAGTATAGTTAGG No data
906772120_906772125 5 Left 906772120 1:48494602-48494624 CCATCAGAGTATACTCTCCCAGC No data
Right 906772125 1:48494630-48494652 TGATGAATAAGAGTATAGTTAGG No data
906772117_906772125 29 Left 906772117 1:48494578-48494600 CCAAAGCAAAATGTGACCCTTGC No data
Right 906772125 1:48494630-48494652 TGATGAATAAGAGTATAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906772125 Original CRISPR TGATGAATAAGAGTATAGTT AGG Intergenic
No off target data available for this crispr