ID: 906773254

View in Genome Browser
Species Human (GRCh38)
Location 1:48504275-48504297
Sequence AGTCTGATAGTACCACATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906773254_906773255 23 Left 906773254 1:48504275-48504297 CCAACATGTGGTACTATCAGACT No data
Right 906773255 1:48504321-48504343 TTTTTAAAAGTTAACTTAGTTGG No data
906773254_906773256 30 Left 906773254 1:48504275-48504297 CCAACATGTGGTACTATCAGACT No data
Right 906773256 1:48504328-48504350 AAGTTAACTTAGTTGGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906773254 Original CRISPR AGTCTGATAGTACCACATGT TGG (reversed) Intergenic
No off target data available for this crispr