ID: 906773573

View in Genome Browser
Species Human (GRCh38)
Location 1:48507777-48507799
Sequence TTTCTCATGAAAAGAAATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906773573_906773577 9 Left 906773573 1:48507777-48507799 CCCTAATTTCTTTTCATGAGAAA No data
Right 906773577 1:48507809-48507831 AAGACCACCTTGCAGGCACCAGG No data
906773573_906773578 10 Left 906773573 1:48507777-48507799 CCCTAATTTCTTTTCATGAGAAA No data
Right 906773578 1:48507810-48507832 AGACCACCTTGCAGGCACCAGGG No data
906773573_906773576 2 Left 906773573 1:48507777-48507799 CCCTAATTTCTTTTCATGAGAAA No data
Right 906773576 1:48507802-48507824 GTGTTTTAAGACCACCTTGCAGG No data
906773573_906773582 27 Left 906773573 1:48507777-48507799 CCCTAATTTCTTTTCATGAGAAA No data
Right 906773582 1:48507827-48507849 CCAGGGATGCTCACTACTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906773573 Original CRISPR TTTCTCATGAAAAGAAATTA GGG (reversed) Intergenic