ID: 906773574

View in Genome Browser
Species Human (GRCh38)
Location 1:48507778-48507800
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906773574_906773577 8 Left 906773574 1:48507778-48507800 CCTAATTTCTTTTCATGAGAAAT No data
Right 906773577 1:48507809-48507831 AAGACCACCTTGCAGGCACCAGG No data
906773574_906773576 1 Left 906773574 1:48507778-48507800 CCTAATTTCTTTTCATGAGAAAT No data
Right 906773576 1:48507802-48507824 GTGTTTTAAGACCACCTTGCAGG No data
906773574_906773582 26 Left 906773574 1:48507778-48507800 CCTAATTTCTTTTCATGAGAAAT No data
Right 906773582 1:48507827-48507849 CCAGGGATGCTCACTACTACTGG No data
906773574_906773578 9 Left 906773574 1:48507778-48507800 CCTAATTTCTTTTCATGAGAAAT No data
Right 906773578 1:48507810-48507832 AGACCACCTTGCAGGCACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906773574 Original CRISPR ATTTCTCATGAAAAGAAATT AGG (reversed) Intergenic