ID: 906773579

View in Genome Browser
Species Human (GRCh38)
Location 1:48507813-48507835
Sequence CATCCCTGGTGCCTGCAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906773579_906773582 -9 Left 906773579 1:48507813-48507835 CCACCTTGCAGGCACCAGGGATG No data
Right 906773582 1:48507827-48507849 CCAGGGATGCTCACTACTACTGG No data
906773579_906773583 10 Left 906773579 1:48507813-48507835 CCACCTTGCAGGCACCAGGGATG No data
Right 906773583 1:48507846-48507868 CTGGACCTGTCATTGTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906773579 Original CRISPR CATCCCTGGTGCCTGCAAGG TGG (reversed) Intergenic