ID: 906773582

View in Genome Browser
Species Human (GRCh38)
Location 1:48507827-48507849
Sequence CCAGGGATGCTCACTACTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906773579_906773582 -9 Left 906773579 1:48507813-48507835 CCACCTTGCAGGCACCAGGGATG No data
Right 906773582 1:48507827-48507849 CCAGGGATGCTCACTACTACTGG No data
906773573_906773582 27 Left 906773573 1:48507777-48507799 CCCTAATTTCTTTTCATGAGAAA No data
Right 906773582 1:48507827-48507849 CCAGGGATGCTCACTACTACTGG No data
906773574_906773582 26 Left 906773574 1:48507778-48507800 CCTAATTTCTTTTCATGAGAAAT No data
Right 906773582 1:48507827-48507849 CCAGGGATGCTCACTACTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906773582 Original CRISPR CCAGGGATGCTCACTACTAC TGG Intergenic