ID: 906773582 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:48507827-48507849 |
| Sequence | CCAGGGATGCTCACTACTAC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 906773579_906773582 | -9 | Left | 906773579 | 1:48507813-48507835 | CCACCTTGCAGGCACCAGGGATG | No data | ||
| Right | 906773582 | 1:48507827-48507849 | CCAGGGATGCTCACTACTACTGG | No data | ||||
| 906773573_906773582 | 27 | Left | 906773573 | 1:48507777-48507799 | CCCTAATTTCTTTTCATGAGAAA | No data | ||
| Right | 906773582 | 1:48507827-48507849 | CCAGGGATGCTCACTACTACTGG | No data | ||||
| 906773574_906773582 | 26 | Left | 906773574 | 1:48507778-48507800 | CCTAATTTCTTTTCATGAGAAAT | No data | ||
| Right | 906773582 | 1:48507827-48507849 | CCAGGGATGCTCACTACTACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 906773582 | Original CRISPR | CCAGGGATGCTCACTACTAC TGG | Intergenic | ||