ID: 906777318

View in Genome Browser
Species Human (GRCh38)
Location 1:48541429-48541451
Sequence CTTATTGTCAGATGAGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 158}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906777318_906777319 17 Left 906777318 1:48541429-48541451 CCACACACTCATCTGACAATAAG 0: 1
1: 0
2: 0
3: 12
4: 158
Right 906777319 1:48541469-48541491 TTGAATTAGTAAATAATAGCTGG 0: 1
1: 0
2: 1
3: 19
4: 306
906777318_906777323 30 Left 906777318 1:48541429-48541451 CCACACACTCATCTGACAATAAG 0: 1
1: 0
2: 0
3: 12
4: 158
Right 906777323 1:48541482-48541504 TAATAGCTGGGTGGGTGCAGTGG 0: 1
1: 2
2: 29
3: 197
4: 1441
906777318_906777320 18 Left 906777318 1:48541429-48541451 CCACACACTCATCTGACAATAAG 0: 1
1: 0
2: 0
3: 12
4: 158
Right 906777320 1:48541470-48541492 TGAATTAGTAAATAATAGCTGGG 0: 1
1: 0
2: 0
3: 22
4: 350
906777318_906777321 21 Left 906777318 1:48541429-48541451 CCACACACTCATCTGACAATAAG 0: 1
1: 0
2: 0
3: 12
4: 158
Right 906777321 1:48541473-48541495 ATTAGTAAATAATAGCTGGGTGG 0: 1
1: 0
2: 0
3: 12
4: 224
906777318_906777322 22 Left 906777318 1:48541429-48541451 CCACACACTCATCTGACAATAAG 0: 1
1: 0
2: 0
3: 12
4: 158
Right 906777322 1:48541474-48541496 TTAGTAAATAATAGCTGGGTGGG 0: 1
1: 0
2: 1
3: 13
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906777318 Original CRISPR CTTATTGTCAGATGAGTGTG TGG (reversed) Intronic
905940878 1:41862308-41862330 CTTATGGTCAGATAAATGTTAGG - Intronic
906646833 1:47481226-47481248 CTTATTGAAGGATGTGTGTGTGG + Intergenic
906777318 1:48541429-48541451 CTTATTGTCAGATGAGTGTGTGG - Intronic
908688272 1:66748216-66748238 CTTTTTGTCAGTGGAGTGTATGG + Exonic
910243076 1:85109463-85109485 ATTATTCTTAGATGAGTTTGGGG - Intronic
911092356 1:94027875-94027897 CTTATTGGCTGATGAGGCTGAGG + Intronic
911855246 1:102868529-102868551 CTTATTCTCAGATGAGATTTTGG - Intergenic
912493954 1:110079411-110079433 CTTATTGCCAGATCAGGGTGGGG + Intergenic
919031138 1:192244298-192244320 CATATTGTAAGCAGAGTGTGTGG - Intergenic
920746887 1:208637439-208637461 CTTAATGACTGATGCGTGTGAGG + Intergenic
921369051 1:214402972-214402994 CTTAAGGTCACATGAGGGTGTGG + Intronic
921641372 1:217559002-217559024 CGTGTGGTCAGTTGAGTGTGAGG - Intronic
922429117 1:225529572-225529594 TTTATTGTCTGATGAGTTTCAGG + Intronic
923118744 1:230970221-230970243 CTTAAGGTCAGTTGTGTGTGAGG - Intronic
923903146 1:238351793-238351815 TTTATTGTATCATGAGTGTGTGG + Intergenic
924021416 1:239787675-239787697 CTCATTAACAGAGGAGTGTGAGG - Intronic
924719132 1:246606461-246606483 CTTATTAACAGAAGAGGGTGCGG - Intronic
924722324 1:246635584-246635606 CTTATTAGCAGAAGAGGGTGCGG - Intronic
924795551 1:247289892-247289914 CTTATTAGCAGAAGAGGGTGCGG + Intergenic
1062917722 10:1254603-1254625 CTTATGGTCAGGTGAATTTGGGG + Intronic
1063975207 10:11409451-11409473 ATAATTGTCAGAAGAGGGTGAGG + Intergenic
1068920866 10:62482551-62482573 CTGATTCTTAGATGGGTGTGTGG + Intronic
1069050528 10:63787988-63788010 CTTTTTGTAACATGAGTTTGTGG - Intergenic
1073916865 10:108415283-108415305 CTTGTTGTCAGATAAATTTGAGG + Intergenic
1074462950 10:113655149-113655171 GGTATTGTCAGATAAGTGTTTGG - Intronic
1079745434 11:24122484-24122506 CTTATTTTTAGCTGAGTGTCCGG - Intergenic
1080002438 11:27364614-27364636 CCTATTTTCAGAGGAGTGTTAGG - Intergenic
1080924229 11:36739408-36739430 CTTCTGCTCAGATGACTGTGTGG - Intergenic
1084545565 11:69813529-69813551 CTGAATGTCAGATGGGTGGGTGG + Intronic
1085916646 11:80897075-80897097 CTTATTGCCATATGAGTCTTAGG + Intergenic
1086210226 11:84309352-84309374 ATTATTGTCAGATAATTATGAGG - Intronic
1086355980 11:85999968-85999990 CTTGTTTTCAGATGAGACTGTGG - Intronic
1086508785 11:87532817-87532839 CTTGTTGTCTGATAAGTCTGTGG + Intergenic
1086942318 11:92811252-92811274 CTTATTAGCAGATGACTTTGGGG + Intronic
1087048261 11:93862564-93862586 CTTATTAGCAGAAGAGGGTGGGG - Intergenic
1087194786 11:95294427-95294449 CGTTTTGTTAGATGTGTGTGTGG - Intergenic
1088537285 11:110875083-110875105 TTTATTGAGAGCTGAGTGTGAGG + Intergenic
1088872414 11:113902232-113902254 CTTATTCTCAAATGATTGTGGGG - Intergenic
1091537692 12:1428245-1428267 CACATTTTCAGATGACTGTGTGG - Intronic
1093274253 12:17104409-17104431 CTGATTGTAAGCTGCGTGTGTGG + Intergenic
1095165230 12:38964366-38964388 CCCTTTGTCAGATGAGTATGTGG + Intergenic
1096926219 12:55150389-55150411 CTATTAGTGAGATGAGTGTGGGG - Intergenic
1098189171 12:67929720-67929742 CTCATTTTCAGATAAGTATGAGG + Intergenic
1098269383 12:68755083-68755105 CTTGTTGTCAGATGAGGATATGG - Intronic
1099150134 12:79100594-79100616 CTTATTATCAGATGATGGGGTGG + Intronic
1099398373 12:82170247-82170269 CTTTTTGGAAGGTGAGTGTGGGG + Intergenic
1099862227 12:88234728-88234750 CTTATTAGCAGAAGAGGGTGGGG + Intergenic
1104630810 12:130400529-130400551 TTTATGGGCAGATGAGTTTGGGG - Intronic
1105200749 13:18173084-18173106 ATTATTATCACATGAGTGTGGGG + Intergenic
1106307764 13:28528556-28528578 CTTTTTGTGAGAAGACTGTGGGG + Intergenic
1107304887 13:39007465-39007487 TTTATTGTAAGATGAGTGGCTGG + Intergenic
1107997921 13:45879182-45879204 ATGAGTGTCAGATGAGCGTGAGG - Intergenic
1109147640 13:58800982-58801004 CTTATTGTCACATAATTTTGTGG - Intergenic
1112653490 13:101423783-101423805 CTTATTATCAGAGAAGTTTGAGG - Intergenic
1115997418 14:39209167-39209189 CTTATTTTCAGCTGAGTGTATGG - Intergenic
1118514614 14:66511483-66511505 CATATTGTAAAATGTGTGTGTGG - Intronic
1120684209 14:87518798-87518820 CTAGTTGTCTGATAAGTGTGGGG + Intergenic
1122238637 14:100347269-100347291 CTTGTTGTCGGATGAGCGTATGG + Intronic
1124616657 15:31247146-31247168 TTTATTCTCAGTAGAGTGTGAGG + Intergenic
1126261561 15:46699008-46699030 CTTATGAACAGATGAATGTGTGG - Intergenic
1129502859 15:76057185-76057207 CTTATTGACAGGAGAGGGTGGGG - Intronic
1132248309 15:100314995-100315017 CTTATTGTCAAATGCCTCTGAGG + Intronic
1133761652 16:8803525-8803547 CTTATTAAAATATGAGTGTGGGG + Intronic
1135941728 16:26827777-26827799 CTTTTTGCCATATGAGTCTGTGG - Intergenic
1137070790 16:35903117-35903139 CTTATTAGCAGAAGAGAGTGGGG - Intergenic
1141059671 16:80854202-80854224 CTTACTGTCTGTTGAGTGAGTGG - Intergenic
1141378838 16:83557140-83557162 CTTATTGTCAACTGCATGTGAGG + Intronic
1143146467 17:4779725-4779747 AATATTGTGAGATGAGCGTGAGG + Intronic
1143632877 17:8148829-8148851 CTTATTGTTGGAGGAGTGGGTGG - Intronic
1146128560 17:30249730-30249752 CTTATTTGCAGATGATAGTGTGG + Intronic
1146416340 17:32636762-32636784 CTCATTGTGTGATAAGTGTGGGG - Intronic
1149673795 17:58440137-58440159 CTGAGTGTCAGGTGAGAGTGGGG + Intronic
1149730913 17:58945441-58945463 TTTAGTGTCAGAAGTGTGTGAGG - Intronic
1149815743 17:59722127-59722149 ATTATAGTCACATGAGTGTTAGG + Intronic
1149822450 17:59792886-59792908 ATTATTATCAGATGAGTGGCTGG + Intronic
1152487907 17:80607038-80607060 CTTCTTAGCAGCTGAGTGTGAGG + Intronic
1153533897 18:6079346-6079368 ATTTATGTCAGAAGAGTGTGAGG - Intronic
1155448796 18:25942116-25942138 CTTATAGACTGATGAGTGCGTGG - Intergenic
1158134518 18:54191676-54191698 ATAATTGTCAGATTATTGTGAGG - Intronic
1161076629 19:2288944-2288966 TTTAGTGTCAGCTGGGTGTGAGG + Intronic
1161474479 19:4476689-4476711 CTCATTGGCAAATGAGTGTCTGG + Intronic
1164935348 19:32206082-32206104 CTTGTTGTCAGATGGCTGTGAGG - Intergenic
1166503571 19:43357695-43357717 CTTATTGTGGGCTGTGTGTGTGG - Intronic
1166506883 19:43377066-43377088 CTTATTGTGGGCTGTGTGTGTGG + Intergenic
925952390 2:8927343-8927365 CATATTGTCTGCTAAGTGTGGGG + Intronic
926278619 2:11425740-11425762 CTTATTAGCAGAAGAGGGTGGGG + Intergenic
927045035 2:19269468-19269490 CTTACTGTTAGATAAGTGTTAGG - Intergenic
930384676 2:50679127-50679149 GTTACTGTCAGAAGAGTATGTGG + Intronic
931556092 2:63507399-63507421 CAAATTGTCACTTGAGTGTGAGG + Intronic
934116734 2:88805778-88805800 ATTATTATCACATGAGTGTGGGG - Intergenic
934796999 2:97109973-97109995 TTCATTGTCAGGTGAGTGTCTGG + Intergenic
934807699 2:97250543-97250565 ATTATTATCACATGAGTGTGGGG - Intronic
934829811 2:97506644-97506666 ATTATTATCACACGAGTGTGGGG + Intronic
934836415 2:97593454-97593476 TTCATTGTCAGGTGAGTGTCTGG - Intergenic
936906784 2:117545340-117545362 CCTCTTGTCAGCTGTGTGTGAGG + Intergenic
938189149 2:129258766-129258788 CTTAGGATCAGTTGAGTGTGTGG + Intergenic
939218267 2:139268240-139268262 CATATTGAAAGATGAGTGTCAGG - Intergenic
941182874 2:162282719-162282741 CTTATTGACAGATGAATGAAAGG - Intronic
941733205 2:168942981-168943003 CTTATCTTAAGATTAGTGTGAGG - Intronic
944136322 2:196403985-196404007 GTTTTTCTCAGATGAATGTGAGG - Intronic
1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG + Intronic
1169738424 20:8863275-8863297 ATTATTGTCAGATGCAGGTGTGG - Intronic
1172571505 20:35974435-35974457 CTTGTTGTCAGGGGAATGTGAGG + Intronic
1173517761 20:43677344-43677366 CTAATTGTAAGATGAGTGGATGG + Intronic
1178807803 21:35854085-35854107 CTTAGTGAGAGAGGAGTGTGAGG + Intronic
1179658989 21:42862781-42862803 CTTGGTGACAGATGGGTGTGGGG - Intronic
1179666676 21:42917566-42917588 CTTATTAGCAGAAGAGGGTGCGG - Intergenic
1179961423 21:44769001-44769023 CGTATTGTCAGAGGAGCCTGTGG - Exonic
1182409490 22:30171156-30171178 CTTATTGAAAGATCAGAGTGTGG - Intronic
1182467982 22:30529752-30529774 ATTCTTGACAGATGAGTGGGGGG + Intronic
950207549 3:11092357-11092379 CTTATTCTGAGATCAGAGTGGGG - Intergenic
953055055 3:39381455-39381477 CCCATTGGCAGATGAGTGGGGGG - Intergenic
955144971 3:56308105-56308127 AGTATTGTCAGATGAGTGAGTGG - Intronic
956643729 3:71436396-71436418 CTTGTGGTCTGAGGAGTGTGGGG + Intronic
960055703 3:113274860-113274882 CTGGTTGTAAGATGGGTGTGTGG + Intronic
960062086 3:113333608-113333630 TTTATTGTCATATTTGTGTGTGG - Intronic
961812171 3:129528197-129528219 CCTCCTGTCAGAGGAGTGTGGGG + Intergenic
965872822 3:173281026-173281048 CTTATTAGCAGAAGAGGGTGGGG + Intergenic
972005044 4:34091243-34091265 CCTGTTGACAGATGTGTGTGTGG + Intergenic
972412004 4:38804540-38804562 GTTATTCCCAGAGGAGTGTGGGG + Intronic
972659709 4:41104331-41104353 CTTAATGTGATATCAGTGTGTGG - Intronic
973731250 4:53824533-53824555 CCTTTTGTCAGATGAGTAGGTGG + Intronic
974149417 4:57987070-57987092 ATTATTGTTAGATGAGCTTGAGG - Intergenic
975231486 4:71939418-71939440 ATTATTATCATATGTGTGTGGGG - Intergenic
977999829 4:103543958-103543980 CTTATTCTCTAATGAGTGTCTGG - Intergenic
978229119 4:106376711-106376733 CTTATTGTCACTTGAGGTTGTGG - Intergenic
990488399 5:56280811-56280833 CTTCTTGTGAGCTGAGTCTGAGG + Intergenic
990764724 5:59169638-59169660 CTGTTTGTTAGATGAGGGTGTGG + Intronic
991911674 5:71569188-71569210 CTTATTGTTAAATCAGTGTCTGG + Intergenic
992814938 5:80427481-80427503 CTTATTGACAGATTCCTGTGAGG + Intronic
994923792 5:106087136-106087158 CATATTGTCTGGTCAGTGTGTGG - Intergenic
999847346 5:155498946-155498968 CTTATTATCAGATGACAATGAGG + Intergenic
1003853789 6:10251876-10251898 CCTAGTGTCAGATGAGTGGCTGG + Intergenic
1004363027 6:14987734-14987756 TTTATTGTCAGATGACTCAGTGG + Intergenic
1005146735 6:22700268-22700290 CTTATTTTCAGAGGAGCGTTAGG - Intergenic
1005522260 6:26611698-26611720 CTCATTGTCAGGTGACTGTGTGG + Intergenic
1008012854 6:46487564-46487586 CATATTGTGAGATTATTGTGAGG - Intronic
1008623687 6:53297179-53297201 GTTATTGGCAGATGGGTATGGGG - Intronic
1009283345 6:61779425-61779447 CTGATTTTTAGATGAGGGTGTGG + Intronic
1011009216 6:82684981-82685003 CTGATTGTTTGATAAGTGTGGGG - Intergenic
1011295369 6:85821157-85821179 CCCTTTGTCAGATGAGTATGTGG - Intergenic
1011372816 6:86657082-86657104 CTTATGGTCATATGAGTTTCTGG - Intergenic
1014529706 6:122544432-122544454 CATATTTTCAAATGATTGTGGGG - Intronic
1018549457 6:164978704-164978726 CTTGTTCTGAGATGACTGTGTGG + Intergenic
1018915557 6:168130483-168130505 CATATTGGCGGCTGAGTGTGGGG + Intergenic
1020968124 7:14898746-14898768 GCTATTGTCAGATGTGTATGTGG - Intronic
1023446844 7:40240742-40240764 CATGTTGTCAGATGAGTGATTGG + Intronic
1024124463 7:46278328-46278350 CTTACTATCAGAACAGTGTGGGG - Intergenic
1032364382 7:131285481-131285503 CTTATTATCAGATGGATGTGAGG + Intronic
1034707989 7:153163643-153163665 CTTATTGTCAGTTGACTTGGAGG + Intergenic
1037680118 8:21090127-21090149 GTGATTGTCAGAAAAGTGTGGGG + Intergenic
1040948157 8:52906828-52906850 CTCATTATCAATTGAGTGTGGGG + Intergenic
1041595676 8:59648300-59648322 CTTATGGTCAGAAGAGTGGATGG - Intergenic
1042158616 8:65869598-65869620 CTTATTAGCAGAAGAGGGTGAGG + Intergenic
1046842391 8:118874085-118874107 AGTATTGTGAGATGAGTCTGAGG - Intergenic
1047579052 8:126192546-126192568 CTTCTGTTCAAATGAGTGTGTGG + Intergenic
1051305640 9:15706164-15706186 CTTATAGTAGGATGTGTGTGGGG + Intronic
1051926851 9:22338455-22338477 CTTATTTTCAGATGTCTGTGAGG - Intergenic
1061107922 9:128546415-128546437 CTTATTTTCAAATGACTGGGGGG + Intergenic
1061190559 9:129080486-129080508 CTTTTTGTCAAAAGTGTGTGGGG - Intergenic
1203583605 Un_KI270746v1:40855-40877 ATTATTATCACATGAGTGTGGGG - Intergenic
1187485673 X:19700905-19700927 CTTGTTCTCAGAAGAGTGAGGGG - Intronic
1187717960 X:22122622-22122644 CTTATTGTCAAATGCCAGTGAGG - Intronic
1188345792 X:29064006-29064028 CCTATAGAAAGATGAGTGTGTGG + Intronic
1192308539 X:69988960-69988982 ATTACTGTCAGGTGGGTGTGGGG - Intronic
1194781268 X:98028297-98028319 ATTATTGGCAGTTGGGTGTGGGG + Intergenic
1195420294 X:104667899-104667921 ATTATTTTCAGCTGGGTGTGAGG + Intronic
1196983766 X:121244570-121244592 CTTATTGTCATTTGATTGTTAGG - Intergenic
1197947148 X:131851755-131851777 CTTATTAGCAGAAGAGGGTGGGG - Intergenic
1198409049 X:136347350-136347372 CTTATTGGCAGAGATGTGTGAGG - Exonic
1200918114 Y:8589340-8589362 CTTTTTTGCAGATGAATGTGTGG - Intergenic