ID: 906777471

View in Genome Browser
Species Human (GRCh38)
Location 1:48542992-48543014
Sequence CCCACTGTTCAGAGAAGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 4, 3: 11, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906777469_906777471 -1 Left 906777469 1:48542970-48542992 CCAATGAAGTAGGTATATTATTC 0: 1
1: 2
2: 7
3: 63
4: 340
Right 906777471 1:48542992-48543014 CCCACTGTTCAGAGAAGATAAGG 0: 1
1: 0
2: 4
3: 11
4: 170
906777468_906777471 0 Left 906777468 1:48542969-48542991 CCCAATGAAGTAGGTATATTATT 0: 1
1: 3
2: 9
3: 59
4: 371
Right 906777471 1:48542992-48543014 CCCACTGTTCAGAGAAGATAAGG 0: 1
1: 0
2: 4
3: 11
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906777471 Original CRISPR CCCACTGTTCAGAGAAGATA AGG Intronic
900684041 1:3935887-3935909 CCCAATGCTCAGGGAAAATATGG - Intergenic
900843340 1:5075245-5075267 TACACTGTTCAGAGAAAAAAAGG + Intergenic
901877352 1:12174549-12174571 CCTACTTTTCAAAGAAGAAATGG - Intronic
903512796 1:23889052-23889074 ACCACTGTTCAGAAACCATATGG + Intronic
903917686 1:26776189-26776211 CCTACTGTTCAGAGAAGAAAGGG - Intronic
906777471 1:48542992-48543014 CCCACTGTTCAGAGAAGATAAGG + Intronic
910205967 1:84748977-84748999 CCCACTGTTCCCAGAAGATAAGG - Intergenic
912104212 1:106250343-106250365 CCCACAGTTCAAAGATGATTAGG - Intergenic
914141390 1:144952091-144952113 ACCACTGTTCTGTGACGATAAGG - Intronic
915471765 1:156129966-156129988 CCCTCTGTTCAGTGCAGATCAGG + Intronic
918160769 1:181897258-181897280 CCAACTTTTCACAGAAGGTAGGG - Intergenic
918639218 1:186818423-186818445 CCTACTGTTAGGAAAAGATATGG + Intergenic
919761944 1:201103637-201103659 GCCACTGTACAGAGAAGTGATGG - Intronic
920405263 1:205704279-205704301 CCCACCCTCCAGAGAAAATACGG + Intergenic
1063078005 10:2735798-2735820 TCCACTGTGTAGACAAGATATGG - Intergenic
1064246355 10:13670452-13670474 CCCATTGTTCGGAGAAGAATAGG - Exonic
1064265631 10:13823066-13823088 CCAACTTTTCAGAGAACACAGGG - Intronic
1064339845 10:14476080-14476102 CCCACTGAGGAGAGAATATAAGG + Intergenic
1065297453 10:24290229-24290251 CCCACTGTTCATTGAAGATTTGG - Intronic
1066406575 10:35124895-35124917 CCTACTTTTCTGAGAAAATACGG - Intergenic
1067219444 10:44333340-44333362 ACCTCTGGACAGAGAAGATAGGG - Intergenic
1068933854 10:62617468-62617490 ACCACTCTTCAGATAAGAGAAGG + Intronic
1069616379 10:69808986-69809008 CCCACTGGGCAGAGAAGCTGGGG + Intronic
1072314231 10:94186192-94186214 CTCACTGTTCAGAACAGATGAGG - Intronic
1072917167 10:99545107-99545129 CCCACTCTTCTGAGAAGGAAGGG + Intergenic
1072933398 10:99688084-99688106 CCAAAAGTTCAGAGAAAATAAGG - Intronic
1075086922 10:119419837-119419859 CCCACGGCTCAGAGAAGGGAGGG - Intronic
1079903996 11:26222622-26222644 CCTAATTTTCAGAGAATATACGG - Intergenic
1084944225 11:72630254-72630276 CTCACAGTGCAGAGAAGACAAGG + Intronic
1085666487 11:78418906-78418928 TCCACTTATCAGAGAAGTTAGGG - Intergenic
1089326686 11:117662233-117662255 CCAAGTATTCAGAGAAGAGAAGG + Intronic
1090269820 11:125378311-125378333 CCCACTGCTCAGAGGACACAAGG - Intronic
1090316723 11:125797600-125797622 CCTAGATTTCAGAGAAGATACGG - Intergenic
1090902751 11:131047084-131047106 CCCACTGTCTAGGGAAGAAAGGG - Intergenic
1091780751 12:3213274-3213296 CTCACTGTACAGAGAACAGAAGG - Intronic
1091897543 12:4117400-4117422 GCCACTGTTCCGAAAGGATAAGG - Intergenic
1095280443 12:40345788-40345810 CACACTGTTCAGAGGTGATATGG - Intronic
1097086023 12:56469082-56469104 GGCACTCTTCAGAGATGATACGG + Exonic
1097087631 12:56480231-56480253 CCCACTTTTCAGAGATCTTAAGG + Intronic
1098218509 12:68244269-68244291 CCCACTCTCTAGAGAAGAAATGG - Intergenic
1099618686 12:84973814-84973836 CCCAGTTTTCAGAGAAGGTTAGG - Intergenic
1103089751 12:118089450-118089472 CCCACTGTGGATAAAAGATAAGG + Intronic
1103244306 12:119442592-119442614 ACAACTATTTAGAGAAGATAAGG + Intronic
1105429363 13:20323371-20323393 CCCCCTGTGCAGAGGAGGTATGG + Intergenic
1106674935 13:31948359-31948381 CCCAATGGTCAGAGAAATTAAGG + Intergenic
1108194249 13:47975899-47975921 CCCACTCTGCATAGAAGAAATGG + Intronic
1108519647 13:51234817-51234839 CTCACGGTTCAGAGAAGCTCGGG - Intronic
1108910646 13:55546973-55546995 CCTACACTTCAGAAAAGATAAGG + Intergenic
1110993948 13:82080653-82080675 CCCACTTATAAGAGAATATATGG + Intergenic
1114522881 14:23349803-23349825 CAGACTGTTCAGAGGAGATGTGG + Intronic
1114600638 14:23953451-23953473 CCCACTTCCCAGAGAAGAAAAGG + Intergenic
1115724701 14:36200393-36200415 ACCACAGTTCAGATAACATAAGG - Intergenic
1116317414 14:43416187-43416209 CCCACAGTTCAGAAGAGATTGGG - Intergenic
1117540134 14:56739041-56739063 CCAACATTTCAGTGAAGATATGG - Intergenic
1117659855 14:57992344-57992366 CTCACTGTTCAGAGGTAATAAGG - Intergenic
1119280736 14:73405384-73405406 CCTACAGCTCAGAGAAGATGAGG + Intronic
1121837060 14:97101724-97101746 CCCACTGTATAGAGAAAATACGG - Intergenic
1122137651 14:99644261-99644283 CTCACTGGACAGAGAAGATGGGG + Intergenic
1123992943 15:25696766-25696788 CCCAGTGCTCTGAGAAGATGAGG + Intronic
1124210028 15:27755289-27755311 CCCACTGTTTGAAGAAGAAAAGG - Exonic
1126330099 15:47522651-47522673 CCCACTATACTGAGAGGATATGG + Intronic
1126548555 15:49901334-49901356 ACCACTATTCAGAGAGAATATGG + Intronic
1127599365 15:60519947-60519969 GCCACTGCTCAAAGAACATACGG - Intronic
1127658563 15:61078590-61078612 ACCAATGCTCAGAGAGGATAAGG + Intronic
1129379136 15:75154501-75154523 CCCACTGCACAGAGAAGACTGGG - Intergenic
1129783350 15:78289709-78289731 GACTCTGTTCAGAGAACATATGG + Exonic
1130064116 15:80590875-80590897 GGCACTGGTCAGACAAGATAAGG - Intronic
1131071828 15:89471000-89471022 CCCACTGTCCAGGGAAAAGAAGG + Intergenic
1131101586 15:89694644-89694666 CACACTGTTAAGAGAATAAAAGG - Intronic
1131635453 15:94228879-94228901 CCCACTGAGCAGAGAAGATATGG + Intergenic
1131976280 15:97949012-97949034 CAAACAGTTCAGAGAAGACAGGG - Intergenic
1133931367 16:10235045-10235067 CCCTGTGCTCAGAGAAAATATGG + Intergenic
1135296124 16:21280794-21280816 AGCCCTGCTCAGAGAAGATAGGG + Intronic
1137467110 16:48719949-48719971 TCCACAGTTCTGAGAAGATAAGG + Intergenic
1138339597 16:56280006-56280028 CCCAGTTTTCAGAGAAAAAAAGG + Intronic
1140040349 16:71403321-71403343 CCCAGTGCTGAGAGAAGATGTGG + Intergenic
1142356214 16:89603451-89603473 CCCACTGTGCAGAGAAGCACTGG + Intergenic
1143138303 17:4724933-4724955 CCCTGTGTTCAGAGCAGAGAAGG - Intergenic
1144123731 17:12181868-12181890 GCCACTGTGCAGGGAAGACAAGG - Intergenic
1147497240 17:40928305-40928327 GCCACTGTGCAGAGCAGACAAGG - Exonic
1148438173 17:47698034-47698056 CCCACTTTTCAGAGGAGGGATGG - Intronic
1149539911 17:57461078-57461100 CCCACTCTTCAGAGGAAATGGGG - Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1151017899 17:70577879-70577901 CCCCCAGTTCAGAGAATAAAAGG + Intergenic
1153689992 18:7582636-7582658 CCAACTGTTCTGAGAAGCTGAGG - Intronic
1156577099 18:38329839-38329861 TCCAATGTTCAGAGAAGTTTGGG + Intergenic
1156637897 18:39053221-39053243 CCCATTGAACAGAGAAGATGGGG + Intergenic
1157536810 18:48465532-48465554 CCAACTGTCCAGGGAAGATAAGG + Intergenic
1158238179 18:55343639-55343661 CTCCCTCTTCAGAGAAGTTAAGG - Intronic
1158331118 18:56363434-56363456 CACACTGTTAAGAGAATAAAAGG + Intergenic
925311735 2:2889605-2889627 CGCACTGTGCAGAGAAGCGAGGG + Intergenic
927944415 2:27126773-27126795 CCCACAAGTAAGAGAAGATAAGG + Intronic
929762870 2:44820642-44820664 CCCACTCTTCTGAGAGGACAAGG - Intergenic
930232258 2:48855189-48855211 CCCACTTTACAGATAAGAGAAGG + Intergenic
930546683 2:52776290-52776312 CACATAGTTCAGAGATGATATGG + Intergenic
932024706 2:68121276-68121298 ACCACTGCTCAGAGGTGATAAGG - Intergenic
932515291 2:72340930-72340952 CCTACTGGTCAGAGAAGGGACGG + Intronic
935199161 2:100841000-100841022 CCCACTGTACAGAGGAGGAATGG - Intronic
937819678 2:126295368-126295390 GTCACTGTTAAGAGAAGAAAAGG + Intergenic
940769750 2:157827303-157827325 CCCACTGTGCAGAGAGAACAAGG + Intronic
943556584 2:189413505-189413527 TCTTCTGTTCTGAGAAGATAAGG + Intergenic
943709298 2:191072480-191072502 CCTACTATTCAGATAATATATGG + Intronic
945124259 2:206490776-206490798 CACCCTGATCAGAGAAAATATGG - Intronic
946743895 2:222827172-222827194 CTCAGTCTTAAGAGAAGATATGG - Intergenic
947601860 2:231456343-231456365 CCCACTTTCCATAGAAGATCTGG - Intronic
948862315 2:240758561-240758583 CCCACTGTCCCCAGGAGATAAGG - Intronic
1173018289 20:39246328-39246350 CCCACTGTACCTAGAAGAAATGG + Intergenic
1173794401 20:45848951-45848973 CACACTGCTCAGAGAAGTGAAGG - Intronic
1173888859 20:46487285-46487307 CTCATTGTTCAGAGAAAATGGGG - Intergenic
1174766112 20:53255473-53255495 CCCATTGCTCAGAGCAGATGTGG - Exonic
1175342729 20:58244706-58244728 CCCACCATTCAGAGAAGTCAGGG - Intergenic
1179236586 21:39552642-39552664 TCAACTGCTCAGAGAAGAAAAGG + Intergenic
1185032904 22:48454084-48454106 CCCACTGTGCACAGAAGGTGGGG - Intergenic
957954044 3:87160999-87161021 CCCAGTGTACAGAGAAGTTCAGG + Intergenic
959016011 3:101134708-101134730 CTCACTGTTCAGATAATATCTGG + Intergenic
959073548 3:101725939-101725961 CCCACTTTACAGAGTAGAAAAGG + Intronic
962204305 3:133422564-133422586 TCCACTGCTCAGAGATGATGGGG - Intronic
964162801 3:153665652-153665674 CCCTTTGTTTAGAAAAGATAGGG + Intergenic
967374053 3:188781302-188781324 ACCACTCTTCAGAGATGCTATGG + Intronic
969725807 4:8917468-8917490 CCCACTGTCCTGAGAAGCTCTGG - Intergenic
974279463 4:59773889-59773911 CACAGTGTTCAGTGATGATATGG + Intergenic
982520994 4:156416668-156416690 CCCAGAGTTCAGAGGATATATGG - Intergenic
985264520 4:188145501-188145523 CTCACTGTCCAGACAAGATCAGG - Intronic
985647630 5:1092485-1092507 CCCTCCCTTCTGAGAAGATAGGG + Intronic
985854381 5:2413519-2413541 TCCACTGCCCAGAGTAGATATGG + Intergenic
986457612 5:7935054-7935076 CCCACTGATCAGAGAAGCAGGGG - Intergenic
987107475 5:14654537-14654559 CCCACTCTTAAGGGAAGAAAAGG + Intergenic
990048280 5:51461898-51461920 CCCATTATTCAGTGAAAATATGG + Intergenic
992223400 5:74594925-74594947 CAAACTATTCAGAGAATATAGGG - Intergenic
992564506 5:77984735-77984757 CACACTTTTCAGAGAGGAGACGG + Intergenic
995725406 5:115177078-115177100 CCCACATTTCAGAGAACATACGG + Intronic
996716656 5:126593749-126593771 CCCTCTGCTCAGAGATGAAATGG + Intronic
996919048 5:128746124-128746146 CCCAGTGTTCAGTGATGATTTGG - Intronic
997390905 5:133514484-133514506 CCCAGAGTGCAGAGAAGAAAAGG + Intronic
999230338 5:150057959-150057981 GGCACTGTCCAGAGAAGAGAGGG - Intronic
999508344 5:152221753-152221775 GCCACTGTACAGAGAAAAAAAGG - Intergenic
999575398 5:152971157-152971179 CCCACTTATAAGAGAAAATATGG - Intergenic
1000454114 5:161427852-161427874 CCCAGTGTTCACAGTAGTTAAGG + Intronic
1000795169 5:165656061-165656083 ACCACTGTTCAGAGGAAATGGGG - Intergenic
1001333855 5:170782220-170782242 CCCATTGGTCAGATAAGAAATGG + Intronic
1006417858 6:33915468-33915490 CCCACAGGTCAGAGAAGACCTGG + Intergenic
1012015893 6:93850949-93850971 CCCACTTATAAGAGAACATATGG + Intergenic
1015193485 6:130498567-130498589 CCCTCTTTCCAGAGAATATATGG - Intergenic
1015199734 6:130565752-130565774 CCCACTGTTCAGAGACATCAGGG + Intergenic
1015694317 6:135963398-135963420 TTCACTGTTCAGAGAAGAAACGG + Intronic
1016150361 6:140734112-140734134 CCCACTTTTCAGATAATAAAGGG - Intergenic
1017861295 6:158399973-158399995 CCCAGTGTTCAGGCAAGAGAAGG + Intronic
1018581976 6:165315569-165315591 CTCACTGGGCAGAGAAGATATGG - Intergenic
1020894417 7:13921789-13921811 CCCACCATTCAGAAAAAATATGG + Intronic
1021976648 7:26017752-26017774 CCAAATGTACAGAGAAGAGACGG - Intergenic
1022993284 7:35729205-35729227 CCCACTCTGCAGAGCAGATCAGG - Intergenic
1026620495 7:71945941-71945963 TCCAGAGTTCAGAGAAGTTAGGG + Intronic
1027832366 7:83195569-83195591 CAAACTGTTCAGACAAGATTTGG - Intergenic
1028472966 7:91224417-91224439 CCCACAGTTCAGGGAGGATCTGG + Intergenic
1030345439 7:108428224-108428246 CACACTGTTGAGAAAAGAAAAGG + Intronic
1030517572 7:110557409-110557431 GCCACTGTTAAGAGAACATTGGG + Intergenic
1031578612 7:123444950-123444972 CCCATAGCTCAGAGAAGAAAGGG - Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1033998018 7:147376239-147376261 CCCAGTGTTCAGAGAGTTTATGG + Intronic
1035337403 7:158138645-158138667 GCCAGTGCTCAGAGAAGATTGGG + Intronic
1038070350 8:24006313-24006335 CCCACTCTTTAAAGAAGAAAGGG - Intergenic
1038329787 8:26599007-26599029 CTCACTTTTCAGAGAAGAGCTGG + Intronic
1039840066 8:41286688-41286710 CCCCCTCTTCAGTGAAGAAAGGG - Intronic
1040710040 8:50176954-50176976 CCCCCTGTTCAGTCAAGAGAAGG + Intronic
1042224384 8:66504143-66504165 CCCACTGTGCAGAGAAGAGATGG + Intronic
1042786121 8:72549003-72549025 CCCACTCTTCAGGGAGGATAAGG - Intronic
1045441482 8:102217539-102217561 ACCAAGGTTCAGAGAAGTTAAGG + Intronic
1050607246 9:7314685-7314707 AGCACTGTGCAGAGAAGAGAAGG + Intergenic
1055470180 9:76603058-76603080 CCCAGTGCTCAGAGGAGAGATGG - Intergenic
1056523694 9:87423238-87423260 CCCAGTGGTCAGAGAATTTATGG - Intergenic
1059113406 9:111578569-111578591 GCCACTGTTCTGAGAAGAGGCGG + Intronic
1059139604 9:111840448-111840470 TCAACTGCTCAGAGAAGAAAAGG - Intergenic
1059482596 9:114603136-114603158 CCCCCAGATTAGAGAAGATAAGG + Intergenic
1059830867 9:118094334-118094356 CCCCGTGGTCACAGAAGATAAGG + Intergenic
1061575104 9:131501502-131501524 CCGACTGTTCAGGGAAAACATGG + Intergenic
1185527563 X:791529-791551 CCCACTGTGCAGAGAGAAAAAGG + Intergenic
1188153636 X:26712693-26712715 TCCACTGTTCTCAGAAGATTTGG + Intergenic
1189116753 X:38350851-38350873 AGCACAGTTCAGTGAAGATATGG + Intronic
1190363946 X:49674288-49674310 CCCACTGTTAGGAGATGATTCGG + Intergenic
1194934400 X:99930763-99930785 CCCACAATCCAGAGAAGATATGG + Intergenic
1195597126 X:106704619-106704641 CCCACAGTGAAGAGAAGATGAGG + Intronic
1196797930 X:119517314-119517336 CTCACTGTTCTGTGAAGAAAGGG + Intergenic
1197385013 X:125791653-125791675 TCCTCTGTTTAGAGAGGATATGG - Intergenic
1198409219 X:136348880-136348902 ACCACTGTTCACAGTAGATAGGG - Exonic
1201762928 Y:17558558-17558580 CCCACTGCACCAAGAAGATAGGG + Intergenic
1201838624 Y:18347431-18347453 CCCACTGCACCAAGAAGATAGGG - Intergenic