ID: 906779500

View in Genome Browser
Species Human (GRCh38)
Location 1:48559894-48559916
Sequence CTCATTGTTTACTGTGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 431}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906779500_906779502 5 Left 906779500 1:48559894-48559916 CCTGACACACAGTAAACAATGAG 0: 1
1: 0
2: 2
3: 46
4: 431
Right 906779502 1:48559922-48559944 ATTTGTTTAATAACTATTGATGG 0: 1
1: 0
2: 2
3: 55
4: 627

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906779500 Original CRISPR CTCATTGTTTACTGTGTGTC AGG (reversed) Intronic
901553155 1:10011017-10011039 TTCTTTGTTTTCTGTCTGTCGGG - Intronic
901855422 1:12041559-12041581 CTCATTCCTTACTGTGTATCTGG - Intergenic
903006930 1:20304817-20304839 GTCATTGTTTACTGGCTGTGTGG + Intronic
903259786 1:22125255-22125277 CTAATTGTCTTGTGTGTGTCTGG + Intronic
903315740 1:22504368-22504390 TTTATTGCTTACTGTGTGCCAGG + Intronic
904046254 1:27610569-27610591 CAAATTGTTGACTGTGTGCCAGG - Intergenic
904257160 1:29261054-29261076 CTAATACTTTACTTTGTGTCAGG + Intronic
904663307 1:32101152-32101174 TTCATTTGTTACTGTGTGCCAGG + Intronic
904753103 1:32753571-32753593 CTTAGTGTTTACTATGTGCCAGG - Intronic
905077192 1:35282958-35282980 CTTGTTGTTTTCTGTGTGTGTGG + Intronic
905108542 1:35577944-35577966 CTGCTTGCTTTCTGTGTGTCTGG - Intronic
905622077 1:39457158-39457180 CTTCTAGTTTACTGTATGTCTGG - Intronic
905842320 1:41192540-41192562 CTGAGTGTTTACTATGTGCCAGG - Intronic
906261182 1:44391886-44391908 TTCAGTGCTTACTGTGTGTTAGG - Intergenic
906779500 1:48559894-48559916 CTCATTGTTTACTGTGTGTCAGG - Intronic
906784219 1:48600176-48600198 CTGAGTACTTACTGTGTGTCAGG - Intronic
907350075 1:53821811-53821833 CTAAATATTTACTGTGTGCCAGG + Intronic
907356906 1:53883031-53883053 TTCACTGTCTACTGTGTGCCAGG - Intronic
907513260 1:54978108-54978130 CTCACTGTTCACTGTGTCCCAGG - Intergenic
907623128 1:56002082-56002104 CTGAGTGTTTACTCCGTGTCAGG - Intergenic
908205099 1:61838899-61838921 CTGAATGTTTACTGAGTGCCAGG + Intronic
908314656 1:62920904-62920926 CTGACTGCTTACTGTGTGTCAGG + Intergenic
908600419 1:65732932-65732954 TTGAGTGTTTACTGTGTGTCAGG - Intergenic
908855594 1:68423399-68423421 CTGATTATCTACTGTGTGCCAGG - Intergenic
908952676 1:69580693-69580715 CTAAATATTTACTGTGTGCCAGG + Intronic
911002139 1:93177709-93177731 TTGATTATTTACTATGTGTCAGG + Intronic
911101636 1:94100295-94100317 CTGAGAGTTTACTATGTGTCAGG + Intronic
911562523 1:99423905-99423927 TTCATTATTTACTGTATATCAGG + Intergenic
911640842 1:100287304-100287326 ATCACTGTTTCCTGTGTGACAGG + Intronic
911784596 1:101930567-101930589 CTGATTGTTAACTGTTTGCCTGG + Intronic
911906929 1:103581356-103581378 CTCATTGATTGCTCTGTTTCAGG + Intergenic
912132731 1:106621667-106621689 TTCAATGTTTACTATGTGTTAGG - Intergenic
912231410 1:107797096-107797118 TTCAGTGTTAACTGTGTGTCAGG + Intronic
912853352 1:113146006-113146028 GTTAATGTTTACTGTGTGTCAGG + Intergenic
913327834 1:117642915-117642937 CACATGCTTTACTGTGAGTCAGG - Intergenic
914873607 1:151496045-151496067 TTGATTATCTACTGTGTGTCAGG - Intergenic
914963362 1:152227470-152227492 CTCATTTTTTTCTGCCTGTCTGG + Intergenic
915943090 1:160131167-160131189 CAAATTGTTTACTATGTATCAGG - Intronic
916193881 1:162205208-162205230 TTTATTGATTACTGTGCGTCAGG + Intronic
916312416 1:163411731-163411753 TTGATTGTGTACTATGTGTCAGG + Intergenic
916385823 1:164267503-164267525 GTACTTGTTTATTGTGTGTCTGG - Intergenic
916806007 1:168261883-168261905 CTGAGTGTTTACTTTGTGCCAGG - Intergenic
917939380 1:179902799-179902821 CTTAGTGTTTACTATGTGCCAGG - Intronic
918065790 1:181100820-181100842 TTTATTGTCTACTTTGTGTCAGG + Intergenic
918293824 1:183136065-183136087 TTTAGTGTTTACTGTGTGTCGGG - Intronic
918987093 1:191645804-191645826 TTCTTTGTTTACTATGTGCCAGG + Intergenic
919044356 1:192431662-192431684 CTGATTGTTTAATAAGTGTCTGG + Intergenic
919150251 1:193687494-193687516 CTGATTGATTACTCTGTGACTGG + Intergenic
920295776 1:204955300-204955322 CCAAGTGCTTACTGTGTGTCTGG - Intronic
920636236 1:207706705-207706727 CTTATTCTTTAATGTGTATCTGG - Intronic
921198826 1:212784537-212784559 CTCATTGTTTACATTCTGTATGG + Intronic
921200301 1:212798846-212798868 GTAATTGTTGACTGTCTGTCTGG - Intronic
921551647 1:216543611-216543633 CACATTTTTTAATGTGTTTCTGG + Intronic
922137248 1:222841315-222841337 TGCATTGTTTACTGTGTGCCTGG + Intergenic
922515192 1:226202488-226202510 CTCAATATTTATTATGTGTCAGG - Intergenic
923367598 1:233278165-233278187 CCCAGTGTTGACTGCGTGTCAGG - Intronic
923379268 1:233398688-233398710 CTGATGGCTTACTGTGTGCCAGG - Intergenic
923870807 1:237992171-237992193 ATCATAGTCTACTGTGGGTCAGG - Intergenic
924006125 1:239613530-239613552 CTCCTTTTTGTCTGTGTGTCTGG - Intronic
1063347264 10:5323709-5323731 CTGAGTGTCTACTCTGTGTCAGG + Intergenic
1064571884 10:16702282-16702304 CTCAGTGGAGACTGTGTGTCTGG - Intronic
1064945207 10:20779370-20779392 CTCATGGTTTACTAAGTGTTTGG - Intergenic
1066087527 10:31985514-31985536 ATGATGGTTTACTGTGTGTTAGG - Intergenic
1066234704 10:33474381-33474403 CTAATTATTTAATGTGTGGCAGG + Intergenic
1066556732 10:36622670-36622692 CTCATTTTGTTCAGTGTGTCTGG - Intergenic
1066631084 10:37460089-37460111 CTTATTGTTTACTGATGGTCTGG - Intergenic
1067288934 10:44927564-44927586 CCCAGTGTGTGCTGTGTGTCTGG - Intronic
1067999931 10:51320639-51320661 CTTATTTGTTACTGTCTGTCAGG - Intronic
1068631846 10:59306405-59306427 CTGAATGTCTACTGTGTGCCTGG + Intronic
1068632410 10:59311493-59311515 ATCATTGTTTACTAAGTGTATGG - Intronic
1068818027 10:61339979-61340001 GTCATGGTTTATTCTGTGTCAGG - Intergenic
1070568562 10:77622576-77622598 TTGAGTGATTACTGTGTGTCTGG - Intronic
1070990658 10:80729438-80729460 CTCATTGAATTCAGTGTGTCAGG - Intergenic
1072234577 10:93442265-93442287 TTCTAGGTTTACTGTGTGTCAGG - Intronic
1073158543 10:101369365-101369387 CTCATTATTTTTTGTGTGCCAGG + Intronic
1073546791 10:104355626-104355648 CTGATTGTTTGCTATGTGCCAGG - Intronic
1073748370 10:106495561-106495583 CACATTGTCTTCTGTGTGTTTGG + Intergenic
1074583954 10:114748422-114748444 TTCATTGTTGTCTTTGTGTCAGG - Intergenic
1075536102 10:123273573-123273595 CCCATTGTCTACAGTGTGACAGG + Intergenic
1076718022 10:132376760-132376782 TACATTGTTTTGTGTGTGTCAGG + Exonic
1077064638 11:635593-635615 CTCATTGTTTCCATTGTTTCTGG + Intergenic
1079129687 11:17740291-17740313 ATCATTGTCTTGTGTGTGTCAGG - Intronic
1079317695 11:19423091-19423113 ATGAGTATTTACTGTGTGTCAGG - Intronic
1080123979 11:28709814-28709836 CTGATTTTCTACTTTGTGTCAGG + Intergenic
1080488885 11:32741218-32741240 CTCTTTGTTGACTTTCTGTCTGG + Intronic
1080571317 11:33559565-33559587 CTGATTGCTTGCTGTGTGCCAGG - Intronic
1080803527 11:35631290-35631312 CTGAGTCTTTACTATGTGTCGGG - Intergenic
1080822051 11:35816797-35816819 CTAAGTGCTTACTATGTGTCAGG - Exonic
1081838654 11:46178674-46178696 CACAGTGCTTACTGTGTGCCGGG - Intergenic
1083212737 11:61198806-61198828 CTCATGGGTTAGTGTGTGACAGG - Intergenic
1084018741 11:66404177-66404199 CACAGTGTTTACTGTGTTCCAGG - Intergenic
1084623774 11:70292559-70292581 CGTATTGTCTACTGTGTGTAAGG + Intronic
1085107272 11:73856043-73856065 TTCAGTGCCTACTGTGTGTCAGG - Intronic
1085519882 11:77131586-77131608 CTGAGTGTTTGCTGTGTGCCAGG + Intronic
1085662914 11:78386066-78386088 CTCATTCTTTATTCTTTGTCAGG + Intronic
1085974153 11:81632212-81632234 CTCATTGGTTTCAGTGTGGCTGG - Intergenic
1086319925 11:85634874-85634896 CTCATTGTACACTAGGTGTCTGG + Intronic
1086435470 11:86775744-86775766 CTCAGAGTTTTCTCTGTGTCAGG + Intergenic
1087569062 11:99901129-99901151 TTCATTGTATAGTGTGTGGCAGG + Intronic
1088715200 11:112542951-112542973 CTGACTGTTCACTCTGTGTCAGG - Intergenic
1089317738 11:117603553-117603575 CTGAGTGTTTGCTGTGTGTCAGG - Intronic
1089775995 11:120836373-120836395 CCCACTGTTTAGTATGTGTCAGG - Intronic
1089808244 11:121111151-121111173 CTGAGGGTTTACTATGTGTCTGG + Intronic
1090466801 11:126942295-126942317 CTCAGTGTTTACCGTGTGCCAGG - Intronic
1090584762 11:128199297-128199319 CTCAGTGTTTATTATATGTCAGG + Intergenic
1094337705 12:29379605-29379627 TTGAGTGTTTACTGTGTGCCAGG + Intronic
1094388248 12:29918889-29918911 CTGAGTGCTCACTGTGTGTCAGG - Intergenic
1094461439 12:30700741-30700763 CGGATTGTTTATTGTGTGCCAGG - Intergenic
1095422019 12:42034028-42034050 TTTATTGTTTACTATGTCTCAGG + Intergenic
1095600557 12:44008257-44008279 CTCATTCTTTATTCTTTGTCAGG - Intronic
1095824536 12:46517206-46517228 TTCTTTGTTTTCTGTGTGTCAGG + Intergenic
1095926309 12:47583119-47583141 CTGAGTGTCCACTGTGTGTCAGG + Intergenic
1097689164 12:62718130-62718152 CTGCCTGTTTACTATGTGTCAGG + Intronic
1098119935 12:67225902-67225924 TTTATTGTTTACTGTAAGTCTGG - Intergenic
1098267983 12:68743007-68743029 TTCAGTGCTTACTGTGTGCCAGG - Exonic
1098289383 12:68942572-68942594 TTTATTGTTTACTCTGTGTCAGG + Intronic
1098471603 12:70851275-70851297 CTTATTTTTGTCTGTGTGTCTGG - Intronic
1098499821 12:71178297-71178319 TTCTTTGTTGACTTTGTGTCTGG - Intronic
1098552475 12:71778561-71778583 TTCATTGCTTACTATGTGCCAGG + Intronic
1100143181 12:91643900-91643922 CTCATTATTTTCAGTGTCTCTGG + Intergenic
1100506208 12:95223243-95223265 CTGAGTGTTTACAATGTGTCAGG - Intronic
1100679763 12:96906977-96906999 CTTGCTGTTTACTGTGTGCCAGG - Intergenic
1100739535 12:97576029-97576051 CCTAATGTTTACTATGTGTCAGG + Intergenic
1100948069 12:99810028-99810050 TGGATTGTTTACTGTGTGCCAGG - Intronic
1101037993 12:100723962-100723984 GTGAGTGCTTACTGTGTGTCAGG + Intronic
1102809101 12:115808653-115808675 TTCATTGTTTACAGTGTACCAGG - Intergenic
1105788954 13:23778744-23778766 CTTAGTGTTTACTGGGTGCCAGG + Intronic
1106139815 13:27002805-27002827 CTGAGTGTCTACTGTGTGCCAGG - Intergenic
1107349614 13:39500366-39500388 CTAATTTTTTATTTTGTGTCTGG + Intronic
1107364812 13:39658697-39658719 CTCATTGTTTGCTCTGTCTGTGG + Intronic
1107685123 13:42889473-42889495 CTCCTTGTTTACTCTGTCTCTGG + Intronic
1108168878 13:47720888-47720910 CTGAATGCTTACTGTGTGCCAGG - Intergenic
1108719927 13:53120690-53120712 CTTATTATTTACTATGTGCCAGG + Intergenic
1109081485 13:57907488-57907510 ATCATTGTCTACTGTGCTTCTGG + Intergenic
1110184973 13:72663320-72663342 CTCATGGTTTCTTGAGTGTCAGG - Intergenic
1110208065 13:72941142-72941164 TTGTTTGTTTCCTGTGTGTCAGG + Intronic
1111626334 13:90792837-90792859 TTGACTGCTTACTGTGTGTCAGG + Intergenic
1111748990 13:92303805-92303827 CTCATTGTCCACTTTGTGGCAGG + Intronic
1112472550 13:99702063-99702085 CTGATTGTCTACTATGTGTTAGG + Intronic
1115443705 14:33464898-33464920 CTGAGTGCTTACTGTGTGCCAGG - Intronic
1116007923 14:39316519-39316541 CTGAATGTATACTGTGTGTCAGG - Intronic
1116476327 14:45344699-45344721 CTCATTATTTATAGTGTTTCAGG + Intergenic
1117851845 14:59980786-59980808 CTATCTGTTTACTGTTTGTCTGG - Intronic
1118044690 14:61954472-61954494 CTCAAAGTTAACTGTATGTCTGG - Intergenic
1118717995 14:68573929-68573951 CTCATTGACTGCTGTGTGTGTGG + Intronic
1119276997 14:73366464-73366486 CTGAATGCTTACTGTGTGCCAGG + Intronic
1119580517 14:75774995-75775017 CTCCTGGTTTTCTGTGTTTCTGG + Intronic
1119902193 14:78270683-78270705 CTGAATGTTTACTATGTGCCTGG + Intronic
1119963399 14:78884938-78884960 CTGAATGTTTCCTATGTGTCAGG - Intronic
1120235255 14:81883031-81883053 CTTATTGCTTCCTGTGTGTTTGG - Intergenic
1120325435 14:83018812-83018834 CTCATTGTTTTGTGTGTTTGTGG + Intergenic
1120629523 14:86872978-86873000 CTCATTGCTTGCTGTAGGTCAGG + Intergenic
1120667451 14:87323583-87323605 CTCATTGTTTTCTCTCTCTCTGG - Intergenic
1120711235 14:87795321-87795343 TTGATTTCTTACTGTGTGTCAGG - Intergenic
1120744161 14:88138948-88138970 CTCTTAGTATCCTGTGTGTCTGG - Intergenic
1122994270 14:105254139-105254161 CTCATTGATCCCTGTGTCTCTGG - Intronic
1125071631 15:35561621-35561643 TTTATTGTTTACTCTGTGACAGG - Intergenic
1125489844 15:40138254-40138276 CTGAGTGCTTACTCTGTGTCAGG - Intergenic
1130135061 15:81175503-81175525 CTGAGTGTTTACTCTGTGCCAGG - Intronic
1133395497 16:5443699-5443721 CTGAGTGTTTACTCTGGGTCAGG + Intergenic
1134427776 16:14168100-14168122 CTCATTGTTTGCTTTTTATCAGG + Intronic
1134676953 16:16097463-16097485 CTGAGTGTCTACTATGTGTCAGG - Intronic
1134801225 16:17086545-17086567 CTCAGTGCCTACTATGTGTCAGG - Intergenic
1135692893 16:24558243-24558265 CCCAGTATTTGCTGTGTGTCTGG - Intronic
1137282545 16:46990495-46990517 TTCAGTGTCTACTCTGTGTCAGG - Intergenic
1138036034 16:53607249-53607271 CTCAGTGCTTACTGTGTTCCAGG - Intronic
1138036325 16:53610447-53610469 CTCACTGTGTGCTATGTGTCAGG + Intronic
1138091389 16:54177455-54177477 CTCATCTCTTTCTGTGTGTCTGG + Intergenic
1138099118 16:54237695-54237717 CTGAGTGTTTACTATGTGCCAGG + Intergenic
1138104690 16:54281786-54281808 CTCTTTGTTAACGGTGTTTCTGG - Intergenic
1138371755 16:56532623-56532645 TTCATTTATTACTGTGGGTCTGG - Intergenic
1139482779 16:67239866-67239888 GTGAGTGCTTACTGTGTGTCAGG - Intronic
1140094136 16:71860618-71860640 CTCATTGTGGACTGTGGGTAGGG + Exonic
1140233956 16:73141859-73141881 CTCTTTCCTGACTGTGTGTCTGG + Intronic
1143113824 17:4569492-4569514 CTTGTTGTTTAATGTGTGTGGGG + Intergenic
1143831914 17:9659278-9659300 TTTATTGTCTACTCTGTGTCAGG - Intronic
1144505877 17:15830413-15830435 CTCATTGTTTACTTTGACTTGGG + Intergenic
1144839610 17:18177796-18177818 CTGAGTGTTAACTGTGTGCCAGG - Intronic
1145170051 17:20648345-20648367 CTCATTGTTTACTTTGACTTGGG + Intergenic
1146089529 17:29862341-29862363 TTGAATGTTTACTGTGTGCCAGG - Intronic
1146388988 17:32403633-32403655 TTCATTAACTACTGTGTGTCAGG - Intergenic
1147492656 17:40885018-40885040 CCCATAGTTCACCGTGTGTCTGG + Exonic
1148646640 17:49223219-49223241 CCCATTGCTTGCTGTGTGTGTGG + Exonic
1149148899 17:53535057-53535079 TTGAGTGCTTACTGTGTGTCAGG - Intergenic
1149679186 17:58492999-58493021 CTTACTGTTTACCATGTGTCAGG + Intronic
1151390257 17:73782283-73782305 TTAATTGTCTACTGTGTGCCAGG + Intergenic
1153625898 18:7022218-7022240 TTCATTGTTTATTAAGTGTCCGG - Intronic
1154135482 18:11774074-11774096 CTGAATGTTTAAGGTGTGTCAGG - Intronic
1155849290 18:30751188-30751210 CACATTGTTTTCTGTCTGTCAGG - Intergenic
1156672246 18:39484939-39484961 CTGATGGTTTACTATGTGCCAGG + Intergenic
1156909109 18:42389618-42389640 TTCACTGTTTTGTGTGTGTCAGG + Intergenic
1157631099 18:49096804-49096826 TGCACTGTTTACTGTGTGCCTGG - Intronic
1158382955 18:56955718-56955740 ACCAGTGTTTACTATGTGTCAGG + Intronic
1158774279 18:60557159-60557181 ATCTTTGTCTACTGTGTGTCTGG - Intergenic
1161214242 19:3085334-3085356 CTCAGTGCCTACTGTGTGCCGGG - Intergenic
1161899484 19:7107788-7107810 CTAAGTGCTTACTGTGTGCCAGG + Intergenic
1162004120 19:7766364-7766386 CTGAGTGTCTACTGTGTGCCTGG - Intronic
1165057409 19:33186647-33186669 CTCATTCATTACTGTGTGGGGGG + Intronic
1166693112 19:44836106-44836128 TTGAGTGTTTACTGTGTGCCAGG + Intergenic
926380219 2:12279525-12279547 GACATGGTTTACTGAGTGTCTGG + Intergenic
926892302 2:17649187-17649209 CTCATTGTTTCCTGTGGGTGAGG - Intronic
926979562 2:18553735-18553757 CTGATTTTTTACTGTGTGCTGGG + Intergenic
927947889 2:27148403-27148425 TTCATAGATTACTGTGTGCCAGG - Intergenic
928045046 2:27922740-27922762 ATCAGTGTTCACTGTGTGTCTGG - Intronic
928193619 2:29196531-29196553 CCCAGTTTTTACTGTGTGTCTGG + Intronic
929970948 2:46575707-46575729 CTAAATATTTACTATGTGTCAGG - Intronic
930106101 2:47640716-47640738 CTTAGTGTTTACTATGTGTTAGG - Intergenic
932529610 2:72514865-72514887 TTTATTGATTGCTGTGTGTCTGG - Intronic
932970328 2:76533224-76533246 CTCAGTGTATTCTATGTGTCAGG + Intergenic
933573096 2:84036409-84036431 ATCTTTATTTACTTTGTGTCAGG + Intergenic
933776998 2:85777097-85777119 CTGAGTGTTTACTCTGTGTCAGG + Intronic
934127807 2:88915566-88915588 ATCATTGTTTTTTGTGTCTCTGG - Intergenic
935151574 2:100441294-100441316 TTGAGTGTCTACTGTGTGTCAGG + Intergenic
935844237 2:107147331-107147353 CTGAATGTGTACTGTGTGCCAGG + Intergenic
936666028 2:114596614-114596636 CTCATTGAGTACTGTATGTCAGG + Intronic
936887385 2:117329039-117329061 TTCATTGCCTACTTTGTGTCGGG - Intergenic
938321603 2:130370026-130370048 CTCATCTTTTTCTGTGTTTCAGG + Exonic
938395512 2:130944790-130944812 CTCATAGTTCTTTGTGTGTCAGG + Intronic
939874498 2:147562286-147562308 TTGCATGTTTACTGTGTGTCAGG - Intergenic
940834353 2:158504300-158504322 CTCAGTGTCCACTATGTGTCAGG - Intronic
941109379 2:161401892-161401914 GTCATTGCTTATTGTGTGTATGG + Intronic
941661695 2:168201992-168202014 CTCGTTGTTTTCTGTTTCTCTGG - Intronic
941709529 2:168697427-168697449 CTGATTATTTTCTGTGTGCCAGG + Intronic
942134473 2:172911265-172911287 CCCATTGTTTGCTGGGTGTGGGG - Intronic
942313686 2:174679981-174680003 TTAAGTGTTTACTGTGTGCCAGG - Intronic
942428087 2:175880340-175880362 CTGAGTGGTTACTGTGTGCCTGG + Intergenic
943245080 2:185436606-185436628 TTGATTGTTTACTATATGTCAGG + Intergenic
943275119 2:185856363-185856385 CTATTTGTTTTCTGTATGTCTGG - Intergenic
944472175 2:200065572-200065594 CACATTGTGTACTTGGTGTCAGG - Intergenic
944604987 2:201344732-201344754 GTCATGGTTTTCTGTGTTTCTGG + Intronic
944810594 2:203323912-203323934 TTCAATGCCTACTGTGTGTCAGG - Intergenic
945221048 2:207484813-207484835 CTGAGTGTCTACTGTGTGGCAGG + Intergenic
946477869 2:220026029-220026051 CTCAGTATTTACTGTGTAACGGG - Intergenic
946497978 2:220215492-220215514 CTCAATGTGGTCTGTGTGTCAGG + Intergenic
946536876 2:220639915-220639937 CACATTGTTTGCTGTCTTTCAGG - Intergenic
946670035 2:222092689-222092711 TTCATGGTTTTCTGTGAGTCAGG - Intergenic
947126611 2:226875159-226875181 CTAATTGCCTACTTTGTGTCAGG - Intronic
947153737 2:227139482-227139504 CTCTTTGGTTACTGTCTGTCAGG - Intronic
947191581 2:227511717-227511739 TTAAGTGCTTACTGTGTGTCAGG + Intronic
947659279 2:231854763-231854785 TTGAATGATTACTGTGTGTCAGG + Intergenic
1171077347 20:22142026-22142048 CTGATTGTCTTCTGTGTGTCAGG + Intergenic
1172572310 20:35980315-35980337 ATGAGTGCTTACTGTGTGTCAGG - Intronic
1173906942 20:46636435-46636457 CTCAGTGTTCCCTGTGTGCCAGG - Intronic
1174715918 20:52758547-52758569 TTGAATGTTTACTGTGTGCCAGG - Intergenic
1174821269 20:53728601-53728623 GTCACTGTTTGCTATGTGTCTGG + Intergenic
1175388072 20:58610017-58610039 CTGAGTGTTTACTGTGTGCCAGG - Intergenic
1175623912 20:60474687-60474709 CTGAATATTTGCTGTGTGTCGGG - Intergenic
1176841297 21:13845343-13845365 CTCAGTGCTGACTGTGTGCCTGG - Intergenic
1177380593 21:20337543-20337565 CTAAACGTTTACTGTGTTTCAGG - Intergenic
1177409423 21:20710471-20710493 CTCATTGTTTCCTATGTACCAGG + Intergenic
1177443673 21:21163672-21163694 CTATTTGTTTGCTGAGTGTCAGG + Intronic
1177777673 21:25586982-25587004 CTGATTGTTTATTGTGTGCCAGG - Intronic
1178553723 21:33567454-33567476 TTTATTGTTTACTATGTGGCAGG + Intronic
1179419092 21:41221854-41221876 GTCAGTGTCTACTGTGTGCCTGG + Intronic
1180592446 22:16952716-16952738 CTATTTGTTTATTGTGTGTGGGG + Intergenic
1184516185 22:44964284-44964306 CTCACTGTTGAATGTGTCTCTGG - Intronic
949404041 3:3696135-3696157 CAGAGTGATTACTGTGTGTCAGG - Intergenic
949455071 3:4229584-4229606 TTAAATGTTTACTGTGTGTCAGG - Intronic
949688971 3:6612848-6612870 CTGAGTACTTACTGTGTGTCAGG - Intergenic
950214843 3:11152231-11152253 CTTACTGCATACTGTGTGTCAGG - Intronic
950224654 3:11223868-11223890 ATCTTTGTTTACTGTGTGTTTGG - Intronic
951224092 3:20100166-20100188 CTCACAGTTTACTGTGTGTTTGG + Intronic
951752116 3:26048164-26048186 GTCACTGTCTACTGTGTGCCAGG + Intergenic
952850642 3:37725696-37725718 GTAATGGTTTACTGTGTGCCAGG - Intronic
954042536 3:47899854-47899876 CGCATGGATTCCTGTGTGTCTGG + Intronic
954905381 3:54058349-54058371 CTTATTGTTTAATTTGAGTCAGG - Intergenic
955017145 3:55082324-55082346 CTGAGTGATTCCTGTGTGTCTGG - Intergenic
955385301 3:58474557-58474579 CTGATTGTTTACTCTGTTCCTGG - Intergenic
955708676 3:61755552-61755574 CTAATTGTCTACTGTGTGCCAGG + Intronic
955835724 3:63052938-63052960 TTCATTATTTACTATGTGTTAGG - Intergenic
956376517 3:68619153-68619175 TTGAGTGTCTACTGTGTGTCAGG + Intergenic
957516016 3:81251885-81251907 TTCAGTGCTGACTGTGTGTCAGG - Intergenic
957573821 3:81984144-81984166 CTCAATTTCTACTATGTGTCAGG - Intergenic
957592729 3:82221733-82221755 TTCATTTTTCATTGTGTGTCTGG + Intergenic
957609719 3:82451434-82451456 CTCATTTTTTAATGTGTGTCAGG - Intergenic
957860272 3:85939559-85939581 CTCATTATTTACAGCGTGTTGGG - Intronic
958513783 3:95085349-95085371 CTCTTTTCTTACTTTGTGTCTGG + Intergenic
958718573 3:97818238-97818260 CACAGTATTTACTGTGTGGCAGG - Intergenic
958736028 3:98010540-98010562 ATCTTTGTTTACTTTGGGTCCGG - Intronic
959003663 3:100994561-100994583 GTAAATGTTTCCTGTGTGTCAGG - Intergenic
960206443 3:114906140-114906162 TTAAGTGTTGACTGTGTGTCAGG - Intronic
960377421 3:116920418-116920440 CTAAGTGTTTACTATGTGTGAGG - Intronic
960426082 3:117509318-117509340 AGAAGTGTTTACTGTGTGTCAGG - Intergenic
960699035 3:120423082-120423104 CTCATTGCGTATTGTGTGCCTGG + Intronic
960923277 3:122770365-122770387 TTGATTGTTTACTATGTGCCAGG - Intronic
961157742 3:124694817-124694839 CTATTTGTTTAATGTGGGTCTGG - Intronic
961589054 3:127961603-127961625 TTCATTGAGTACTGTGTGGCAGG + Intronic
962230310 3:133659831-133659853 CTGAGTGCTTACTGGGTGTCAGG - Intronic
962446943 3:135474298-135474320 ATCCTTGTTTACTATATGTCAGG + Intergenic
962513815 3:136129699-136129721 CTCATTTTTTGTTGTGTCTCTGG - Intronic
962685861 3:137847081-137847103 CCCATTCATTACTGTGTCTCAGG + Intergenic
962950660 3:140215605-140215627 CTGAATGTTTACTGTATGCCTGG - Intronic
962970317 3:140394763-140394785 TTCAGTGTTTACTATGGGTCAGG - Intronic
963499769 3:146111511-146111533 TTCAGTGTTTACAGTGTGCCAGG - Intronic
963670862 3:148250365-148250387 CTGAGTGCTTACTGTGTGCCAGG - Intergenic
964036519 3:152205816-152205838 CTCATTCTTCACTGTGTCTATGG + Intergenic
964675171 3:159270090-159270112 CTGAATGTCTACTGTGTGCCAGG + Intronic
964734190 3:159899563-159899585 TTCAGTGTTTCCTGGGTGTCAGG - Intergenic
964825435 3:160821884-160821906 CTGAGTTCTTACTGTGTGTCAGG + Intronic
966013515 3:175112082-175112104 AATATTGTTTACTATGTGTCAGG - Intronic
966017339 3:175157456-175157478 CTTAATGCTTATTGTGTGTCAGG - Intronic
966528915 3:180951766-180951788 TTGAATGTTTACTGTGTGCCAGG + Intronic
966617982 3:181932719-181932741 GCCATTGTTTCCGGTGTGTCTGG + Intergenic
966821009 3:183924457-183924479 CTGAATGTTTACTGTGTGTCAGG - Intronic
968045435 3:195621553-195621575 TTGAGTGCTTACTGTGTGTCCGG - Intergenic
968064229 3:195749574-195749596 TTGAGTGCTTACTGTGTGTCCGG - Intronic
969161075 4:5259611-5259633 CTGAGCATTTACTGTGTGTCTGG - Intronic
970008839 4:11436454-11436476 TTCAGTGTGTACTCTGTGTCAGG - Intergenic
970365433 4:15353623-15353645 CTTAGTGTGCACTGTGTGTCTGG + Intronic
970478865 4:16452674-16452696 CTGAACGTTTACTCTGTGTCAGG - Intergenic
970676855 4:18460610-18460632 TTTATTGTTTACTATTTGTCAGG + Intergenic
970766986 4:19561819-19561841 CTCATTGTCTGTTATGTGTCAGG + Intergenic
972175203 4:36396293-36396315 CTCTATGTTTACTGTGTTACGGG + Intergenic
972371539 4:38428616-38428638 TTGATTGTTTACTGTGTACCAGG - Intergenic
972500689 4:39675293-39675315 CTGAATGTCTACTATGTGTCAGG + Intergenic
972851870 4:43060237-43060259 TTCATTGTTGACTTTCTGTCTGG - Intergenic
974329990 4:60465658-60465680 CTCTTTGTTTTCTGTTTGCCTGG - Intergenic
975128263 4:70806384-70806406 CTGAATGTTTACTATGTGCCAGG - Intronic
977256636 4:94748243-94748265 TTCATTGCTTACTATGTGCCAGG - Intergenic
977784864 4:101021072-101021094 GTAATTGTTTATTGTCTGTCTGG - Intergenic
978444373 4:108766597-108766619 CTCTTTGGATACCGTGTGTCAGG - Intergenic
979293993 4:119010136-119010158 CTGAGTGTTTACTATGTGTTAGG + Intronic
979803974 4:124947686-124947708 ATGAATGATTACTGTGTGTCTGG + Intergenic
980032501 4:127846339-127846361 CTCATTGGCTCCTGTGTGGCTGG - Intergenic
981243459 4:142506668-142506690 CTCCTTTCTTACTGTGGGTCAGG + Intronic
981346431 4:143682731-143682753 TTGAGTGTTTACTATGTGTCGGG + Intronic
981559158 4:146028239-146028261 GTTATTGTCTACTGGGTGTCAGG + Intergenic
981652454 4:147075436-147075458 CACATAGATTACTGTGTGACTGG - Intergenic
981791851 4:148546456-148546478 CTGAGAGCTTACTGTGTGTCAGG - Intergenic
982155839 4:152520008-152520030 TTGAATGTTTACTGTATGTCAGG - Intronic
982737986 4:159025938-159025960 TTGATTGTTTACTGTGTGCCAGG - Intronic
983252984 4:165365792-165365814 TTGATTATTTACTGTGTGTGAGG - Intronic
984229975 4:177083684-177083706 TTTATTGTGTACTGTATGTCTGG - Intergenic
984620522 4:181947119-181947141 CTCAGTGCCTACTGTGAGTCAGG + Intergenic
989179400 5:38561624-38561646 TTTATTGCTTACTTTGTGTCAGG - Intronic
990157939 5:52900844-52900866 TTGAGTGTTAACTGTGTGTCAGG - Intronic
990827371 5:59916433-59916455 CTTATTGTTCACTGTATGTCTGG - Intronic
992294098 5:75309857-75309879 CTAAGCATTTACTGTGTGTCAGG - Intergenic
993300997 5:86209772-86209794 TTTATTTTTTACTGTGTGTCAGG - Intergenic
993897304 5:93551853-93551875 GTCAATGTATAATGTGTGTCTGG - Intergenic
994341383 5:98632760-98632782 CTCAATGTTTACTGTATTCCAGG - Intergenic
995691766 5:114834313-114834335 CTCATTGTTTGTTTTTTGTCAGG - Intergenic
996118462 5:119644938-119644960 CCGAGTGCTTACTGTGTGTCAGG + Intergenic
996167743 5:120246012-120246034 TGCATTGTTTATTATGTGTCAGG + Intergenic
997140755 5:131377974-131377996 TTTATTGTCTACTGTGTGTCAGG + Intronic
997408027 5:133667886-133667908 TTTATTGTCTACTGTGTGCCAGG - Intergenic
997526586 5:134557099-134557121 CACAGTGATTACTGTGTGTCAGG + Intronic
997823505 5:137086472-137086494 CTCTTTGTTTACTCTGAGTGTGG + Intronic
997862538 5:137431065-137431087 CTCATTGCTTCCTGTTTGTGGGG - Intronic
998217510 5:140248426-140248448 TACATTCTTTAGTGTGTGTCAGG - Intronic
998352131 5:141508701-141508723 CTCATTCTTTTCTGTGTGCAGGG + Intronic
998479857 5:142453749-142453771 TTAAGCGTTTACTGTGTGTCAGG - Intergenic
998901347 5:146858364-146858386 CTGAATGTTTAATCTGTGTCAGG + Intronic
999042691 5:148432608-148432630 CTGAGCGCTTACTGTGTGTCAGG - Intronic
999105224 5:149064580-149064602 CTGAATGTTTACTGTGGGCCAGG + Intergenic
999140617 5:149358777-149358799 CTTTTTGTTTATTGTGTGTGTGG + Intronic
999249249 5:150172331-150172353 CTAAATCTTTACTGTGTGCCAGG + Intronic
999416361 5:151399863-151399885 ATCATTGTTTACTTTGTGCCTGG + Intergenic
1000280169 5:159775131-159775153 CTGAGTATTTACTGTGTGCCAGG + Intergenic
1000858058 5:166424469-166424491 CTCATTGCCTACTATGTGTCAGG + Intergenic
1001042066 5:168343287-168343309 CTGAGTGTTTACTGTGGGGCAGG + Intronic
1001224471 5:169931885-169931907 CTCTTTCTTCACTGTGGGTCAGG + Intronic
1001575564 5:172761625-172761647 TTTATTCTTTACTATGTGTCAGG + Intergenic
1001831121 5:174790232-174790254 ATCATTGTTAACTGTGTGATAGG + Intergenic
1003410229 6:5855628-5855650 CTCTTTCTTTACTGTGAGCCAGG + Intergenic
1004425655 6:15505314-15505336 CTCATCTTTTAGTGTGTGACAGG + Intronic
1004458123 6:15810550-15810572 TTGATTATTTACTGTGTGTTAGG + Intergenic
1004548744 6:16626128-16626150 TTAATTGCTTACTATGTGTCAGG - Intronic
1005556261 6:26987966-26987988 CTCAGTGTTTCCTTTGTGTTTGG - Intergenic
1006344983 6:33473710-33473732 CTCCTTGTATACTTTGAGTCAGG + Intergenic
1006643327 6:35499515-35499537 CACAGTGTTTACTATGTGCCAGG - Intronic
1007147840 6:39654417-39654439 CCCATTCTTTCCTGTCTGTCAGG + Intronic
1007813960 6:44506919-44506941 TTCACTGGCTACTGTGTGTCAGG - Intergenic
1008742965 6:54632132-54632154 CTCATTGTTTGCTGTGGGTGAGG + Intergenic
1008761602 6:54858617-54858639 CTCATTTTTTCTTGTGTTTCTGG - Intronic
1008839537 6:55884436-55884458 CTTATTATTTATTTTGTGTCAGG - Intergenic
1010332573 6:74641427-74641449 CTGATTGCTTACTGTATGTCAGG - Intergenic
1010443193 6:75921968-75921990 CTCAGTGTTGACTGTATGTCTGG + Exonic
1011078135 6:83459911-83459933 CTCTTTGTTTCCTGTTTGTTGGG - Intergenic
1013795320 6:113881422-113881444 CTGAGTGTTTACTATGTGCCAGG - Intergenic
1015152376 6:130054321-130054343 TTCATTGTATTCTGAGTGTCAGG + Intronic
1015317471 6:131832602-131832624 CTCATAGTTTTTGGTGTGTCAGG + Intronic
1015460991 6:133490799-133490821 TTCTTTGTTGATTGTGTGTCTGG - Intronic
1015915997 6:138217352-138217374 TTGATTGTTTTCTATGTGTCAGG + Exonic
1016679087 6:146807549-146807571 TTCTTTTTTTTCTGTGTGTCAGG - Intronic
1016679730 6:146815179-146815201 TTCTTTTTTTTCTGTGTGTCAGG - Exonic
1017062662 6:150499862-150499884 CTGAGTGTTTACTCTGTGTTGGG - Intergenic
1017088401 6:150736350-150736372 CTAATTGATTACTATGTGCCAGG - Intronic
1017248439 6:152253358-152253380 CTGAGTGTTTACTATGTATCAGG + Intronic
1018360247 6:163060739-163060761 CTGAGTGTTTACTGTGGGTTGGG - Intronic
1019192279 6:170259204-170259226 ATCATTGCTGACTGTGTGCCAGG - Intergenic
1020046059 7:5041349-5041371 CTCAGGGTTTACTGGGTTTCTGG - Intronic
1020291416 7:6725239-6725261 CTCAGGGTTTACTGGGTTTCTGG - Intergenic
1021219155 7:17955067-17955089 CTCATAGTTTCCTCTGTGGCAGG - Intergenic
1023142593 7:37117078-37117100 CTCAGTGTTTCCTCAGTGTCAGG - Intronic
1024051608 7:45627394-45627416 CTCATTCATCACTGTGTGTGTGG + Intronic
1024722037 7:52148206-52148228 CTCATTGTTCAATGTGATTCTGG + Intergenic
1025017767 7:55453508-55453530 ATTATTGTTTGTTGTGTGTCAGG + Intronic
1025887620 7:65612871-65612893 CTCATGGTCTACTATGTTTCAGG - Intergenic
1026256746 7:68718808-68718830 CTCAGTGTTTACCATGTGCCAGG - Intergenic
1026878027 7:73890807-73890829 CTGAGCGTTTACTCTGTGTCAGG - Intergenic
1028016508 7:85720525-85720547 TTTATTGTTTCCTGTGTGCCAGG + Intergenic
1028513874 7:91655223-91655245 CACAGTTTTTATTGTGTGTCTGG - Intergenic
1030346137 7:108434653-108434675 CTCATGGTTTTGTGTGTGGCTGG - Intronic
1031058286 7:117018783-117018805 CTGAGTGTTTACTATGTGCCAGG - Intronic
1031626067 7:123994567-123994589 TTCTTTGTTTACTGTTTGACAGG + Intergenic
1031854792 7:126909037-126909059 CTCATGGTCTACTATGTTTCAGG + Intronic
1032009387 7:128333145-128333167 CTCATTGTTTAGTATGTTCCTGG + Intronic
1033382323 7:140834289-140834311 TTCATTATCTAATGTGTGTCAGG - Intronic
1033445365 7:141416820-141416842 CTCGTTATGTACTCTGTGTCTGG - Intronic
1037266467 8:17067364-17067386 TTAAATGTTTACTGTGTGCCAGG - Intronic
1037753194 8:21695937-21695959 CTCATTGTTTCAGGTGTGGCAGG + Intronic
1038227722 8:25672299-25672321 CTGATTATTTACCGTGTGCCAGG + Intergenic
1038393303 8:27225621-27225643 CTGAGTGTTTGCTGTGTGCCAGG + Intergenic
1039231345 8:35452104-35452126 TTAATTGGTTACTGTGTGCCAGG - Intronic
1041910572 8:63085028-63085050 CTGAATGCTTACTGTGTGCCAGG + Intronic
1042237640 8:66629128-66629150 TTGAGTGTTTACTATGTGTCAGG + Exonic
1042302843 8:67304288-67304310 CTCATTGCCTACTGTGTGCCAGG + Intronic
1043427242 8:80159689-80159711 TTTATTGTTTTCTGTATGTCAGG - Intronic
1043687489 8:83106363-83106385 CACAGTATCTACTGTGTGTCAGG - Intergenic
1045060436 8:98406155-98406177 CTGGATGTTTATTGTGTGTCAGG - Intronic
1045211508 8:100104829-100104851 CCCATTGTATACAGTGTTTCAGG - Intronic
1046061517 8:109145222-109145244 CTCAATGTTTACTGTATAGCAGG + Intergenic
1046084239 8:109411962-109411984 TGCAGTGTTTACTGTGTGTCAGG - Intronic
1046610480 8:116417863-116417885 TTAAATGTTTACTTTGTGTCAGG + Intergenic
1047067918 8:121307323-121307345 TTGAGTGTTTACTGGGTGTCAGG - Intergenic
1047604098 8:126457329-126457351 CTTACTGTTTACTATGTGTCAGG - Intergenic
1047795230 8:128248458-128248480 CTGAGTGTTTACTGTGTGCCAGG + Intergenic
1049566000 8:143339528-143339550 GTGAGTGTTTGCTGTGTGTCTGG - Intronic
1049890880 9:70022-70044 TTCAATGTTTATTGTGGGTCAGG - Intergenic
1049949406 9:629859-629881 CTGAGTGTTTTCTGTGTGTCAGG + Intronic
1052387884 9:27843659-27843681 TTGATTGTTTACTGAGTGTTTGG - Intergenic
1053483714 9:38436169-38436191 CTGAGTGCTTACTGTCTGTCAGG + Intergenic
1053732343 9:41071206-41071228 TTCAATGTTTATTGTGGGTCAGG - Intergenic
1054696108 9:68360510-68360532 TTCAATGTTTATTGTGGGTCAGG + Intronic
1054981210 9:71209012-71209034 CTCATGATTTACATTGTGTCTGG - Intronic
1055856872 9:80698946-80698968 CTCATTGTTTATTTAGTCTCTGG + Intergenic
1055887329 9:81079127-81079149 CTCATTGTTTCCTGTTTGCTAGG - Intergenic
1055999914 9:82203981-82204003 CTAAGTATTTACTGTGTTTCAGG + Intergenic
1056429779 9:86515722-86515744 TTGAATGTTTACTATGTGTCAGG + Intergenic
1056481922 9:87014474-87014496 CTTTTTGTTTTCTCTGTGTCAGG + Intergenic
1057616349 9:96594149-96594171 CTTTTTGTTTCCTGTGTCTCAGG - Intronic
1058439576 9:104994344-104994366 TTGAGTGTTTACTATGTGTCAGG - Intergenic
1058579676 9:106441318-106441340 TTTAATGTTTACTATGTGTCAGG - Intergenic
1058903383 9:109461029-109461051 CTAATAGTTTAGTATGTGTCTGG - Intronic
1060695793 9:125707710-125707732 CTGCATGTTTACTATGTGTCAGG - Intergenic
1060773687 9:126352199-126352221 CTTTTTGTATACTGTCTGTCTGG + Intronic
1061470812 9:130824052-130824074 CCTATTGTTTCCTGTGTCTCTGG - Intronic
1061708729 9:132472809-132472831 CTCAGTGTTTGCTGTGTGCCCGG + Intronic
1062665977 9:137672083-137672105 CTCATTCTGTGCTGAGTGTCAGG + Intronic
1185593443 X:1293539-1293561 CTCTTTGTCTACTCTGTGTAGGG - Intronic
1186852517 X:13594256-13594278 TTTATTGTCTACTTTGTGTCAGG + Intronic
1187560043 X:20394051-20394073 TTGAATGTTTACTGTGTGCCAGG + Intergenic
1188106574 X:26154527-26154549 GTCATTGTTTAATGTTTGTGTGG - Intergenic
1188287046 X:28340024-28340046 CTCTTTGTTTGCTGTGTTTCTGG + Intergenic
1188392969 X:29643880-29643902 CACATTTTTTTGTGTGTGTCAGG + Intronic
1188963620 X:36523877-36523899 ATCATTATATACTGTGTGTCAGG - Intergenic
1191090902 X:56619798-56619820 CTCAGTGTTTCCTGTTTATCTGG - Intergenic
1191188884 X:57643862-57643884 ATCATTGTTGACTTTCTGTCTGG - Intergenic
1192046314 X:67677741-67677763 CTCATTGTGTAATCTGAGTCAGG + Intronic
1192365978 X:70473560-70473582 CTGAATGTCTACTGTGTATCAGG - Intronic
1192423835 X:71058087-71058109 CTAATAGTCTTCTGTGTGTCTGG - Intronic
1192745248 X:73931853-73931875 CTGAATGCTTACTCTGTGTCTGG - Intergenic
1193557631 X:82975468-82975490 CTGGTTGTTTGCTATGTGTCTGG + Intergenic
1193919650 X:87409542-87409564 TTCCTTTTTGACTGTGTGTCCGG + Intergenic
1194346713 X:92773952-92773974 CCCATTGTCTACTGTGTGAATGG - Intergenic
1194444453 X:93970646-93970668 TTCAGTGCTTACTATGTGTCAGG + Intergenic
1195676097 X:107507961-107507983 CTCAGTGCTTTCTGTGTGCCAGG + Intergenic
1196207016 X:112952099-112952121 CTGAGTGCTTACTATGTGTCAGG - Intergenic
1197308880 X:124879371-124879393 ATCATTTTTTATTCTGTGTCTGG + Intronic
1197751663 X:129968258-129968280 CTCTTTGTTGAGTGAGTGTCTGG + Intergenic
1198250737 X:134877166-134877188 CTCATTGTTTCCTATGTGAATGG - Intergenic
1198874037 X:141203920-141203942 CTCATTGGAGACTCTGTGTCGGG + Intergenic
1199506353 X:148566049-148566071 CTAATTGTTTACTCTCTGCCAGG + Intronic
1199840205 X:151638478-151638500 CTGAGTGCTTACTGTGTATCAGG + Intronic
1200109283 X:153731902-153731924 CTCCTTTTATACTGTGTATCAGG + Intronic
1200385746 X:155888975-155888997 TTTATTGTTTACTATGTGCCAGG - Intronic
1200655046 Y:5890596-5890618 CCCATTGTCTACTGTGTGAATGG - Intergenic
1201761453 Y:17543845-17543867 TACAATGTTTACTCTGTGTCTGG - Intergenic
1201840099 Y:18362145-18362167 TACAATGTTTACTCTGTGTCTGG + Intergenic