ID: 906780688

View in Genome Browser
Species Human (GRCh38)
Location 1:48570383-48570405
Sequence GGGCTGTGAGAGGTGGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 724
Summary {0: 1, 1: 0, 2: 3, 3: 71, 4: 649}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906780680_906780688 4 Left 906780680 1:48570356-48570378 CCTCTTTGAGGAGCAGTAGGGGC 0: 1
1: 0
2: 0
3: 14
4: 136
Right 906780688 1:48570383-48570405 GGGCTGTGAGAGGTGGGACAGGG 0: 1
1: 0
2: 3
3: 71
4: 649
906780674_906780688 28 Left 906780674 1:48570332-48570354 CCGCCACAGCTTCGCAGTCTGCT 0: 1
1: 0
2: 3
3: 36
4: 558
Right 906780688 1:48570383-48570405 GGGCTGTGAGAGGTGGGACAGGG 0: 1
1: 0
2: 3
3: 71
4: 649
906780675_906780688 25 Left 906780675 1:48570335-48570357 CCACAGCTTCGCAGTCTGCTGCC 0: 1
1: 0
2: 1
3: 33
4: 260
Right 906780688 1:48570383-48570405 GGGCTGTGAGAGGTGGGACAGGG 0: 1
1: 0
2: 3
3: 71
4: 649
906780673_906780688 29 Left 906780673 1:48570331-48570353 CCCGCCACAGCTTCGCAGTCTGC 0: 1
1: 0
2: 0
3: 25
4: 574
Right 906780688 1:48570383-48570405 GGGCTGTGAGAGGTGGGACAGGG 0: 1
1: 0
2: 3
3: 71
4: 649

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906780688 Original CRISPR GGGCTGTGAGAGGTGGGACA GGG Intronic
900037386 1:427482-427504 GGGTTGGGAGAGGTGGGGGATGG + Intergenic
900059016 1:663223-663245 GGGTTGGGAGAGGTGGGGGATGG + Intergenic
900112297 1:1013545-1013567 GGGCTGTGGGCTGTGGGCCACGG - Exonic
900329616 1:2127494-2127516 GGGCAGTGGGAGGCGGGACGTGG - Intronic
900391337 1:2435268-2435290 GGGCTGTGGGGGGTGGGGCCCGG + Intronic
900492099 1:2955489-2955511 GAGCTGTGAGAAGAGGGCCATGG - Intergenic
900607333 1:3529728-3529750 GGGCTGGGAGCTGTGGGACGTGG - Intronic
900954550 1:5878400-5878422 CGGCTGTGAGTGGAGGGACCTGG + Intronic
901136974 1:7003852-7003874 GAGTTGTGAGAGGTGGGTCAAGG + Intronic
901252950 1:7795604-7795626 GGCCTGTGGGAGGAGTGACACGG + Intronic
901327716 1:8378861-8378883 GGGCTGTGAGACGGGGCTCATGG + Intronic
901681816 1:10917197-10917219 AGGCTGTGGGAGGAGGGACAAGG + Intergenic
901730042 1:11273006-11273028 GGGCGGTGAGGGGTGGGGCGGGG - Intergenic
901830000 1:11886494-11886516 GGGCCCTGAGAGGAGGGAGAGGG + Intergenic
901854765 1:12037678-12037700 GAGGTGTGAGACGTGGGTCAGGG - Intergenic
901859494 1:12064815-12064837 GGGCTTGCAGAGCTGGGACAGGG - Intronic
902465853 1:16618144-16618166 GGGCTGTGGGGGGTGGGTCGGGG - Intergenic
902683262 1:18058718-18058740 GGGCTGGGTGAGCAGGGACAGGG - Intergenic
902817864 1:18926393-18926415 GGGCTGTGGGAAGTGGGAAAGGG - Intronic
902920936 1:19665607-19665629 GGGAGGTGAGTGGGGGGACATGG - Exonic
903390164 1:22958532-22958554 GGGATGTGGGTGGTGGGCCAGGG - Intronic
903418943 1:23204567-23204589 GGGCAGGGAGAGGTGGCACAGGG - Intergenic
903742634 1:25567075-25567097 GGGCTGGGAGAGGTGGCAGGCGG - Exonic
903974924 1:27143276-27143298 CGGCCTTGAGAGGTGGGCCAGGG - Intronic
905767380 1:40612655-40612677 GGGCTGTGGGAGGTGGGCACAGG - Intergenic
905881619 1:41467754-41467776 GGGATGTGGGAAGTGAGACAGGG + Intergenic
906241536 1:44245241-44245263 GGGCTGGGAGAGGCGGGGAAGGG - Intronic
906780688 1:48570383-48570405 GGGCTGTGAGAGGTGGGACAGGG + Intronic
906843380 1:49163903-49163925 GGGCTGCGAAAGTTGGAACAGGG + Intronic
906880291 1:49582341-49582363 AGGCTGTGACAGCTGGGACCAGG - Intronic
907241387 1:53083191-53083213 TGGCTGTGAGAGATGAGAGAGGG + Intronic
907875506 1:58483158-58483180 GGGCTGGGAGAGGGGGCAGATGG - Intronic
909560624 1:77005703-77005725 GGGCTGAGAGAAGAGGGAAATGG - Intronic
910152911 1:84174383-84174405 GTGCTGTGAGAGCTGGGAGGGGG - Intronic
910265179 1:85330825-85330847 TGGCAGTGTGAGGTGGGAAAGGG + Intronic
911805407 1:102200710-102200732 GAGCTGTGAGAAGGGGGCCACGG - Intergenic
911871176 1:103101177-103101199 GGGCTTGGGGAGGTGGGAAATGG + Intronic
912028785 1:105212729-105212751 GGGCAGTGAGAAGGGGGGCAGGG + Intergenic
912223035 1:107699527-107699549 GAGCTGTGAGAAGAGGGCCACGG - Intronic
912391438 1:109305999-109306021 GGGCTGTTAGAGGCGGCACTAGG + Intronic
912491355 1:110064495-110064517 GGGCTGGGAGAGGTGGGCACTGG - Intronic
913405462 1:118486213-118486235 GGGAAGTGAGAGGGGGTACAAGG - Intergenic
913522303 1:119656389-119656411 ATGCTGTGAAAGGTGGGACAGGG + Intergenic
913551989 1:119925158-119925180 GGGCAGTGTGCGATGGGACAAGG + Intronic
913966518 1:143381606-143381628 GTGCTGTGGGAGATGGGTCAGGG + Intergenic
914060893 1:144207213-144207235 GTGCTGTGGGAGATGGGTCAGGG + Intergenic
914118257 1:144759156-144759178 GTGCTGTGGGAGATGGGTCAGGG - Intergenic
915298964 1:154941329-154941351 GACCTGGGAGAGGTGGGACAGGG + Intergenic
915471177 1:156126602-156126624 GAGCTGTGCCTGGTGGGACAAGG - Intronic
915939503 1:160109767-160109789 CCGCTGTGAGAGGTGGGACAGGG - Intergenic
916078553 1:161217890-161217912 GGGCTCTGGGAGGTAGGACAGGG - Intronic
916118844 1:161510747-161510769 TGGAGGTGGGAGGTGGGACAGGG + Intronic
916411469 1:164551056-164551078 GAGCTGTGAGAAGAGGGCCATGG - Intergenic
916426420 1:164685518-164685540 TGGCTGTAAGAGGTGGGAAGGGG - Intronic
917972724 1:180219191-180219213 GGGCTGTGAATGGTGAGACGGGG + Intergenic
918043843 1:180929293-180929315 GGGGTGTGGGAGGTGTGAGAAGG + Intronic
919215237 1:194544913-194544935 AGGCTGTCAGGGGTGGGGCAGGG - Intergenic
919308741 1:195878334-195878356 GAGCTGTGAGAAGAGGGCCATGG - Intergenic
919521946 1:198599937-198599959 GAGCTGTGAGAAGAGGGCCATGG + Intergenic
919887312 1:201944231-201944253 GGGGTGAGAGAGGTGAGGCAGGG + Intronic
919922355 1:202174198-202174220 GGGCCCTAAGAGGTGTGACAGGG + Intergenic
919924501 1:202185427-202185449 GGGCAGGGAGGGGTGGGACTGGG + Intergenic
920288707 1:204901093-204901115 AGGCTGTGTGTGGTGGGGCAGGG + Intronic
920390618 1:205598212-205598234 AGGCTGTGAGAGGTGGGGTAGGG - Intronic
920397967 1:205660274-205660296 GGGCTGGGGGAGGTGGGAAGAGG - Intronic
922163268 1:223094095-223094117 GGGGTGTGTGTGGTGGAACAGGG + Intergenic
922862358 1:228830275-228830297 GGCCTGTGGGAAGTGGGCCAGGG + Intergenic
924179381 1:241424875-241424897 GGGCTGTCAGTGCTGGGGCACGG - Intergenic
1063371194 10:5524089-5524111 GGCCTGTGAGGGAGGGGACAAGG - Exonic
1064141777 10:12796741-12796763 GAGCTTTGTGAGGTGGGGCACGG + Intronic
1064271663 10:13871281-13871303 GGGCTGTGTGGGGGCGGACACGG + Intronic
1065489226 10:26265888-26265910 GGGCAGTCAGAGGATGGACAAGG + Intronic
1065813445 10:29463633-29463655 GTGCTGTGAGGGCAGGGACAGGG + Exonic
1066371206 10:34819700-34819722 GGGCTCTGAGTGGTGGGTCATGG - Intergenic
1067116215 10:43437224-43437246 GGGCTGTGAGAGGGGGAGCGTGG + Exonic
1067972939 10:50992196-50992218 GGACAGGGAGAGGCGGGACAGGG + Intronic
1068543809 10:58325351-58325373 GGGTTGTGGGAGCTGGGACAAGG - Intergenic
1069904649 10:71725190-71725212 GGACTCTGTGAGGTGGGGCAAGG - Intronic
1070017491 10:72548221-72548243 GGGCTGAGAAATGTGAGACAAGG + Intronic
1070712118 10:78690329-78690351 AGGCTGTGTGGGGAGGGACAAGG + Intergenic
1071455968 10:85851941-85851963 GGGCTGTGAAGGGTGGGGCTGGG - Intronic
1071574528 10:86715969-86715991 GGGCGGGGAGAGGTGGGAGTGGG - Intronic
1071873411 10:89818837-89818859 GAGCTGTGAGAAGAGGGCCACGG - Intergenic
1071940434 10:90585932-90585954 TGCCTGTGAGAGGTGGGAGTGGG - Intergenic
1072608586 10:97002411-97002433 GGGCTGTGTCAGGTGGGGCTTGG - Intronic
1072728632 10:97829928-97829950 GACCTGGGAGGGGTGGGACACGG - Intergenic
1073122312 10:101130323-101130345 GGGCTGGGATTGGTGGGACTAGG - Intronic
1073214339 10:101828364-101828386 GAGCTGGGCGAGGTGGGCCAGGG - Intronic
1074362306 10:112833271-112833293 GTGATGTGGGATGTGGGACATGG - Intergenic
1075089562 10:119436197-119436219 GGGCTTTGGGAAGTGGAACATGG - Intronic
1075190969 10:120308377-120308399 GGGCTATAAGGGATGGGACAGGG - Intergenic
1075355721 10:121772554-121772576 AGGCTGTGAGGCGTGAGACAGGG - Intronic
1075853655 10:125609204-125609226 GGGGTTGGAGAGGTGGGAGAGGG + Intronic
1075975667 10:126691860-126691882 GGGCTGGGAAGGGTGGGGCAGGG + Intergenic
1076469887 10:130710919-130710941 GGGCTGTGAGGGTCTGGACAGGG + Intergenic
1076964112 11:65405-65427 GGGTTGGGAGAGGTGGGGGATGG + Intergenic
1077182987 11:1224659-1224681 GGGCTGTGAGCTGTGGGTCGGGG + Intronic
1077186406 11:1237273-1237295 GGACTGTGTGCCGTGGGACATGG - Intronic
1077240599 11:1508530-1508552 GGGCTGTGAGGGGGAGGGCAGGG - Intergenic
1077267810 11:1660892-1660914 GGGCCGTGGGGAGTGGGACAGGG - Intergenic
1077267850 11:1661032-1661054 GGGCCGTGGGGAGTGGGACAGGG - Intergenic
1077267864 11:1661072-1661094 GGGCCGTGGGGAGTGGGACAGGG - Intergenic
1077267872 11:1661092-1661114 GGGCCGTGGGGAGTGGGACAGGG - Intergenic
1077267886 11:1661132-1661154 GGGCCGTGGGGAGTGGGACAGGG - Intergenic
1077267900 11:1661172-1661194 GGGCCGTGGGGAGTGGGACAGGG - Intergenic
1077267908 11:1661192-1661214 GGGCCGTGGGGAGTGGGACAGGG - Intergenic
1077267916 11:1661212-1661234 GGGCCGTGGGGAGTGGGACAGGG - Intergenic
1077267924 11:1661232-1661254 GGGCCGTGGGGAGTGGGACAGGG - Intergenic
1077267944 11:1661292-1661314 GGGCCGTGGGGAGTGGGACAGGG - Intergenic
1077267964 11:1661352-1661374 GGGCCGTGGGGAGTGGGACAGGG - Intergenic
1077267989 11:1661432-1661454 GGGCTGTAGGGAGTGGGACAGGG - Intergenic
1077272940 11:1690340-1690362 GGGCTGTGGGGAGTGTGACAGGG + Intergenic
1077272992 11:1690500-1690522 GGGCCGTGGGGAGTGGGACAGGG + Intergenic
1077273005 11:1690560-1690582 GGGCTGTGGGGAGTGCGACAGGG + Intergenic
1077273019 11:1690622-1690644 GGGCTGTGCGGAGTGTGACAGGG + Intergenic
1077273022 11:1690642-1690664 GGGCTGTGCGGAGTGTGACAGGG + Intergenic
1077273032 11:1690682-1690704 GGGCTGTGGGGAGTGTGACAGGG + Intergenic
1077273037 11:1690702-1690724 GGGCTGTGGGGAGTGTGACAGGG + Intergenic
1077273059 11:1690843-1690865 GGGCTGTGGGGAGTGTGACAGGG + Intergenic
1077273064 11:1690863-1690885 GGGCTGTGGGGAGTGCGACAGGG + Intergenic
1077303777 11:1858828-1858850 GGGCCGTGCTGGGTGGGACACGG - Intronic
1077353837 11:2105593-2105615 GGGCAGAGACAGATGGGACAGGG - Intergenic
1077390874 11:2300176-2300198 GGGGTGTGTGAGGTTGGGCAGGG + Intronic
1077514942 11:2995723-2995745 GGGATTTGAGAGGTAGGGCACGG + Intergenic
1077851485 11:6077842-6077864 GGGCTGTGTGAGTTGGGCCGTGG - Intergenic
1078083060 11:8217858-8217880 AGGCAGGGAGAGGTGGGCCAAGG - Intergenic
1078328403 11:10398729-10398751 GGGCTGTGAGAGCAGGGAGGAGG - Intronic
1079835206 11:25325475-25325497 GTGTTGTGAGAGGTGAGAAAAGG - Intergenic
1080296572 11:30736632-30736654 GGGAAGTGAGGGGTGGGTCAGGG + Intergenic
1080359299 11:31494059-31494081 GAGCTGTGAGAAGAGGGCCATGG - Intronic
1081713090 11:45230518-45230540 GGGCTGGGCCAGGTGGGACCTGG - Intronic
1081724760 11:45320569-45320591 GCGCTGTGAGAGGTGGAGGAGGG + Intergenic
1083004078 11:59324847-59324869 GGGAAGGGAGAGGAGGGACAAGG - Intergenic
1083161320 11:60855943-60855965 GGGCAGACAGAGGTGGGAGAGGG + Exonic
1083189794 11:61041770-61041792 GGGCTGTTTGAAGTGGGAGAGGG - Intergenic
1083614335 11:64018902-64018924 TGGCTGTGTGAGGTGGGGGATGG + Intronic
1083735410 11:64677517-64677539 GGGCAGGGACAGGTGGGGCAAGG - Intronic
1083764742 11:64836400-64836422 GGGCTGGGTGAGGTGGGTGAGGG - Intronic
1083936441 11:65872359-65872381 GGGCTGCGAGATGGTGGACACGG + Exonic
1084440566 11:69170369-69170391 GGGCTGGGTGAGGGGGGACCTGG - Intergenic
1084671477 11:70609146-70609168 GGGCTTTGAGAGGTGGGAGCCGG - Intronic
1084964766 11:72738844-72738866 GAGCTGTGTGTGGTGGGAAAGGG - Intronic
1085564188 11:77498504-77498526 GGACTGTGAGAGGTGGGCCGTGG - Intergenic
1085688232 11:78645223-78645245 AGACTCTGAGAGGTGGCACAAGG - Intergenic
1086142001 11:83509823-83509845 GGGCTGAGAGATGTGAGACCTGG + Intronic
1088360662 11:108985747-108985769 GAGCTGTGAGTGCTGGGACCAGG + Intergenic
1088429760 11:109745949-109745971 TGGCTGTGAGAGATGGGGCTAGG + Intergenic
1089606999 11:119647321-119647343 GGGCAGGGAGTGGTGGGGCAGGG - Intronic
1089634962 11:119806148-119806170 TGGCTCAGAGAGGTGGGACCCGG - Intergenic
1089936184 11:122366291-122366313 GGGATGATAGAGGTGGGGCAGGG - Intergenic
1090080465 11:123609065-123609087 GCCCTGTGAGGGGAGGGACAGGG - Intronic
1090090798 11:123695939-123695961 GGGCTGCGAGAAGAGGGAAATGG - Intergenic
1090800089 11:130165177-130165199 GGGCTGTGACATGCGGAACAGGG + Intronic
1091446381 12:546195-546217 GGGGTGTGAGAGGAGGGAGGGGG + Intronic
1091778678 12:3200507-3200529 GGGCTGGGAGAGGTGTGCCCAGG + Intronic
1091909892 12:4221087-4221109 GGGCTGGGAGAAGTGGGGAACGG - Intergenic
1092212080 12:6652899-6652921 GGGCTGTGAGAGGTGGGGCGAGG - Intronic
1092841177 12:12542466-12542488 GGGCTGGGAGGAGTGGGAAATGG + Intronic
1093238529 12:16640865-16640887 GAGCTGTGAGAAGAGGGCCATGG - Intergenic
1094339275 12:29392737-29392759 GGGTTGGTAGAGGTGGGAAAGGG + Intergenic
1094501325 12:31023414-31023436 GGGCTGTTCGTGGTGGGGCATGG + Intergenic
1095147687 12:38750340-38750362 GAGCTGTGAGAAGAGGGCCATGG + Intronic
1095857493 12:46876456-46876478 AAGCTGTGAGAAGTGAGACAAGG + Intergenic
1095946211 12:47755035-47755057 GGGCTGCTTGTGGTGGGACAGGG + Intronic
1096063286 12:48719962-48719984 GAGCTGTGAGAAGAGGGCCATGG - Intergenic
1096192908 12:49631797-49631819 GGGCTGGAACAGGAGGGACAGGG - Intronic
1096234525 12:49917202-49917224 GGACTGTGACATGTGGGAGAAGG + Intergenic
1096423357 12:51479404-51479426 GGGCTGTGTGCGGTGGCTCATGG + Intronic
1096555850 12:52403251-52403273 GGGCTGTGGTAGCTTGGACATGG + Intronic
1096814847 12:54195671-54195693 GGGCTAGGAGAGGAGGGTCAGGG - Intergenic
1101021512 12:100558877-100558899 CGGCTGAGAGAGGTGGAACTAGG - Intronic
1101138702 12:101772727-101772749 GTGCTGTGAGAGGGAGGAAAGGG - Intronic
1101963731 12:109268005-109268027 GGGCAGTGAGGGGTGGGAGAAGG + Exonic
1102010349 12:109614561-109614583 TGGGTGTCAGGGGTGGGACAGGG - Intergenic
1102474482 12:113179834-113179856 GAGATGTGACAGGTGGGACAAGG + Intronic
1102514897 12:113439856-113439878 GAGCTGTGAGGGGTTGGAAAAGG - Intergenic
1103962630 12:124618486-124618508 GGGCTGGGGGAGGTGGGAACGGG - Intergenic
1104483700 12:129130692-129130714 GGGCAGTGAGAGGAGAGACAGGG + Intronic
1104946463 12:132416972-132416994 GGGCTGGCAGGGGTGGGCCAAGG - Intergenic
1104979616 12:132567988-132568010 TGGCTGTGAGCTATGGGACAGGG + Intronic
1106158325 13:27177970-27177992 GGGAAGTGAGAGGTGGAAGAAGG + Intergenic
1106800973 13:33255477-33255499 AGGCTGGGAGAGGGTGGACAGGG - Intronic
1109088621 13:58009734-58009756 TAGCTATGGGAGGTGGGACACGG + Intergenic
1109658827 13:65431434-65431456 GGGCAGAGGGAGGTGGGACAGGG + Intergenic
1110604433 13:77415317-77415339 GGGCTGTGAGGGGTGGACCCAGG + Intergenic
1110722470 13:78779808-78779830 GGGCTGTCAGAGCTGGCACATGG - Intergenic
1112797996 13:103078332-103078354 GGGCTGTGGGAGGTTGAAAATGG + Intergenic
1113481626 13:110625938-110625960 GGGCTGTGAGAGTGGGCAGAGGG + Intronic
1113696710 13:112351518-112351540 TGGCTGTGAGTGGTTGTACATGG + Intergenic
1113775855 13:112944203-112944225 GGGCCGTGAGAGGAGGGTCCTGG + Intronic
1113775864 13:112944224-112944246 GGGCTGTGAGGGGAGGGTCCCGG + Intronic
1113821775 13:113219624-113219646 GTGCTGTGAGAGGAGAGGCAAGG - Intronic
1114497149 14:23140691-23140713 GAGGGGTGAGAGGTGGGCCAGGG - Intronic
1116056475 14:39870591-39870613 ATGCTGAGAGAAGTGGGACAGGG + Intergenic
1117274431 14:54178573-54178595 GAGCTTTGAGAGGTGGGAAGAGG - Intergenic
1118199285 14:63657402-63657424 GGGCTGGAAGAGGTGGAAAATGG - Intergenic
1118289112 14:64504188-64504210 GGACTGGGCGAGGTGGGGCATGG + Intronic
1121312528 14:92942955-92942977 GCACTGTAAGAGGTGGCACAGGG - Intronic
1121625718 14:95384275-95384297 GAGTTGAGAGAGGTGAGACAGGG - Intergenic
1121655775 14:95594512-95594534 TGGATGTGAGAGGTGGGTGAGGG - Intergenic
1121681300 14:95794836-95794858 GGACTGGGAGAAGTAGGACATGG + Intergenic
1121742788 14:96265890-96265912 GGGCTGGCAGAGGCGGGAAAGGG + Intronic
1122224675 14:100267473-100267495 GGGCCCTGTGAGGTGGGTCAAGG + Intronic
1122307545 14:100775486-100775508 AGGCTGGGAGAGGGGGGAGAGGG + Intergenic
1122524508 14:102371212-102371234 GGGTTGGGTGAGGTGGAACATGG + Intronic
1122947606 14:105020477-105020499 CGGCGGTGCGAGGTGGGACTAGG - Intronic
1123463476 15:20495605-20495627 AGGCTGTGAGAGGCGGGATTTGG + Intergenic
1123654585 15:22504812-22504834 AGGCTGTGAGAGGCGGGATTTGG - Intergenic
1124062409 15:26306373-26306395 GAGCTGTGAGAAGAGGGCCATGG + Intergenic
1124171332 15:27376361-27376383 GAGCTGTGAGAAGAGGGCCATGG - Intronic
1124274318 15:28313013-28313035 AGGCTGTGAGAGGTGGGATTTGG + Intronic
1124308496 15:28600009-28600031 AGGCTGTGAGAGGCGGGATTTGG - Intergenic
1124878552 15:33620030-33620052 GGGCTGGGGGATGTGGGAAAGGG - Intronic
1124891492 15:33737922-33737944 GGGGTGTGAGAGAGGGGAGAGGG + Intronic
1124896758 15:33784722-33784744 GGGCTCTGAGTGGAGGGACGTGG - Intronic
1125155475 15:36579970-36579992 GGGCTGTGAGAGGGGAGAGATGG - Intronic
1125486465 15:40114634-40114656 GGGCTTTGAGAGCAGGGAAATGG - Intergenic
1125791953 15:42373761-42373783 GGTCTTTGAGGGGTGGGCCAGGG + Intronic
1126240270 15:46433860-46433882 GGGCCCTGAGAGGTTGGAAATGG - Intergenic
1127642862 15:60931723-60931745 GGGCAGGAAGAGATGGGACATGG + Intronic
1127928473 15:63571650-63571672 AGGCTGTGTGAGGTGAGAGAGGG + Intronic
1128522847 15:68386902-68386924 AAGCAGGGAGAGGTGGGACAGGG + Intronic
1129670349 15:77604448-77604470 GTGGTGCGGGAGGTGGGACAGGG + Intergenic
1129673058 15:77617591-77617613 GGGCTGTGTGAGGTGTGGGAAGG - Intronic
1129876346 15:78978065-78978087 GGGCTGTTGCAGGTGGGGCAAGG + Intronic
1130430962 15:83846467-83846489 AGGCTTAGAGTGGTGGGACAGGG + Intronic
1130531790 15:84752599-84752621 GGGCTGTGAAAGGCAGGTCAAGG + Intronic
1130890371 15:88128414-88128436 GGGCTGTGTGAGGATGGACATGG - Intronic
1130937258 15:88480907-88480929 GGGCTGTGGCAGCAGGGACAGGG - Intergenic
1131826016 15:96322938-96322960 GGGCTGTGATAGGTGGTCCCCGG - Intergenic
1131948697 15:97656494-97656516 GGGATTTGAGAGGTGAGAAAAGG + Intergenic
1132122011 15:99184258-99184280 GAGCTGTGAGAAGAGGGCCACGG + Intronic
1132147497 15:99437339-99437361 GGGCAGGGAGAGCTGGGTCACGG - Intergenic
1132380042 15:101360075-101360097 GGGCTGTGAGAGGAGAGAGGGGG - Intronic
1132444439 15:101899778-101899800 GGGTTGGGAGAGGTGGGGGATGG - Intergenic
1132906227 16:2284126-2284148 CTGCTGTGGGAGGTGGGGCAAGG + Intronic
1133255132 16:4512030-4512052 GGGGTGCTAGAGGTGGGGCATGG - Exonic
1134040005 16:11061052-11061074 GGGCTGGGGGACATGGGACATGG + Intronic
1135435825 16:22425969-22425991 GGGCAGTGACGGGTGGGAGATGG + Intronic
1136476227 16:30515379-30515401 AGGCTGGGAGAGGCGGGTCATGG - Intronic
1136654631 16:31702628-31702650 TGGCTATGAGAGCTGGGAAATGG + Intergenic
1136712745 16:32253480-32253502 GGGCTGCGAAAGGCGGGACAGGG - Exonic
1136755171 16:32675949-32675971 GGGCTGCGAAAGGCGGGACAGGG + Exonic
1136777441 16:32879404-32879426 GGGCTGGGGGAGGTGGGGCGGGG - Intergenic
1136812942 16:33194420-33194442 GGGCTGCGAAAGGCGGGACAGGG - Exonic
1136819418 16:33304500-33304522 GGGCTGCGAAAGGCGGGACAGGG - Exonic
1136825981 16:33361035-33361057 GGGCTGCGAAAGGCGGGACAGGG - Exonic
1136831047 16:33459806-33459828 GGGCTGCGAAAGGCGGGACAGGG - Exonic
1136893183 16:33982110-33982132 GGGCTGGGGGAGGTGGGGCGGGG + Intergenic
1137629752 16:49934658-49934680 GGACTGTGGCAGGAGGGACAGGG - Intergenic
1138225773 16:55292970-55292992 TGGAGGTGTGAGGTGGGACAGGG + Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1138480620 16:57300695-57300717 GGGCGTGGAGAGATGGGACAAGG + Intergenic
1138535438 16:57657496-57657518 GGCCTGAAAGGGGTGGGACAGGG + Intronic
1138655761 16:58490418-58490440 GGGCAGTGAGGGCTGGGCCAGGG - Intronic
1138798903 16:60002072-60002094 GAGCTGTGAGAAGAGGGCCATGG + Intergenic
1141506626 16:84482411-84482433 GGGCAGTGACAGCTGGGCCAGGG - Intronic
1141567880 16:84915606-84915628 GCTCTGTGAGAGATGGGAGAAGG - Intronic
1141652291 16:85399497-85399519 GGGCTGTGAAACTAGGGACAAGG - Intergenic
1141793100 16:86249874-86249896 GATCTATGGGAGGTGGGACAGGG + Intergenic
1142180051 16:88663898-88663920 AGGCTGTGGGCGGCGGGACAGGG - Intergenic
1142225561 16:88875598-88875620 GGGCTGAGAGAGGTCGGAGCTGG + Exonic
1202991519 16_KI270728v1_random:17390-17412 GGGCTGCGAAAGGCGGGACAGGG - Intergenic
1203057313 16_KI270728v1_random:936288-936310 GGGCTGCGAAAGGCGGGACAGGG + Intergenic
1203079854 16_KI270728v1_random:1141513-1141535 GGGCTGGGGGAGGTGGGGCGGGG - Intergenic
1142759860 17:2035935-2035957 GGGCGGGGAACGGTGGGACAGGG - Intronic
1142969430 17:3601266-3601288 GGGTTGTGGGAGGTTGGACCAGG - Intergenic
1143084430 17:4405300-4405322 GGGCTTGGGGAGTTGGGACAGGG + Intergenic
1143090504 17:4446849-4446871 GGGCTGTGAGGGGAGGGAGGCGG - Intronic
1143351744 17:6293162-6293184 GGGCTGGGGGAGGAGGGAAATGG + Intergenic
1143562376 17:7703619-7703641 AGGCGTTGAGAGGTGGGACCAGG + Intergenic
1143758836 17:9086515-9086537 GGGCTGTGAGAGGTTAGAACGGG + Intronic
1143862617 17:9901951-9901973 GGGCTGTGCAAGGTGGCAGAAGG - Intronic
1144328032 17:14200432-14200454 GGGCTGTATTAGGTGGGGCAAGG - Intronic
1144568686 17:16381215-16381237 GGGGTGTGAGAGGGGGGAATGGG + Intronic
1144785741 17:17830698-17830720 GGCTTGTGGGAGGTGGGACGGGG - Intronic
1145007536 17:19346045-19346067 GAGCTGTGGGCGGTGGAACAGGG + Intronic
1146927581 17:36755540-36755562 GGGGTGTGAGAGGTGGGCCCTGG + Intergenic
1147192474 17:38746164-38746186 GGGAGTTGAGAGGTGGGAGAGGG - Intronic
1147952130 17:44113125-44113147 AGGCAGAGAGAGCTGGGACAGGG - Intronic
1147956424 17:44137939-44137961 GGGCTGTGGGAGTTGGCTCAGGG - Intergenic
1147991136 17:44334258-44334280 TGGCTGTGAGAGCTGGGAGCAGG - Intergenic
1148085863 17:44993519-44993541 GTGGTGTGAGTGGTGGGAAAGGG - Intergenic
1148144618 17:45355195-45355217 AGGATGTTGGAGGTGGGACAAGG + Intergenic
1148835680 17:50464604-50464626 GGGCTGGCAGAGTTGGGGCATGG + Exonic
1148894260 17:50830955-50830977 GGGTTGTCAGGGGTGGGGCATGG - Intergenic
1149568467 17:57655486-57655508 GGGTGGGGAGAGGTGGGACGGGG - Intronic
1150209890 17:63436150-63436172 GGGCTGTGGGAGGTGAGAGAGGG + Exonic
1150317576 17:64182311-64182333 GGGCTGGGAGGAGGGGGACAGGG + Intronic
1150604684 17:66680791-66680813 GGGGTGGGGGAGGTGGGAAAGGG + Intronic
1151336832 17:73444773-73444795 GGTCGGTGAGCGGTGGGGCAGGG + Intronic
1151551470 17:74824864-74824886 CGACAGGGAGAGGTGGGACATGG + Intronic
1151658877 17:75508343-75508365 GGGCTGTGACAGGTGGGGGGAGG - Intronic
1151880938 17:76893961-76893983 GGGGTGTAAGAGGTGGAAAATGG + Intronic
1152045196 17:77930723-77930745 GGGCTGGGGGAGGTGGGGTAGGG - Intergenic
1152222111 17:79074734-79074756 GGGCTGTGAGGGGCGGGGCCTGG - Intergenic
1152253233 17:79222666-79222688 AGGCTGTGTGTGGGGGGACATGG - Intronic
1152287656 17:79422073-79422095 GGGCTGAGAGAGGCGGGACTTGG + Intronic
1152575857 17:81140720-81140742 GGGCTGTGAGCCGTGGGGCCGGG + Intronic
1152575886 17:81140806-81140828 GGGCTGTGAGCCGTGGGGCCGGG + Intronic
1152610019 17:81310809-81310831 TGGCTGTGGAAGGTGGGAAAGGG - Intergenic
1152929003 17:83100607-83100629 GGTCTGTGGGCGGGGGGACAAGG + Intergenic
1152929040 17:83100704-83100726 GGTCTGTGGGCGGGGGGACAAGG + Intergenic
1152929078 17:83100801-83100823 GGTCTGTGGGAGGGGGGACAAGG + Intergenic
1153019160 18:611155-611177 GAGCTGTAATAGGTGGCACAGGG - Intronic
1153381571 18:4445843-4445865 GTGCTGTGAGAGGTGAGATTTGG + Intronic
1153748509 18:8205959-8205981 GGTCTGTGAAATGTGGGAAATGG + Intronic
1153815147 18:8784737-8784759 GGACTCTGTGAGGTGGGGCAAGG - Exonic
1153965965 18:10182288-10182310 GGGCTGTTGGTGGGGGGACACGG - Intergenic
1154145968 18:11866492-11866514 GGGCTGTGAGAAGAGGGGCCTGG + Intronic
1154325656 18:13388909-13388931 GAGTTGTGGGAGGTGGGTCAGGG + Intronic
1154344692 18:13532086-13532108 GGGCAGTGAGAGATGGGAGCAGG + Intronic
1155142045 18:23052545-23052567 GGGATGTGAGAGGGAGGAGAGGG + Intergenic
1155362437 18:25016338-25016360 GGGCTGGGGGAGGTGAGAAAGGG - Intergenic
1155808516 18:30202819-30202841 GGCATGTGTGGGGTGGGACATGG + Intergenic
1156653259 18:39252353-39252375 TGGCTGTGAGAGATTGGAGAAGG - Intergenic
1158348612 18:56541149-56541171 GGGCTGGGAGAGGGAAGACATGG - Intergenic
1160211290 18:76882312-76882334 GTGCTGTGGGAGGTAGGACAAGG - Intronic
1160640915 19:135037-135059 GGGTTGGGAGAGGTGGGGGATGG + Intergenic
1160752511 19:741206-741228 GGGCTGTGAGAAGTCTCACAGGG + Intronic
1160764751 19:802448-802470 GGGTTGTCTGAGGGGGGACAGGG + Intronic
1160921616 19:1523530-1523552 GGGCGGTGAGGCCTGGGACAGGG - Intergenic
1161437570 19:4272986-4273008 GGGCCCTGAGAGGTGGGGCAGGG - Intergenic
1161684955 19:5698055-5698077 GGGGTGTGAGGGGGAGGACAGGG - Intronic
1161983940 19:7643977-7643999 GGCCTTGGAGAGGTGGGACCTGG + Intronic
1161984109 19:7644543-7644565 GGGATGGGAGAGGCGGGCCAAGG - Intronic
1162126593 19:8502673-8502695 GGGCTGCTAGAGGTGGGGCGGGG + Exonic
1162372425 19:10287448-10287470 GGGCTGGAAGAGGTGGGGGAAGG + Intronic
1162641597 19:12014554-12014576 GGCCAGGGAGAGGTGGGAAAAGG - Intergenic
1162838652 19:13339364-13339386 GGGCTGGGGGAGGGGGAACAGGG + Intronic
1162860966 19:13505786-13505808 GGGCTGGGAGAGGGGGCACCGGG - Intronic
1163255137 19:16151653-16151675 GGGCTGTGGGAGATGGGAGGAGG + Intronic
1163499098 19:17664870-17664892 GAGCTGTGAGAGGGGAGAAAAGG + Intronic
1163526371 19:17823983-17824005 GGGCTAAGAGAGCAGGGACAGGG + Intergenic
1163589921 19:18187132-18187154 GGGCTGGGTGCGGTGGGTCATGG - Intergenic
1163668524 19:18614084-18614106 AGGCTGTGGGAGGTGGGAGCGGG - Exonic
1163685779 19:18710976-18710998 GGGCACTGTGGGGTGGGACAGGG - Intronic
1165145337 19:33726779-33726801 GGGCTAGGAGACGTGGGCCAGGG + Intronic
1165374847 19:35434472-35434494 GAGCTGTCAGAGATGGGCCAGGG - Intergenic
1165403161 19:35614621-35614643 GGGCGCAGAGAGGTGGGACCTGG + Intronic
1165445090 19:35852365-35852387 AGGCTGTGAGTAGTGAGACAAGG - Intronic
1166266100 19:41685423-41685445 GGGATGAGAGAGGTGGAACATGG + Intronic
1166310243 19:41958629-41958651 GGGCGGTGAGAGGAGGGACCGGG + Intronic
1166569523 19:43784860-43784882 GGTCTGAGAGAGGAGGGGCAGGG + Intergenic
1166584619 19:43934951-43934973 GAGCTGTGGGAGGTGGGGGAAGG + Exonic
1167041842 19:47027343-47027365 GGGCAGAGAGAGGGGGGACCTGG - Intronic
1167095282 19:47372130-47372152 GGGCTGGGAGAGGTAGGGAAAGG - Intronic
1167105449 19:47427696-47427718 GGGCTGGGAGACCAGGGACAAGG - Intergenic
1167110167 19:47455874-47455896 GGGCTGTGAGATATGGTAGAGGG + Intronic
1167327911 19:48836625-48836647 GGTCTGTGGGAGGAGGGACTGGG - Exonic
1167441693 19:49512877-49512899 GGTCTGAGAGAGGAGGGACTGGG + Intronic
1167566696 19:50261455-50261477 GATCTGTGAGGGGTGGGAGAGGG - Exonic
1167567826 19:50267923-50267945 TGGCTGTGAGAGGTGAGGGAGGG + Intronic
1167669021 19:50839063-50839085 GGTCTGAGAGAGGTGGGGCTGGG + Intergenic
1167688611 19:50971476-50971498 CGTCTGTGAGAGGAGGGGCAAGG - Intergenic
1167738582 19:51311381-51311403 GGTCTGAGAGAGGAGGGACTGGG + Intergenic
1167798612 19:51726605-51726627 GGTCTGAGGGAGGAGGGACATGG - Intergenic
1167960124 19:53098605-53098627 GGACTGTGAGTGGAGAGACAAGG - Intronic
1167963912 19:53128413-53128435 GGACTGTGAGTGGAGAGACAAGG - Intronic
1168288561 19:55346338-55346360 CACCTGTGAGAGGTGGGACCGGG + Exonic
1168524643 19:57079077-57079099 GGGCTGAGGGTGGTGGGACAAGG + Intergenic
1202700301 1_KI270712v1_random:159101-159123 GTGCTGTGGGAGATGGGTCAGGG + Intergenic
926178450 2:10617920-10617942 GGGCTGGGAGAGGGAGGAGAAGG + Intronic
926224142 2:10955395-10955417 GGGCTGTGAGAGCTGAACCAAGG - Intergenic
926287218 2:11498856-11498878 GGGCTGGGAGAGATGTCACAGGG - Intergenic
926452331 2:13020536-13020558 GAGATGTGAGATGTGGGAGATGG - Intergenic
927324260 2:21785079-21785101 AGACTGGGAGAGGTGGGTCAGGG - Intergenic
927693609 2:25225154-25225176 GGGCTGGGAGAGGTGGGCATTGG - Intergenic
929332193 2:40695595-40695617 GTGGGGTGGGAGGTGGGACAAGG - Intergenic
931200421 2:60092391-60092413 GGCCAGTGAGAAGTGGGCCATGG - Intergenic
931221863 2:60295644-60295666 GGGCAGGGAGAGGAGGGAGAGGG - Intergenic
931226472 2:60336183-60336205 GGGCTGTGTGAGGTAGAACAGGG - Intergenic
931267657 2:60674753-60674775 GGACTGTGGGAAGTGGGACGTGG - Intergenic
932060342 2:68491764-68491786 GTAGTGTGAGAGGTGGGACAGGG - Intronic
932265325 2:70362898-70362920 TGGCTGTGAGAAGAGTGACAAGG + Intergenic
932493835 2:72137026-72137048 GGGATGCCAGAGGTGGGACAGGG + Intronic
932756950 2:74415635-74415657 GGGCAGTGAGATGTCGGAAAGGG + Intronic
933070233 2:77847693-77847715 GGGGTGTCAGGGGTGGGAGAAGG + Intergenic
933075055 2:77913793-77913815 GGGCTATGTGTGGTGGGGCAGGG - Intergenic
934171234 2:89542577-89542599 GTGCTGTGGGAGATGGGTCAGGG + Intergenic
934281540 2:91616895-91616917 GTGCTGTGGGAGATGGGTCAGGG + Intergenic
934728416 2:96640039-96640061 GGGTAGGGAGAGGTGGGGCAGGG - Intronic
934942301 2:98511496-98511518 GGGAGGTGGGAGGTGGGAGAGGG + Intronic
935806185 2:106750038-106750060 GGGCTCTGACAGGTGAGAGAGGG - Intergenic
936445784 2:112594012-112594034 GGGCAGTGGGAAGTGAGACAGGG + Intergenic
936900976 2:117481559-117481581 GGGGTGGCAGAGGAGGGACATGG + Intergenic
937958903 2:127439540-127439562 GGGCTGAGTGGGGTGGGCCATGG + Intronic
938405372 2:131029928-131029950 GGCCTGTCAGATGTGGGGCATGG + Intronic
940430449 2:153584036-153584058 GGGCTGTGACAGCTGGGGTAGGG + Intergenic
942408898 2:175685866-175685888 GTGCTGTGCTAGGTGGGACATGG - Intergenic
942708136 2:178800302-178800324 GGGCTGTGAGAGGTGGCAAGTGG + Intronic
944493689 2:200284366-200284388 GGGCAATGAGAAGTGAGACAGGG - Intergenic
944703534 2:202266099-202266121 GGGCTCTGGGAGGAGGGAGAAGG + Intronic
945735833 2:213599393-213599415 GGGCTGGCAGAGGTGGAAGAAGG - Intronic
946126438 2:217567052-217567074 CGTCTTTGAGAGCTGGGACAAGG + Intronic
946299493 2:218814043-218814065 GTCCTTTGAGAGGTGGTACAGGG - Exonic
946953211 2:224899551-224899573 GGGCTGGGAGATTTGGAACAAGG + Intronic
947713169 2:232327180-232327202 GGGCTGTGTGAGGTGGCCCCTGG - Intronic
947720241 2:232365649-232365671 GGGCTGTGTGAGGTGGCCCCTGG - Intergenic
947900808 2:233719887-233719909 GGTCTGTCAGAGGATGGACAAGG + Intronic
948091772 2:235301695-235301717 GGGAGGAGAGAGGTGGGAGAAGG - Intergenic
948484373 2:238271204-238271226 GGGCTCTGAAAGGTGAGGCAGGG + Intronic
948725499 2:239931317-239931339 GGGCTGTGTGAGGACGGGCAGGG - Intronic
948738752 2:240028893-240028915 CTGCTGGGACAGGTGGGACAGGG + Intergenic
948795246 2:240399232-240399254 GGGCAGAGAGAGGTGGGGCTGGG - Intergenic
948800436 2:240430934-240430956 GGGCAGTGGGAGGCGGGACAGGG + Intergenic
948806698 2:240456188-240456210 GGGGTGTGAGAGGTGGCTGACGG + Intronic
948845474 2:240681008-240681030 TGGCTGTGCGATGTGAGACAAGG + Intronic
948848379 2:240693722-240693744 TGGCTGTGCGATGTGAGACAAGG - Intronic
948891973 2:240911651-240911673 GGGCTGGGAGAGGGGGGAATGGG - Intergenic
949042370 2:241855250-241855272 TGGCTGGGGGAGGTGGGAGAGGG - Intronic
1169141571 20:3229926-3229948 GGGGTGTCAGAGATGGGACAGGG - Intronic
1169228717 20:3872608-3872630 AGGCTGGGCGAGGTGGGGCAGGG + Exonic
1169593919 20:7176720-7176742 GAGCTGTGAGAAGAGGGCCATGG - Intergenic
1170435040 20:16317874-16317896 GGGCTGTGAGAGGAGGAGCCTGG + Intronic
1170655264 20:18280785-18280807 GAGCTGTGAGAGCTTGGAGAAGG - Intergenic
1170742836 20:19073085-19073107 TGGCCATGAGATGTGGGACAGGG + Intergenic
1171950828 20:31420249-31420271 GGGCTGAGAGATGTGGGAAATGG + Intergenic
1171983628 20:31644504-31644526 GGACTGTGGGAGCTGGGCCAAGG - Intronic
1172039956 20:32036822-32036844 GGGCAGGGAGTGGGGGGACAAGG - Intergenic
1172213392 20:33216660-33216682 GGGTTGTGGGAGATGGGAAAAGG + Intergenic
1172443233 20:34979900-34979922 GGGCTGTGAGCGGTGGATCGGGG + Intronic
1172448667 20:35006573-35006595 GTGCTGGGTGAGGAGGGACAGGG + Exonic
1172580950 20:36047457-36047479 GGGTTGGTAGAGGTGGGAAAGGG - Intergenic
1172646571 20:36473957-36473979 GAGCTGTGAGACCTTGGACAAGG + Intronic
1172695409 20:36819351-36819373 GGGGTGTGAGAGGTGGGGGATGG - Intronic
1172764724 20:37345549-37345571 GGGCTGGGGCAGGAGGGACAGGG - Intronic
1172930009 20:38579805-38579827 GGGCTGGGAGAGCTGGGGCATGG - Intergenic
1173732494 20:45338484-45338506 GGGCAGTGAGGGGTGGGAAAAGG - Intronic
1173802967 20:45906386-45906408 CGGCTGTGTGATGTGGGATAAGG + Intronic
1173841275 20:46158658-46158680 GTGCAGTGGGAGGTGGGCCAAGG + Intergenic
1173854720 20:46242664-46242686 GGGCTGAGAGAGTTGGGGCGAGG + Intronic
1174193703 20:48758075-48758097 GGGAGGTGGGAGGTGGGAGATGG + Intronic
1174363228 20:50041229-50041251 GGGCTCTGAGCAGAGGGACAGGG - Intergenic
1174466030 20:50718137-50718159 GAGCTGGGAGAGCTTGGACAGGG - Intergenic
1175012175 20:55749148-55749170 GGCCTGTCAGGGGTGGGGCAGGG + Intergenic
1175127012 20:56760001-56760023 AGGCTGTGGGAGCTGGCACATGG - Intergenic
1175270928 20:57733766-57733788 GGGCAGTCAGGGGTGGGACGAGG - Intergenic
1175335530 20:58193505-58193527 CTCCTGTGAGACGTGGGACAGGG + Intergenic
1175844237 20:62050309-62050331 GAGCGGTGAGTGATGGGACATGG - Intronic
1175893358 20:62325042-62325064 GGGCTGGGGTAGGTGGGAAAGGG + Intronic
1176170936 20:63696118-63696140 GGCCTGTGAGTGGTGCCACAGGG + Exonic
1176238161 20:64063742-64063764 GGGCTCCGAGAGGCGGGACAGGG - Intronic
1176268969 20:64225580-64225602 GGGCTTAGAGAGGTGAGACCTGG + Intronic
1176428388 21:6562332-6562354 AGGCACTGAGAGGTGGGAGAGGG + Intergenic
1176590491 21:8644813-8644835 GGGGAGAGAGAGGTGGGAAAGGG - Intergenic
1177343882 21:19843333-19843355 TGGCAGTGAGTGGTTGGACAGGG - Intergenic
1177614391 21:23498945-23498967 GAGCTGTGAGAGGAGGGCCACGG - Intergenic
1177679147 21:24341433-24341455 GGGCTGGGGGAGGTGGGATGAGG + Intergenic
1178668808 21:34572407-34572429 GGGCTGGTGGAGGTGGCACAGGG + Intronic
1178882346 21:36459611-36459633 GTGCTGTCCGAGGTGGGCCAAGG + Intergenic
1179248154 21:39650888-39650910 GGGGTGGAAGAAGTGGGACATGG - Intronic
1179703878 21:43170648-43170670 AGGCACTGAGAGGTGGGAGAGGG + Intronic
1179826951 21:43971575-43971597 GGGCTGTGGGACGTGGGGCCTGG - Intronic
1180089254 21:45525379-45525401 GGCCCGCGAGAGGTGGGAAAGGG + Intronic
1180273319 22:10621846-10621868 GGGGAGAGAGAGGTGGGAAAGGG - Intergenic
1180964228 22:19777680-19777702 GGGCTGAGAGAGGATGGAGAGGG - Intronic
1181044142 22:20206730-20206752 GGGCTCTGAGATGTGGCACACGG + Intergenic
1181469031 22:23126785-23126807 GGGCTGCGTGAAGTAGGACAAGG - Intronic
1181770231 22:25119876-25119898 GAGCTCAGAGAGGTGGGCCAGGG + Intronic
1182423557 22:30260201-30260223 GGGCAGTGAGAGGTAGGGGATGG + Intergenic
1182550422 22:31098011-31098033 GTGCTGTGTGACCTGGGACATGG - Intronic
1183030808 22:35103061-35103083 GGACTGTGAGGGGTGGGAGGAGG - Intergenic
1183571364 22:38656075-38656097 AGGCTGCCAGAGGTGGGTCATGG + Intronic
1183580813 22:38725622-38725644 GGGCTGTGAGTGTTGGGAGAGGG + Intronic
1184108532 22:42382420-42382442 AGGCTGTGGGAGGTGGAGCAGGG + Exonic
1184257809 22:43296980-43297002 GGGAGGTCAGAGGTGGGAGAAGG + Intronic
1184742094 22:46434472-46434494 GGGCTCTGTGAGGTGGGATTAGG - Intronic
1185326058 22:50226438-50226460 TGTCAGTGAGGGGTGGGACAGGG + Intronic
1185335314 22:50268640-50268662 GGGCTGAGGGCAGTGGGACATGG - Intronic
1185388678 22:50547848-50547870 GGGGTGTGAGGGTTGGGACTGGG - Intergenic
949616030 3:5754669-5754691 GGGGAGTCAGAGGTGGCACAGGG + Intergenic
950161792 3:10765853-10765875 GGGCAGTGGGAAGTGAGACAAGG + Intergenic
950747014 3:15098922-15098944 GTGACGTGAGAGGTGGGAGATGG - Intronic
953145440 3:40270623-40270645 GAGCTGTGGGACTTGGGACATGG - Intergenic
954049789 3:47965010-47965032 GGGCTGGGAGAGGCGGGGAATGG - Intronic
954368536 3:50158405-50158427 GGGCTGGGGGAGGTGGGTCTAGG + Intronic
954372402 3:50175693-50175715 GGGCTGGGAGAGCTGGGGCTGGG + Intronic
954431200 3:50471708-50471730 GGGCTCAGGTAGGTGGGACAGGG - Intronic
954756580 3:52843584-52843606 GGGGTGGGAGAGGTGGCAAATGG + Intronic
954812385 3:53256071-53256093 GGGATGGGAGAGGCGGGGCAGGG + Intergenic
954994482 3:54869055-54869077 GTGATGTGAGTGGTGTGACACGG + Intronic
955387165 3:58489053-58489075 AGGCAGTGAGAGTTGGGAGAAGG + Intergenic
955488061 3:59454755-59454777 GGGCAGGGGGAGATGGGACAGGG - Intergenic
956516951 3:70060313-70060335 GTGCTGTGAGAGCTTGGAGAAGG + Intergenic
957792894 3:84961471-84961493 GGGGTGTGAAAGGTGAGAAATGG - Intronic
958646593 3:96882492-96882514 GAGTGGTGAGAGGTGGGAAAGGG - Intronic
960646998 3:119896801-119896823 GGCAGGTGAGAGATGGGACAGGG - Intronic
960670941 3:120154935-120154957 GGAATGTGAGAAGAGGGACATGG - Intergenic
960785789 3:121371894-121371916 CCGCTGGGAGAAGTGGGACAAGG + Intronic
961662595 3:128477560-128477582 GGGCTGGGGCAGCTGGGACAAGG + Intergenic
963016723 3:140830852-140830874 GGCTTTAGAGAGGTGGGACAGGG - Intergenic
963861260 3:150313028-150313050 GGACTGTGAGAGGCAGGAAAGGG - Intergenic
964412080 3:156408196-156408218 GGGCCCTGAGACGTGGGATAGGG - Intronic
967105546 3:186252240-186252262 GGGCTGTGTCATGTGGGAGATGG + Intronic
967254007 3:187571380-187571402 AGGATGTGAGAGGGGAGACAAGG + Intergenic
967997352 3:195176860-195176882 GTGATCTGAGAGGTAGGACAAGG + Intronic
968092053 3:195904522-195904544 GGGCTGAGAGAGGAGGGAATGGG + Intronic
968445698 4:651081-651103 GGGCTGTCACAGGCGGGGCAGGG + Intronic
968633827 4:1667537-1667559 GGGCTGTGGGAGGTGGCATGTGG - Intronic
968869042 4:3232088-3232110 GGGCTTTCAGAAGTGGGACCTGG + Intronic
968869937 4:3236645-3236667 GGGCTGTGGGAGGGGGGCCGTGG + Intronic
968929978 4:3573633-3573655 GGGGTGTGACACGTGGGAGAGGG + Intergenic
969028535 4:4193311-4193333 GTGCTGTGGGAGATGGGTCAGGG - Intronic
969479904 4:7441988-7442010 GGGCTGTGAGAGGAGGTGGAGGG - Intronic
969480038 4:7442336-7442358 GGGCTGGGAGAGGGGGTAGAGGG - Intronic
969867606 4:10085868-10085890 GGCATTTGAGAGTTGGGACATGG + Intronic
973733326 4:53844891-53844913 GTGCAGTGAGAAGTGAGACAGGG - Intronic
973785539 4:54329355-54329377 GGGTTGGGGGAGGTGGGTCAAGG - Intergenic
975214585 4:71738558-71738580 GAGCTGTGAGAAGAGGGCCATGG + Intergenic
977015944 4:91693507-91693529 GAGCTGTGAGAAGAGGGGCATGG - Intergenic
979279123 4:118844908-118844930 GGGCAGAGAGAGGTGGGTGAGGG + Intergenic
981487023 4:145297566-145297588 GGGCTGGAAGAGATGGGAAAAGG - Intergenic
981756493 4:148145895-148145917 GGGCAGTGGGAGGTGGAAGAAGG + Intronic
983430832 4:167648712-167648734 GGCCTGTGACAGGTGGGAAGAGG - Intergenic
984825809 4:183923797-183923819 GGGCTGTGAGGGGTGTGGCATGG + Intronic
985123706 4:186669278-186669300 GAGCCGTGAGAGGGGTGACAGGG + Intronic
985296791 4:188444725-188444747 GGGCACAGAGAGATGGGACAAGG + Intergenic
985495041 5:199551-199573 GGGCTGGCAGAGGTGGGGCGGGG - Exonic
985668521 5:1194375-1194397 GGGCGGTGGGAGGAGGGAGAGGG - Intergenic
985897329 5:2756463-2756485 GGGCGGGGAGAGGTGCGACCTGG - Intergenic
985977289 5:3430251-3430273 GGGGTGGAAGAAGTGGGACAGGG + Intergenic
986415703 5:7526005-7526027 GGGGTATCAGAGCTGGGACAGGG - Intronic
986415718 5:7526065-7526087 TGGGTGTCAGAGCTGGGACAGGG - Intronic
986707552 5:10464072-10464094 CGGCTGGGACAGGTGGGGCAGGG - Intronic
986753292 5:10810299-10810321 GGTGTGTGAGAGGTAGGACTTGG + Intergenic
986804765 5:11299517-11299539 GGCCTGTGAGAGGTGGGAACGGG - Intronic
987663622 5:20907835-20907857 GAGCTGTGAGAAGAGGGCCATGG + Intergenic
988759063 5:34294354-34294376 GAGCTGTGAGAAGAGGGCCATGG - Intergenic
989068870 5:37490008-37490030 AGGCTGTGGTAGGTGGGACGGGG + Intronic
989141894 5:38209671-38209693 GGGCTGTGGGAGAGGGGAGAGGG + Intergenic
990410275 5:55534816-55534838 GGGCTGTGAGGGGAGGGCCCCGG - Exonic
991189989 5:63859387-63859409 GGTCTGTGAGAGTTGGAAAATGG + Intergenic
992083678 5:73259137-73259159 GGACTGTGATAGGAGGGACAAGG + Intergenic
992617202 5:78556047-78556069 GGTGTGGGTGAGGTGGGACAGGG + Intronic
992716114 5:79513557-79513579 GGGCTGAGGGAGGTGGGATCGGG - Exonic
993010606 5:82478346-82478368 GGGCTGGGAGAAGAGGGATATGG + Intergenic
993899549 5:93575030-93575052 GGGCTGTCAGGGCTGGGACTTGG - Intergenic
994733655 5:103524796-103524818 CCGCTGGGAGAGGTAGGACAGGG + Intergenic
997434626 5:133865437-133865459 TGCCTGTGAGAGGTGGGGGAAGG + Intergenic
997696612 5:135866182-135866204 GGTATGTGGGTGGTGGGACAGGG - Intronic
997878686 5:137571036-137571058 GGGCTGTAGGAGGTGGCTCACGG + Intronic
998023719 5:138794720-138794742 TGGGTGGGAGTGGTGGGACATGG + Intronic
998176938 5:139907289-139907311 GGTATGTGAGGGGTGGGAGAGGG + Intronic
998873433 5:146575597-146575619 GAGCTGTGAGAAGAGGGCCATGG - Intergenic
999400272 5:151258890-151258912 GGGCTGGGAGAGGTGAGAGTGGG + Intronic
999766217 5:154742900-154742922 AGGCTGTGAGATGTAGGAAAAGG - Intronic
1000328281 5:160188417-160188439 GGGCGGTGGGAGGTGGGGGACGG + Intronic
1000564854 5:162834772-162834794 GAGCTGTGAGAAGGGGGCCACGG - Intergenic
1002455728 5:179344726-179344748 GGACTGGGAGGGGTGGAACAGGG + Intronic
1002736435 5:181391384-181391406 GGGTTGGGAGAGGTGGGGGATGG - Intergenic
1002748262 6:83440-83462 GGGTTGGGAGAGGTGGGGGATGG + Intergenic
1002813812 6:659988-660010 GGGCTGTTGGGGGGGGGACACGG + Intronic
1003761935 6:9188497-9188519 TGGCTGTCAGAGGTGGGGGAGGG - Intergenic
1003868710 6:10385096-10385118 GGGCTGGGAGGGGTGGGATGTGG - Intergenic
1003935397 6:10970542-10970564 TGGATGTGACAGGTGGGAAAAGG + Intronic
1003997596 6:11558597-11558619 GGGGAGTGGGAGGTGGGACTTGG - Intronic
1004097950 6:12577936-12577958 GGGATGTGAGATTTGGGAGAAGG - Intergenic
1005039232 6:21587144-21587166 GGGATGGGAGGGGTGGGGCAGGG - Intergenic
1005521726 6:26607481-26607503 GGGCTTTGAGATGTGGGGCTTGG + Intergenic
1005813650 6:29533660-29533682 AGGCTGTGAGAGGCTGGTCAGGG - Intergenic
1005904953 6:30254641-30254663 GAGCTGTGAGAAGAGGGCCACGG - Intergenic
1006640266 6:35486032-35486054 GGGCTGTGGGAGGTCGCACGGGG - Intronic
1007031658 6:38633300-38633322 GGCCAGTGAGAAGTGGGACTGGG - Intronic
1007726076 6:43916415-43916437 GGGCTGTGAGGGGCAGGAAAAGG - Intergenic
1007778597 6:44238007-44238029 GGGCGGCGAGAGGTGCGACGGGG + Intergenic
1008014198 6:46500049-46500071 GGGCTGGGGGAGGTGGGAGTGGG + Intergenic
1010096166 6:72048919-72048941 GGGCTTTGGCAGGTGAGACAGGG + Intronic
1010167361 6:72932216-72932238 GGTGAGTGAGAGCTGGGACATGG + Intronic
1010257148 6:73771148-73771170 GGGATCTGAGGGGTGGGAGATGG + Intronic
1011556743 6:88577341-88577363 GGACTGTAAAAGGTGGCACAGGG - Intergenic
1011558933 6:88595828-88595850 GGGCTGTGAAAGGAGGGGCTGGG + Intergenic
1012148659 6:95718344-95718366 GAGCTGTGAGAAGAGGGCCATGG - Intergenic
1013225570 6:108117791-108117813 GGGCCGGGTGAGGTCGGACAAGG + Intronic
1014808894 6:125863240-125863262 GGGCTGTGAGAGGTCAGGAAAGG - Intronic
1015174827 6:130295685-130295707 GGTCTGGGAGAGGGGGGACAAGG - Intronic
1016989611 6:149920162-149920184 GGACTGTGGGAGGTGGGACAGGG + Intronic
1016993440 6:149944928-149944950 GGACTGCGGGAGGTGGGAGAGGG - Intronic
1017004893 6:150022602-150022624 GGACTGCGGGAGGTGGGAGAGGG + Intronic
1017147928 6:151251461-151251483 GGGCAGTGAGATTTGGCACAGGG + Intronic
1017282902 6:152642465-152642487 GGGCTATGAGAACTGGAACAGGG - Intergenic
1017692165 6:156977871-156977893 AAGCTTTGGGAGGTGGGACAGGG + Intronic
1017713096 6:157187232-157187254 AGGCTGGGAGAAGTGGGGCAGGG + Intronic
1018144611 6:160872744-160872766 GGGCTGGGGGAAGTGGGGCAGGG - Intergenic
1018345209 6:162892623-162892645 GGACTGAGATAGGTGGGACAGGG + Intronic
1018350781 6:162956685-162956707 GGGCTGTGTGAGGAGACACAGGG - Intronic
1019241533 6:170666913-170666935 GGGTTGGGAGAGGTGGGGGATGG - Intergenic
1019404813 7:877684-877706 GGGCAGGGAGATCTGGGACAGGG - Intronic
1019435988 7:1022329-1022351 GGGCTGTGGGACGTGGGACCAGG - Intronic
1019598110 7:1867727-1867749 GGGATGGGAGGGGTGGCACAGGG + Intronic
1019824114 7:3269273-3269295 GAGCTGGAAGAGGTGGGACTGGG - Intergenic
1019963868 7:4483505-4483527 GGGCTCTGAGAGGTGTCCCAGGG - Intergenic
1019991317 7:4693660-4693682 GTGATGGGGGAGGTGGGACAGGG + Intronic
1021875946 7:25049316-25049338 GGGCTGAGAGAAGGGGGAGAGGG - Intergenic
1022665978 7:32410781-32410803 GGCCTGTGAGAGCTGGAACCTGG - Intergenic
1023370302 7:39506338-39506360 GAGCTGGGAGTGGGGGGACAAGG + Intergenic
1023648465 7:42343922-42343944 CGGTGGTGAGAGGTGGGACAGGG - Intergenic
1024050381 7:45617413-45617435 CAGCTGTGATAGGTGGGACTGGG + Intronic
1025198452 7:56948736-56948758 CGGCTGGGAGAGGTGGGGCCTGG - Intergenic
1026348162 7:69492900-69492922 TGGCTGTGAGTGTAGGGACAGGG - Intergenic
1026737604 7:72959120-72959142 GAGCTGGGAGAGGTGGGAAATGG - Intergenic
1026788638 7:73317919-73317941 GAGCTGGGAGAGGTGGGAAATGG - Intronic
1026965260 7:74435317-74435339 GAGCTGTGAGAGGCGGGTGAAGG - Intergenic
1027106129 7:75405948-75405970 GAGCTGGGAGAGGTGGGAAATGG + Intronic
1027731227 7:81875842-81875864 GGGATGAGAGAGGTAGGAGATGG - Intergenic
1028494285 7:91447060-91447082 GTGCTGAGGGAGGTGGGAAATGG - Intergenic
1028896561 7:96048131-96048153 GTCCTGTAAGAGATGGGACAGGG + Intronic
1029112929 7:98222796-98222818 GGGGTGACAGAGGTGGGCCAAGG - Intronic
1029163704 7:98571185-98571207 GAGCTGGGAGAGGTGGGGGAGGG - Intergenic
1029188331 7:98755048-98755070 GGGCTGGGAGGGGCGGGAGAGGG - Intergenic
1029443384 7:100600384-100600406 GGGGTGTGTGAGGTTGGGCAAGG - Intronic
1029503641 7:100949401-100949423 GCGCTGTGGGAAGCGGGACACGG - Intergenic
1029706927 7:102280975-102280997 TGGCTGTGTGATCTGGGACAGGG + Intronic
1029728803 7:102425921-102425943 AGGCTGAGAGAGGCGGGACTGGG + Exonic
1032489761 7:132315617-132315639 GGGGCGTGAGATGTGGGCCAAGG - Intronic
1032839152 7:135700445-135700467 GGGCTTTGAGAGATGTGGCAAGG - Intronic
1033350499 7:140558340-140558362 GGACAGGGACAGGTGGGACAGGG - Intronic
1033365444 7:140670062-140670084 GGGCTGGGCGAGGTGGCTCAGGG - Intronic
1033647261 7:143315254-143315276 GGGAAGGGAGAGGTGGGAAAGGG - Intergenic
1033662672 7:143413151-143413173 GGGCTGTGGGAGGGAGGAAATGG + Intergenic
1035255916 7:157627233-157627255 GAGCTGTGTGAAGTGGGACACGG - Intronic
1035362589 7:158323147-158323169 TGGCTGGGAGAGGCGAGACATGG + Intronic
1035371294 7:158380660-158380682 GAGCTGTGAGAAGAGGGCCACGG - Intronic
1035375024 7:158402054-158402076 GGTCAGGGAGAGGCGGGACACGG + Intronic
1035506583 8:141183-141205 GGGTTGGGAGAGGTGGGGGATGG + Intergenic
1036426460 8:8649434-8649456 TGTCTGTGAGAGGAGGGGCAGGG - Intergenic
1036722392 8:11188802-11188824 GGGCTGGCAGAGGTGGGGCCTGG - Intronic
1037291436 8:17353277-17353299 GGGCTGTGGTAGGTGGGAATGGG + Intronic
1037580054 8:20239752-20239774 GAGCTGAGAGAGGGGGGAGAGGG + Intergenic
1038134285 8:24768838-24768860 CAGCTGTCAGAGGTGGGACAGGG + Intergenic
1038696612 8:29812288-29812310 GGGGTGGGGGAGGTGGGGCAAGG - Intergenic
1039469271 8:37803404-37803426 GGGCGGGGAGAGGAGGGAAATGG + Intronic
1039570325 8:38581313-38581335 GGGCTGTGATTCTTGGGACATGG + Intergenic
1040022686 8:42754921-42754943 GTGCTGGGAGATGTGGGAGAGGG - Intronic
1040938242 8:52804086-52804108 GTGCAGTGAGGGGTTGGACAAGG - Intergenic
1042432768 8:68727471-68727493 GAGCTGTGAGAAGAGGGCCACGG - Intronic
1044443036 8:92243262-92243284 GAGCTGTGAGAAGAGGGCCACGG - Intergenic
1044744741 8:95361377-95361399 GGGCAGAGAATGGTGGGACAGGG + Intergenic
1044778701 8:95721448-95721470 GGGCCGTAAGAGGAGGGAGAAGG - Intergenic
1045048387 8:98300873-98300895 GGGCAGGGAAAGGTGGGAGAAGG + Intergenic
1045080953 8:98625427-98625449 GGGCTTGTAGAGGTGGGACTGGG - Intronic
1045586582 8:103544541-103544563 TGGCTGTAAGAGGTGGGGGAGGG - Intronic
1046464972 8:114589232-114589254 GGGCTGACAGAGGCGGGAAAAGG - Intergenic
1046614675 8:116463253-116463275 GGGCTGTGGGGGATGGGGCAGGG - Intergenic
1047251308 8:123183500-123183522 TGGCTGTGACAGGTGGGATCAGG - Intronic
1047405658 8:124583691-124583713 GGGCTGGGAGAGGTGGTCCAGGG - Intronic
1047646348 8:126874412-126874434 GTGTTGAGAGAGGTGGGAGAAGG + Intergenic
1048117100 8:131535867-131535889 GGGCTGTGAGAAGGAGGAAATGG - Intergenic
1048277805 8:133080472-133080494 TGGCGGGGAGAGGTGGGACGTGG - Intronic
1049220779 8:141427848-141427870 GGGCTGTGAGCGCTGGGGGAGGG + Intronic
1049335041 8:142079803-142079825 GGGCTGTGAGTGAGGGGCCAAGG + Intergenic
1049578707 8:143401169-143401191 GTCCTGTGGGAGGTGGGAAAAGG + Intergenic
1049586059 8:143432854-143432876 TTGCTCTGAGAGGTGGGAGAAGG + Intergenic
1049894279 9:99181-99203 GGGCTGGGAGAAGAGGGAAATGG + Intergenic
1051156474 9:14152849-14152871 GGGTTGTCAGAGGTGGGGGAGGG + Intronic
1051860791 9:21622982-21623004 GGGCTGTGAGAAGAGGGCCACGG - Intergenic
1052104770 9:24499456-24499478 TTGCTGTGAGAAGTGGGAAAAGG - Intergenic
1052842053 9:33300351-33300373 AGGCTGTAACAGGTTGGACACGG - Intronic
1053123868 9:35564078-35564100 GGGACGTGGGAGGTGGGACGTGG + Intergenic
1053215059 9:36264004-36264026 TAGCTGTGAGAGGTAGCACAGGG + Intronic
1053735507 9:41099286-41099308 GGGCTGGGAGAAGAGGGAAATGG + Intergenic
1054455448 9:65427964-65427986 GGGCTTTCAGAAGTGGGAAACGG - Intergenic
1054460116 9:65458192-65458214 GGGGTGTGACACGTGGGAGACGG - Intergenic
1054460138 9:65458275-65458297 GGGGTGTGACACGTGGGAGAGGG - Intergenic
1054460178 9:65458402-65458424 GGGGTGTGACACGTGGGAGAGGG - Intergenic
1054460207 9:65458484-65458506 GGGGTGTGACACGTGGGAGAGGG - Intergenic
1054692870 9:68332115-68332137 GGGCTGGGAGAAGAGGGAAATGG - Intronic
1055592791 9:77835120-77835142 GGGCAGGGTGAGGTGGGATAGGG + Intronic
1056822746 9:89854916-89854938 GGGCTGTAAGAGGTAGGGCTGGG + Intergenic
1057274804 9:93670547-93670569 GGGTTGTGGGCGGTGGGGCAGGG + Intronic
1057568340 9:96184531-96184553 GGGCTGTGTGAGGTGAGTCCTGG + Intergenic
1057845170 9:98517302-98517324 GGGGTGGGAAAGGTGGGACTGGG - Intronic
1058306541 9:103449449-103449471 GAGCTGTGACAAGTGGGAAAGGG + Intergenic
1059330181 9:113530121-113530143 GTTTTGTGGGAGGTGGGACATGG + Intronic
1059390903 9:113999122-113999144 GGGAGGTGAGAGGTGGGGCATGG - Intronic
1060193308 9:121606727-121606749 GGGGTGAGGGAGGTGGGACCAGG + Intronic
1060212562 9:121719498-121719520 CTGCAGTGAGAGGTGGGAAAGGG + Intronic
1061040218 9:128137368-128137390 GGGCTGTAAGAGGTAGGGCTGGG - Intergenic
1061391687 9:130320470-130320492 GGGCCGTGGGAGGTGGGAGGTGG + Intronic
1061413021 9:130431225-130431247 GGGCTGGGAGGGGCAGGACAGGG + Intronic
1061536160 9:131251609-131251631 GGGCGGTGGGGGGTGGGGCAGGG + Intergenic
1061582450 9:131546122-131546144 GAGCTGCCAGAGGCGGGACACGG - Intergenic
1061744483 9:132729431-132729453 TGGCTGGGAGAGGTGGGGCTGGG + Intronic
1061880755 9:133567767-133567789 GGGCTCTGAGGGGAAGGACAGGG - Intronic
1062203432 9:135321373-135321395 GGGCTGGGTGAGGTGGGATGGGG - Intergenic
1062261851 9:135666809-135666831 GGGCAGAGAGGGGAGGGACAGGG - Intergenic
1062433124 9:136534888-136534910 GGGCTCTGTGAGGAGGGACTGGG - Intronic
1062525651 9:136977130-136977152 GGGCTGTGAGATGTGGGTCCTGG + Intergenic
1203601725 Un_KI270748v1:16147-16169 GGGTTGGGAGAGGTGGGGGATGG - Intergenic
1185757196 X:2661383-2661405 GGGATTTGGGAGGTGGGACTGGG - Intergenic
1187270280 X:17774493-17774515 GGGCAGTAAGAGATGGGAGAAGG - Intergenic
1187473185 X:19587326-19587348 GGGCTGGGAGAGGGGGTAAATGG + Intronic
1187928772 X:24275033-24275055 GGGCTGGGGGAGGTGAGACTGGG - Intergenic
1188405513 X:29804276-29804298 GGGCCCGGAGAGGTGGGTCAGGG + Intronic
1188441812 X:30220968-30220990 AGGCTGAGAGGGGTGGAACAGGG - Intergenic
1188719555 X:33505988-33506010 TGGATGTGAGACGTGAGACATGG + Intergenic
1189873099 X:45404836-45404858 TGGCTATGAGAGGTGGGAGTGGG - Intergenic
1190010924 X:46784060-46784082 GGGATGTGAGAGGCGGGTGAGGG - Intergenic
1190597134 X:52061458-52061480 GGGGTGTGGGAGGTGGGTCCTGG + Intergenic
1190611690 X:52192615-52192637 GGGGTGTGGGAGGTGGGTCCTGG - Intergenic
1191105341 X:56768831-56768853 GGGCAGTGTGAGGGGGTACAGGG + Intergenic
1191106334 X:56774233-56774255 GGGCAGTGTGAGGGGGTACAGGG + Intergenic
1191107327 X:56779635-56779657 GGGCAGTGTGAGGGGGTACAGGG + Intergenic
1191109672 X:56794642-56794664 GGGCAGTGTGAGGGGGTACAGGG + Intergenic
1191791321 X:64975541-64975563 GGGCTGTGTGGGCTGGCACAAGG - Intronic
1192446524 X:71215304-71215326 GGGCTGAGGGAGGTGGGCCAGGG + Intronic
1192595294 X:72400784-72400806 GGGGGGTGAGAGGTGGGTAATGG - Intronic
1193037847 X:76972763-76972785 GGGCTGTGGGAGGCAGGGCAGGG + Intergenic
1193397311 X:81000708-81000730 GGGTTGGTAGAGGTGGGAAAAGG - Intergenic
1194366302 X:93018604-93018626 GGGCTATGAAAGCTGGCACAAGG - Intergenic
1194794643 X:98196583-98196605 GGACTGTGAGAAGTGGGTGAGGG - Intergenic
1194820225 X:98496763-98496785 GGTCTAAGAGAAGTGGGACAGGG - Intergenic
1195892773 X:109713464-109713486 GGGAAGTGAGAGATGGGACAGGG + Intronic
1196465666 X:115969237-115969259 GGGCCGGGAGAGGTGGGCTACGG + Intergenic
1196483898 X:116181878-116181900 GGGCTATGAGAGCCAGGACAGGG + Intergenic
1197211958 X:123835480-123835502 GAGAGTTGAGAGGTGGGACATGG - Intergenic
1197710702 X:129665092-129665114 GCACTGTGACAGGAGGGACATGG - Intergenic
1197950794 X:131894225-131894247 GGCCTGTCGGGGGTGGGACATGG + Intergenic
1198934744 X:141894817-141894839 GGGCAGGGAGAGGTGGGCGAAGG + Intronic
1199601944 X:149546301-149546323 GTGCTGTGAGTGGTGGGGCTGGG - Intronic
1199648442 X:149933183-149933205 GTGCTGTGAGTGGTGGGGCTGGG + Intronic
1200102414 X:153694638-153694660 GGGCTGGGGGAGGTGGGGCAGGG + Intronic
1200129162 X:153831531-153831553 GGGCTGTGAAAGCGGGGACCGGG - Intergenic
1200674527 Y:6134866-6134888 GGGCTATGAAAGCTGGCACAAGG - Intergenic