ID: 906780965

View in Genome Browser
Species Human (GRCh38)
Location 1:48572674-48572696
Sequence ACCCCCCCTTCAGTTCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906780965_906780971 30 Left 906780965 1:48572674-48572696 CCTGGGAGAACTGAAGGGGGGGT 0: 1
1: 0
2: 1
3: 13
4: 155
Right 906780971 1:48572727-48572749 GCTCAAGCCCTCCAGAGCATAGG 0: 1
1: 0
2: 0
3: 9
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906780965 Original CRISPR ACCCCCCCTTCAGTTCTCCC AGG (reversed) Intronic
900342531 1:2195600-2195622 ACCCCTCCTGCAGGGCTCCCTGG + Intronic
901502289 1:9660325-9660347 TCCCTGCCTTCAGTTCTCTCAGG + Intronic
902919417 1:19657273-19657295 CCCGCCCCTTCAGATCTCCATGG - Exonic
903187498 1:21637051-21637073 CCCACACCTTCAGATCTCCCTGG - Intronic
904052618 1:27648865-27648887 ACACCCTCTTTAGTTCTGCCAGG - Intergenic
905264123 1:36739382-36739404 TCCCTCCCTCAAGTTCTCCCAGG + Intergenic
906780965 1:48572674-48572696 ACCCCCCCTTCAGTTCTCCCAGG - Intronic
906953703 1:50355034-50355056 ACCTGACCTTCTGTTCTCCCTGG + Intergenic
908787902 1:67753524-67753546 GCCCCCGCTTCAGTTCTGGCTGG - Intronic
913112190 1:115666606-115666628 TGCCACCTTTCAGTTCTCCCTGG - Intronic
913198367 1:116476187-116476209 ACCCCCCCATCAGGGCTCCTTGG - Intergenic
915165952 1:153947896-153947918 GCCCTCCCTTGAGTTCCCCCAGG + Exonic
915518118 1:156425250-156425272 ACCCCACCCTGAGTTCTTCCAGG + Intronic
917073892 1:171183297-171183319 ATCCCCACATCAGTTATCCCTGG + Intergenic
920730623 1:208480466-208480488 ACTCCCCATTCAGTTGTCCTTGG - Intergenic
922349164 1:224721816-224721838 ATCCCCCCTCCAGTTCTGGCCGG - Intronic
922624596 1:227026152-227026174 GCCCCCCCTTCCCTTCTCCCAGG - Exonic
922696537 1:227733751-227733773 ACCCCTCCTTCAGTTGGACCAGG - Intronic
923486300 1:234434704-234434726 TCCCCAGCTTCAGTTCTGCCAGG - Intronic
924612882 1:245588516-245588538 ACCCGTCCTTCACTTCACCCAGG + Intronic
1062845460 10:700019-700041 ACTCCCCCGTCTGTTCTCCAGGG - Intergenic
1063015479 10:2072555-2072577 ACCCGCTCTTCATTTCTTCCTGG + Intergenic
1068930961 10:62589679-62589701 ACCCCCCTTTCATTTCTACCAGG - Intronic
1073008237 10:100340717-100340739 TCCCCCACCTCAGTGCTCCCAGG + Intergenic
1074418044 10:113284566-113284588 ACCCCCTCATCAGTTCTTCCTGG - Intergenic
1076790750 10:132775522-132775544 GCCCCTCCTGCATTTCTCCCTGG + Intronic
1079590523 11:22177589-22177611 ACCCCCACATCCCTTCTCCCAGG - Intergenic
1083433981 11:62630276-62630298 AGCCACCCTTAACTTCTCCCAGG - Exonic
1084552282 11:69851938-69851960 ACCCCGCCTTCCTTTCTGCCTGG + Intergenic
1090363394 11:126188198-126188220 TCCCCGGCTTCAGCTCTCCCTGG - Intergenic
1091436275 12:475498-475520 ACCCCACCTCCGGTTCTGCCGGG - Intronic
1097191716 12:57222588-57222610 GCCCACCCTTCAGCTTTCCCAGG + Intronic
1098503080 12:71217047-71217069 ACCCCCCGTGGAGTTCTCCGTGG - Intronic
1099584798 12:84503200-84503222 ACCCCCACTCCAGTACACCCAGG - Intergenic
1100461260 12:94801576-94801598 ACCTGCCATTCAGTTCTCTCTGG - Intergenic
1101904518 12:108814792-108814814 ACCCCGACTTCAGTTCTCCCAGG - Intronic
1103703525 12:122859834-122859856 AGCCCCCCTTCTGTCCCCCCAGG + Intronic
1113308776 13:109108878-109108900 ACTCTCCTGTCAGTTCTCCCAGG - Intronic
1114701480 14:24682621-24682643 CTCTCCCCTTCAGTTCTCCGAGG - Intergenic
1115109115 14:29800181-29800203 ACCCACCCTGTATTTCTCCCAGG + Intronic
1118805390 14:69232122-69232144 TCCCTCCCTTCAGTTTTGCCTGG + Intronic
1119209811 14:72823215-72823237 AACCTCCCTCCAGTTCTCCAAGG + Intronic
1121267364 14:92612967-92612989 ACACCCCCTTCTGTGCCCCCTGG - Intronic
1121884324 14:97529209-97529231 ACCACCCCATCAGTGCTTCCTGG + Intergenic
1122859121 14:104574400-104574422 ACCCCCCACTCAGGGCTCCCTGG - Intronic
1123075293 14:105664860-105664882 ATCCGCCCTTCAGTCCACCCAGG + Intergenic
1126939010 15:53745171-53745193 ATACCCCCATCAGTTCTCCAAGG - Intronic
1127122946 15:55786848-55786870 ACTCCCTCTTCAGCTCTCCAGGG + Intergenic
1128579269 15:68797579-68797601 CCCCACCCATCAGTGCTCCCTGG + Intronic
1130353342 15:83109621-83109643 TCCCTCCTTTCAGTTCTCCCTGG + Intronic
1131008954 15:89001558-89001580 ACCCCCCCTGCATTTCACCATGG + Intergenic
1131302284 15:91210234-91210256 ACCTCCCCATCATTTCTCACTGG - Intronic
1132498371 16:274324-274346 ACCCCACCCTCAGACCTCCCTGG + Intronic
1132941538 16:2510919-2510941 ACACCCCCTTCAGGCCTCTCTGG - Intronic
1133216787 16:4297356-4297378 AGCCCCCTTTCTGTTCTCCTAGG - Intergenic
1133280787 16:4664036-4664058 ACCGCGTTTTCAGTTCTCCCGGG - Intronic
1133799114 16:9070571-9070593 ATCCCTCCTTCACTTCCCCCTGG + Intergenic
1137530377 16:49275558-49275580 CACACCCCGTCAGTTCTCCCAGG - Intergenic
1138595682 16:58027785-58027807 GCTCCTCCTTCAGCTCTCCCTGG - Intronic
1140954535 16:79849734-79849756 ACCCCCTCTTCCGTTTCCCCAGG - Intergenic
1142900359 17:3007785-3007807 ACTCCCCCTGCCCTTCTCCCTGG - Intronic
1144212125 17:13024561-13024583 GCCCTGCCTCCAGTTCTCCCGGG + Intergenic
1147652482 17:42070487-42070509 ACCCACCCTGCCTTTCTCCCAGG - Intergenic
1148108907 17:45133440-45133462 ACCCCATCCTCAGATCTCCCAGG + Intronic
1148317188 17:46712327-46712349 AACCCCACTTCAGTCCTCCAAGG + Intronic
1148615277 17:48996547-48996569 CCTCCCCCTTCAGTTCGCTCCGG + Intergenic
1149540868 17:57467201-57467223 ACCCACCTGACAGTTCTCCCAGG - Intronic
1149661949 17:58338563-58338585 GGCCTCCCTTCAGTTCTCCATGG - Intergenic
1153926502 18:9839498-9839520 ACCCCCTCTTCGCTTCTCACAGG - Intronic
1160303560 18:77708949-77708971 ACCCCCCATTTTGTTCTCCCGGG + Intergenic
1160799317 19:960458-960480 ACCCCCACTTCACTGCACCCTGG - Intronic
1161241966 19:3227792-3227814 ACCCCCCCTGCCTTCCTCCCAGG + Intronic
1161405513 19:4089264-4089286 CCTCCCCCTTCAGTACTTCCTGG - Intergenic
1163003730 19:14384501-14384523 CACCCCCCTTCAGGTCTCCCTGG + Intronic
1163536472 19:17879659-17879681 ACCCCATCTGCAGTCCTCCCTGG + Intronic
1166214189 19:41325137-41325159 ATCCCCCTCCCAGTTCTCCCGGG + Intronic
1167037885 19:47005078-47005100 GGCCCCCCTTCACTTCTCTCAGG - Intergenic
1167307027 19:48715234-48715256 ACACCCACTTCTGTTCTCCCGGG - Intronic
1167605738 19:50480568-50480590 ACTCCCCCCACAGTGCTCCCTGG + Exonic
925745147 2:7037842-7037864 ACTCAGCCTTCACTTCTCCCTGG - Intronic
928219897 2:29395031-29395053 GCCCCCACTTCAGAGCTCCCGGG + Intronic
934609391 2:95723305-95723327 ACCCCCACAACAGTTTTCCCAGG + Intergenic
934963102 2:98694931-98694953 CCCCCCCCTTCCGATCTGCCTGG + Intronic
936027856 2:109047086-109047108 GCTCCTCCTTCAGCTCTCCCTGG + Intergenic
936345329 2:111671376-111671398 TCCCACCCTTCACTTCTCCATGG - Intergenic
941291081 2:163675930-163675952 CCCCTCCCTCCAGCTCTCCCAGG - Intronic
944108398 2:196104179-196104201 GCCAGCCCTTCAGTTGTCCCAGG - Intergenic
944487317 2:200220726-200220748 GGCTCCCCTTCAGGTCTCCCAGG + Intergenic
946310255 2:218879238-218879260 CCCCCTCCTTCAGTTCCCCAGGG + Intergenic
947869291 2:233424053-233424075 ACCCCCTCTTCACTTTTCACGGG - Intronic
948067561 2:235092446-235092468 ACCCCACGTTCAGTTCTCTTAGG + Intergenic
948079062 2:235190617-235190639 ACCCTGCCTTGAGTTCTGCCTGG + Intergenic
1171123060 20:22582248-22582270 GCGTCCCCTTCAGCTCTCCCAGG + Exonic
1171221547 20:23402509-23402531 ACCCCACTTTCAGTTCTCAGTGG + Intronic
1172777025 20:37413731-37413753 ACCCCCAATTCAGGTCTCCCAGG + Intergenic
1173059146 20:39645234-39645256 CCCACCCCTTCAGCTCCCCCAGG - Intergenic
1173982895 20:47238728-47238750 GCCTCCCCTTCTGTTCTCCGTGG - Intronic
1175074423 20:56360843-56360865 ACCCTCCCTGCACTGCTCCCAGG - Intronic
1175618510 20:60423668-60423690 GCCCCATCTTCAGCTCTCCCTGG + Intergenic
1179642943 21:42759096-42759118 AACCCGCCTTCGGTTCTTCCTGG + Intronic
1179932487 21:44579622-44579644 ACCCCCCCCTCCATACTCCCAGG - Exonic
1180789061 22:18564276-18564298 ACACCCCATGCACTTCTCCCTGG - Intergenic
1181769066 22:25112508-25112530 TCCTCCCCTCCAGTCCTCCCAGG + Intronic
1182150073 22:28021526-28021548 TCCCCCCCTGCAGCTCACCCAGG - Intronic
1183279435 22:36924122-36924144 CCACCGCCTTCAGTTCTCCAGGG + Intronic
1183284176 22:36952195-36952217 CCACCACCTTCAGTTCTCCTGGG - Intergenic
1184414425 22:44343939-44343961 ACCCCCCTCTCAGTACTCACTGG + Intergenic
950171111 3:10839617-10839639 CCCCCTTCTTCAGGTCTCCCAGG + Intronic
953383066 3:42488789-42488811 ACCTCCCCCTCAGTCCTGCCAGG - Intergenic
954683932 3:52360460-52360482 ACCCTCCCTCTAGTTCTCTCTGG + Intronic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
965701194 3:171460484-171460506 ACTCCCCCTTCACTCCTCCCAGG - Intergenic
966866356 3:184260932-184260954 TCCCCCTCTTCCCTTCTCCCGGG - Intronic
969425539 4:7121866-7121888 ACCCCCTCTTCAGGCCTTCCTGG - Intergenic
969705853 4:8791148-8791170 TCCCTCACTTCAGTTCTCCAAGG + Intergenic
975800853 4:78057901-78057923 CCCCCACCTTCAGTGCGCCCGGG + Exonic
976149988 4:82081953-82081975 CCTCCTCCTCCAGTTCTCCCAGG + Intergenic
978140568 4:105313208-105313230 ACCCCTGCTTCAGCTCTCGCTGG + Intergenic
979652192 4:123148379-123148401 ACCCACTCTTCACTACTCCCCGG - Intronic
980093308 4:128464553-128464575 ATCCCTCCTCCAGTTCCCCCTGG + Intergenic
981892562 4:149755520-149755542 ACCAACCCTTCACTTCTCCCAGG + Intergenic
986160474 5:5223475-5223497 ATCCCCCCTTAAGTAGTCCCCGG - Intronic
987162368 5:15157470-15157492 ACCTCCCCTTGAGTTTTGCCAGG - Intergenic
989452082 5:41598202-41598224 ACTGACACTTCAGTTCTCCCTGG - Intergenic
993743066 5:91563424-91563446 AAACCACCTTCAGGTCTCCCAGG - Intergenic
998151307 5:139759035-139759057 ATCTCCCCTTCAGTACTACCTGG - Intergenic
999622331 5:153485925-153485947 ACCCACCCTGGAGTTCTGCCAGG - Intergenic
1000388546 5:160699516-160699538 GCCCCCACCTCAGTTCTTCCGGG - Intronic
1001243151 5:170085521-170085543 ACCCCACCTTCATTTTTCCCAGG - Intergenic
1003251501 6:4432628-4432650 TCACCTCCTTCAGTTCTTCCTGG + Intergenic
1004880543 6:20003087-20003109 AGCCCCACTCCACTTCTCCCAGG + Intergenic
1006019649 6:31110530-31110552 GCCCTCCCTTCGGTTTTCCCAGG - Intergenic
1006719025 6:36138280-36138302 ACCCCACCATCACTTCACCCGGG - Intronic
1006929917 6:37681325-37681347 CCCCCCTCTTCAGGTCTCCTAGG + Intronic
1007702456 6:43772925-43772947 ACCGCCCCTCCTGTGCTCCCTGG + Intronic
1019714159 7:2530689-2530711 ACCCCTGCTTCCGTTCTGCCAGG + Intergenic
1020092371 7:5348907-5348929 TCCCCCACATCAGGTCTCCCTGG + Intronic
1022494066 7:30842362-30842384 ACCCTGCCATCAGCTCTCCCTGG + Intronic
1023336267 7:39174112-39174134 AGGCTCCCTTCAGTTCACCCTGG + Intronic
1023513340 7:40976601-40976623 ACCCCTCCTTCAATTTTTCCAGG + Intergenic
1023897206 7:44443835-44443857 GCCCCATCTTCAGTTCTCCTGGG + Intronic
1025763446 7:64416975-64416997 ACCCCCCATTCATTTTTCCAAGG - Intergenic
1026943673 7:74303061-74303083 ACCCTCCCATCAGCTCTCCCAGG + Intronic
1033409737 7:141106468-141106490 ACCCACCCTTCATTTCCCCTAGG + Intronic
1041096153 8:54352062-54352084 ACCCGCCCCGCACTTCTCCCTGG + Intergenic
1042489550 8:69381671-69381693 ACCCCTGCTTGTGTTCTCCCTGG + Intergenic
1043387130 8:79759471-79759493 CCCCCACCTTCACTACTCCCAGG - Intergenic
1045225491 8:100240424-100240446 ACCTCCCCTGCAGGTCTTCCAGG - Exonic
1048737755 8:137520511-137520533 AGCCTCCCTTCACTTCACCCAGG + Intergenic
1048817690 8:138349129-138349151 AAACCCCCTTCAGTTCACCTGGG + Intronic
1049013047 8:139900361-139900383 ACCAACCCTTCTGTCCTCCCTGG + Intronic
1050857768 9:10382927-10382949 ACCGTCCCTTTAGTTCTCCAAGG + Intronic
1050978064 9:11967248-11967270 ACCCACACTCCAGTTCTCCTTGG + Intergenic
1052049030 9:23824632-23824654 ACCACCCCTTCCGCCCTCCCCGG + Intronic
1053449362 9:38180281-38180303 TCCCTCCCTTCACTGCTCCCAGG + Intergenic
1055018165 9:71641458-71641480 ACCCCCTCTCCAGTCATCCCGGG - Intergenic
1056766564 9:89447787-89447809 ACCACCACTTCAGTGCTCCCTGG + Intronic
1058067808 9:100568174-100568196 ATCATCCCTGCAGTTCTCCCTGG - Intronic
1060109959 9:120899819-120899841 ATCCCCTCCTCAGTTCCCCCAGG + Intergenic
1060834036 9:126741456-126741478 ACCCCCTCTCCATGTCTCCCAGG - Intergenic
1061002952 9:127912731-127912753 ACACCCCCTGCAGCTCCCCCTGG + Intronic
1061205652 9:129161670-129161692 AACCTCCCTGCAGATCTCCCTGG - Intergenic
1185644833 X:1609274-1609296 GCCGCCCCCTCCGTTCTCCCAGG - Intergenic
1186495729 X:10011896-10011918 AGCCCCACTTCTGTTCTCTCAGG + Intergenic
1186881955 X:13875287-13875309 ACCCCTCATTCAGCTCTGCCTGG - Intronic
1187328195 X:18311437-18311459 ACCCCTCCTACATTTCTCTCTGG - Intronic
1189961140 X:46325886-46325908 TCCCCGCCTCCATTTCTCCCTGG - Intergenic
1192809823 X:74537790-74537812 AACCCACATTCAGTTCCCCCCGG - Intergenic
1195059036 X:101176349-101176371 ACCTCCCCTACTGTTCTCCGTGG + Intergenic
1200326814 X:155249141-155249163 ACCCCCCTTTCATTCTTCCCTGG + Intergenic