ID: 906781562

View in Genome Browser
Species Human (GRCh38)
Location 1:48577232-48577254
Sequence TATTATATGCATAAGTTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 267}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906781556_906781562 12 Left 906781556 1:48577197-48577219 CCCACACTTGTGCAATAAGAAGG 0: 1
1: 0
2: 0
3: 9
4: 124
Right 906781562 1:48577232-48577254 TATTATATGCATAAGTTGAAGGG 0: 1
1: 0
2: 2
3: 18
4: 267
906781558_906781562 11 Left 906781558 1:48577198-48577220 CCACACTTGTGCAATAAGAAGGT 0: 1
1: 0
2: 0
3: 6
4: 151
Right 906781562 1:48577232-48577254 TATTATATGCATAAGTTGAAGGG 0: 1
1: 0
2: 2
3: 18
4: 267
906781555_906781562 28 Left 906781555 1:48577181-48577203 CCACTTTTGGGCTCTTCCCACAC 0: 1
1: 0
2: 2
3: 21
4: 172
Right 906781562 1:48577232-48577254 TATTATATGCATAAGTTGAAGGG 0: 1
1: 0
2: 2
3: 18
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906781562 Original CRISPR TATTATATGCATAAGTTGAA GGG Intronic
901981596 1:13039277-13039299 TAATTTTTGCATAAGGTGAAAGG + Intronic
902000486 1:13189636-13189658 TAATTTTTGCATAAGGTGAAAGG - Intergenic
902019730 1:13335403-13335425 TAATTTTTGCATAAGGTGAAAGG - Intergenic
902385914 1:16075840-16075862 CTTTATATGCATCTGTTGAACGG - Intergenic
906781562 1:48577232-48577254 TATTATATGCATAAGTTGAAGGG + Intronic
907059134 1:51403221-51403243 TTTTATATGTATAAATTCAAGGG + Intronic
909244167 1:73255934-73255956 TTTTACATGCAGAAGCTGAAAGG + Intergenic
909440712 1:75692504-75692526 GATTCTATGCAGAAGTAGAAGGG + Intergenic
912141788 1:106738886-106738908 GACTTTTTGCATAAGTTGAAAGG + Intergenic
912535393 1:110364820-110364842 TTTTAAAAGCATAAGTTGGAGGG + Intronic
912602674 1:110953474-110953496 TATTATATGTATGGGTTGATAGG - Intronic
912674563 1:111666370-111666392 TAATATATGCACATGTTGCATGG - Intronic
913036753 1:114974301-114974323 GTTGATATGCATAAGTTGAATGG + Intronic
913232922 1:116756613-116756635 TAGTATATGGACAAATTGAATGG - Intronic
914092200 1:144511663-144511685 TTTCATATACATAGGTTGAATGG + Intergenic
917160171 1:172048503-172048525 TATTACATGCTTAATTTAAATGG + Intronic
917318255 1:173751798-173751820 TATTATATCAATGAGTTGATTGG - Exonic
917986851 1:180329034-180329056 AATTATATGCAAAAGTTTACAGG - Intronic
918391704 1:184071091-184071113 TATTATATGAATCAATTAAATGG - Intronic
919022206 1:192121131-192121153 TATTATATGGCAAAGTTGATGGG - Intergenic
919238510 1:194878915-194878937 TTTAATATGACTAAGTTGAAAGG - Intergenic
924919104 1:248607480-248607502 CATAATTTGCATAAATTGAACGG - Intergenic
1064591441 10:16896127-16896149 AATGATATGGAAAAGTTGAAAGG - Intronic
1064873619 10:19967960-19967982 TATTATGTGCATTAGCTGAAAGG + Intronic
1065352504 10:24808047-24808069 AATTATATGGAGAAGTAGAATGG + Intergenic
1067130004 10:43555290-43555312 TCTTCTCTGCAGAAGTTGAATGG - Intergenic
1068181912 10:53532174-53532196 TATTAGAAACAGAAGTTGAAAGG + Intergenic
1069087299 10:64156040-64156062 TATTGGATTCATAAATTGAATGG + Intergenic
1069297198 10:66861076-66861098 TATTGTATGAATAACTTTAAAGG - Intronic
1073704097 10:105962521-105962543 TATTATATGGATACGCTAAAGGG - Intergenic
1074093877 10:110290284-110290306 CTTTATATACATAAGTTAAAAGG + Intergenic
1074324101 10:112431035-112431057 TATTATAAGCACAGTTTGAAGGG + Intronic
1074328638 10:112479676-112479698 GATTATTTTCAGAAGTTGAATGG - Intronic
1079107203 11:17579202-17579224 TAATCTCTGCATAAGCTGAAGGG - Intronic
1080207336 11:29745349-29745371 TATTATATGCATATATTGATAGG + Intergenic
1080594802 11:33762046-33762068 TATTATATGAAAAAGGTGAAGGG - Intronic
1081378903 11:42391110-42391132 TATTATATGTGTTTGTTGAAAGG + Intergenic
1082697483 11:56387373-56387395 TATTTTATTTTTAAGTTGAAAGG - Intergenic
1086046061 11:82533524-82533546 TATTTTATGCATAATTTGTTGGG + Intergenic
1086046964 11:82544278-82544300 TATTATATTCAAAATCTGAAAGG - Intergenic
1086659788 11:89401194-89401216 TATTATATGCAGAAGAGGCATGG - Intronic
1086924791 11:92628538-92628560 TATTATTCTCATAGGTTGAATGG + Intronic
1087292219 11:96332127-96332149 TATTATATGCTAAAGTAGCATGG + Intronic
1087489529 11:98806591-98806613 TATTATTTGTATAAATTTAAAGG + Intergenic
1087577963 11:100013324-100013346 TATTATTTGTATAAGTTTATGGG - Intronic
1087732134 11:101790693-101790715 TATAATATAAATATGTTGAATGG + Intronic
1087869106 11:103269754-103269776 TATTATAAACATAAGTTTTAGGG - Intronic
1088545060 11:110950872-110950894 TATTTTATGAATAATTTGATCGG - Intergenic
1089275009 11:117328737-117328759 TATTAGATGAATAAATTAAAGGG - Intronic
1090469146 11:126963990-126964012 TGTAATATGGATAAGTTGAGTGG - Intronic
1092330671 12:7584012-7584034 TATTATATGCTACAGTTGATAGG - Intergenic
1093424436 12:19012070-19012092 TATTATTTGTATAAATTTAAGGG - Intergenic
1094212477 12:27906809-27906831 TATTATATGAATAAATGGAGAGG + Intergenic
1094751175 12:33410230-33410252 TATTATGTGCATTAATAGAATGG + Intronic
1095301369 12:40588428-40588450 TATTATATACATTAGTTGCTGGG - Intergenic
1095486595 12:42691310-42691332 TAATTTATGGATAAGGTGAAAGG + Intergenic
1097241616 12:57579342-57579364 TATTTTATGAATTAGTTAAAAGG - Intronic
1098998929 12:77154149-77154171 TAACATATTCATAAGTTGCAGGG - Intergenic
1099300505 12:80888660-80888682 AATTAAATTCATTAGTTGAATGG + Intronic
1100571450 12:95846959-95846981 TATTATAAACATCAGTTTAAAGG + Intergenic
1101485394 12:105152862-105152884 CATTATATGCACAAGTAAAATGG - Intronic
1104593626 12:130104467-130104489 TAATACGTGCATAGGTTGAAAGG - Intergenic
1107353024 13:39536036-39536058 CATTGAATGTATAAGTTGAATGG - Intronic
1108830251 13:54468853-54468875 TATTATATGATGAAGATGAAGGG + Intergenic
1110755553 13:79169728-79169750 TATTATTTGTATAAATTTAAAGG - Intergenic
1110856985 13:80307721-80307743 TATTATTTGAATAAGTTGTCTGG + Intergenic
1110989129 13:82014669-82014691 TATTTTATGCATAAATAGAGAGG + Intergenic
1111043000 13:82775479-82775501 TATTATTTGCATAGTTTGACTGG + Intergenic
1111585364 13:90277087-90277109 TATTATTTGTATAAGTTTATAGG + Intergenic
1111694020 13:91600723-91600745 CATTATATGCATTATTTTAATGG - Intronic
1113025617 13:105937929-105937951 TATTAAATACATCAGATGAAAGG + Intergenic
1115083228 14:29482980-29483002 TAGTATTTGCTTAAATTGAAAGG - Intergenic
1115322027 14:32092288-32092310 TCCTATATGCTTAAGTAGAAGGG - Exonic
1115965740 14:38885413-38885435 AATTATATGAATAAGTGGCAAGG + Intergenic
1116241289 14:42346496-42346518 TATTATATGCTTCATGTGAAAGG + Intergenic
1117306406 14:54479579-54479601 TATTTTTTGAATAAGTTGATTGG - Intronic
1118093298 14:62507272-62507294 TGTCATATGGATAAGTTGCAGGG - Intergenic
1118303941 14:64638970-64638992 TTTTATTTGCATAAATTTAAGGG - Intergenic
1119066431 14:71532093-71532115 TATAATATGTATAAATTAAAGGG - Intronic
1120968516 14:90188380-90188402 TATTTTATGTATGAGTTGACTGG + Intergenic
1124791868 15:32735213-32735235 TATTATATATCTAAGTAGAAAGG - Exonic
1125000157 15:34761229-34761251 TATTTTATGCAGAAGTGGGATGG + Intergenic
1126270503 15:46811866-46811888 TATTTTAATGATAAGTTGAAAGG - Intergenic
1126872934 15:53009125-53009147 TATTATATGGCAAAGGTGAATGG + Intergenic
1128040765 15:64571367-64571389 TATTATATGAATAGATTAAATGG + Intronic
1128100800 15:64998243-64998265 TACTTTATGCTTTAGTTGAAAGG - Intergenic
1128846718 15:70904869-70904891 AATTATTTGAATTAGTTGAATGG + Intronic
1130358514 15:83158164-83158186 TAATATGTGCCTAACTTGAAGGG - Intronic
1131921900 15:97337212-97337234 TAGAATTTGCATAAGTTAAATGG + Intergenic
1132171486 15:99661338-99661360 TATCATATGGATAACTGGAAAGG + Intronic
1140700408 16:77576111-77576133 AATTATTTGCATGACTTGAAAGG - Intergenic
1145048911 17:19643920-19643942 TATCATATTCAAAAGCTGAAGGG + Intergenic
1148187588 17:45655859-45655881 TATTATATGCAAAACTTTATGGG + Intergenic
1149543537 17:57486525-57486547 TATTATTTGCATAAAACGAAAGG - Intronic
1149553263 17:57555513-57555535 TAATATGTGCAAAAGTTGACAGG - Intronic
1149957686 17:61071014-61071036 CAGTATATGCATAAGTTAAAGGG - Intronic
1150992575 17:70276981-70277003 TATTATATAAACAAGATGAACGG - Intergenic
1151094554 17:71481163-71481185 TATTATATGAATGAGTTTGAGGG - Intergenic
1153499604 18:5734788-5734810 TTTTATTTGCATAAATTTAAAGG - Intergenic
1153594671 18:6712829-6712851 TATTCTATTGTTAAGTTGAATGG - Intergenic
1155755169 18:29484619-29484641 CATTATATTCATAGTTTGAAAGG + Intergenic
1156009276 18:32477336-32477358 TGTGATATACATATGTTGAATGG + Intergenic
1156215257 18:34991427-34991449 TATTATTTGCCTTATTTGAAAGG + Intronic
1156224175 18:35086623-35086645 AATTATATGTAAAAATTGAAAGG - Intronic
1156965917 18:43092005-43092027 TATTTTATGGATAATTTTAACGG + Intronic
1156969306 18:43135592-43135614 TATAATATGCCTATGTAGAAAGG - Intergenic
1157624062 18:49034333-49034355 CATTAGATTCATAAGTTGGAAGG - Intergenic
1160022910 18:75194324-75194346 AAGTATATGTACAAGTTGAAAGG + Intergenic
1160549331 18:79683343-79683365 TGTTATTTGCATAATCTGAAAGG - Intronic
1166968993 19:46549729-46549751 TATTATTTGTATAAATTTAAGGG + Intronic
924975443 2:169976-169998 TATTGTATTCATAAAATGAAGGG + Intergenic
925801791 2:7609222-7609244 TATAATATTCATAATTGGAAAGG - Intergenic
926358234 2:12060892-12060914 TATTATAGCCATAATTAGAAAGG - Intergenic
927197257 2:20557019-20557041 TATTACATGCAAAATTAGAAAGG - Intergenic
928959932 2:36913696-36913718 TATCATATTTATAAGATGAATGG + Intronic
929170849 2:38931980-38932002 TTTTCTATGCTTAAGATGAATGG + Intronic
929388884 2:41444639-41444661 TGTTATATGCATAAATAGGATGG + Intergenic
930471084 2:51814563-51814585 TATTATATACATCAGGTTAATGG + Intergenic
931100847 2:58999149-58999171 TATAATATGCAGAAGCTAAAGGG + Intergenic
931384870 2:61789362-61789384 TATTTTATTCATAAAATGAAGGG + Intergenic
936605061 2:113943796-113943818 TATTATATGCATCTTTTAAAAGG + Intronic
941394086 2:164952846-164952868 TATTATATGCAGAAATTGAAGGG - Intronic
942492585 2:176504857-176504879 TACTATATACATATGGTGAATGG + Intergenic
942977551 2:182037065-182037087 TATTTTATGTATATGTTTAATGG - Intronic
943165520 2:184319358-184319380 CATTATATGCTTATGTTGTAAGG - Intergenic
943941613 2:194004813-194004835 CATTATTTGCATAATTTTAAAGG + Intergenic
944078103 2:195754815-195754837 TGTTGTATTCAAAAGTTGAAAGG - Intronic
945433188 2:209789613-209789635 TATTATAATCATAAGAAGAAGGG + Intronic
945500981 2:210574792-210574814 TATTGTAAGCATATGTTTAAAGG + Intronic
1169398396 20:5257272-5257294 TATTATATTCATAGTTTGGAAGG + Intergenic
1169589842 20:7128323-7128345 TTTTATATGGAATAGTTGAATGG + Intergenic
1170263924 20:14443607-14443629 TATTATATGCCAAAATGGAAAGG + Intronic
1172796500 20:37543010-37543032 TAATATATACAGATGTTGAAGGG + Intergenic
1173414722 20:42845419-42845441 AATTATAATCATAAATTGAAGGG + Intronic
1175102428 20:56588924-56588946 TAATATATCCATAGGTTGCAGGG + Intergenic
1177672493 21:24251300-24251322 TATAATATACATAAGTTGTGGGG + Intergenic
1179046680 21:37850829-37850851 AGTTATAGGCATAAGTTAAAAGG - Intronic
1179966036 21:44806402-44806424 CAGTATATGGAAAAGTTGAAGGG - Exonic
1180578340 22:16803157-16803179 AAGTATATGCAAAAGTGGAAAGG - Intronic
1181832096 22:25568464-25568486 TATTGTATGAATACTTTGAAAGG - Intronic
949698294 3:6725291-6725313 TAAAATATGCTTAAGTGGAATGG - Intergenic
949705568 3:6812993-6813015 TATTATATGCATATATTAAGAGG + Intronic
949745342 3:7285277-7285299 TATTATATGATTAAGATAAAAGG + Intronic
950199309 3:11031809-11031831 TTTTATATGTATAAATTTAAGGG + Intronic
950997438 3:17518302-17518324 TATTATAGGCACAGGATGAAGGG - Intronic
951252152 3:20406426-20406448 TATTATTTTTATATGTTGAATGG + Intergenic
951452888 3:22859319-22859341 TATAATATACATTAGTTAAAAGG + Intergenic
953418560 3:42736925-42736947 TGTTTTATACATAAGTTGTAGGG + Intronic
954571716 3:51646529-51646551 TAAAATATGAACAAGTTGAAAGG - Intronic
955582022 3:60433818-60433840 TATTAGATGCATCAGATGTATGG + Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956942674 3:74181890-74181912 CATTATATGCATAGGTGAAATGG + Intergenic
957517595 3:81275779-81275801 TATTATTTGCATGAGATCAAAGG + Intergenic
959260641 3:104075461-104075483 TATAATATGAATATTTTGAAAGG + Intergenic
963986006 3:151595563-151595585 TATTATATACATAAATATAATGG + Intergenic
964523207 3:157589064-157589086 TATTATTTGTATAAATTTAAGGG - Intronic
965873315 3:173286431-173286453 ATTTATATGCATAAGTTGTTTGG - Intergenic
966264940 3:178028568-178028590 TATTATATGGAGAGGGTGAAGGG + Intergenic
967516711 3:190378119-190378141 TATTATAAGCATGTGTTTAATGG - Intronic
968886546 4:3337432-3337454 TATTATTTGCAATAGCTGAAAGG + Intronic
970558838 4:17262497-17262519 TATTATTTGTATAAATTTAAGGG + Intergenic
972867064 4:43245782-43245804 TAATATTTGCATATGGTGAAAGG - Intergenic
974688455 4:65264508-65264530 TATTATATGAATAAGATTAATGG + Intergenic
975191147 4:71464082-71464104 CAGTGTATGCATAAGATGAAAGG - Intronic
975302300 4:72804553-72804575 AATAATATTCATAAATTGAAAGG + Intergenic
975915345 4:79318425-79318447 TATTATATGGGTAATTTGAGAGG + Intronic
978233085 4:106424327-106424349 TATCATATGGATAAGTTTGAGGG - Intergenic
978749091 4:112227333-112227355 TATTTTATTCTGAAGTTGAAGGG - Intergenic
982793528 4:159619534-159619556 TCTTTTATGAATAACTTGAATGG + Intergenic
983577945 4:169278448-169278470 TATTATATGTATAATTTACATGG - Intergenic
983889328 4:173014784-173014806 TATTATATGAATAAGGTCACTGG - Intronic
984093189 4:175401541-175401563 TAATATATGCATACTGTGAAAGG + Intergenic
984318779 4:178163979-178164001 TAAGATATACATAAGTGGAACGG + Intergenic
984408985 4:179371085-179371107 TATTATATGGAAAAGGTGAAGGG - Intergenic
987432411 5:17851998-17852020 TATTATATTTATAAGTTTATTGG + Intergenic
987953300 5:24704214-24704236 AATTATATTCAAAAGTGGAATGG - Intergenic
988060751 5:26165807-26165829 ACTTATATTCATAAGTTAAATGG + Intergenic
988343202 5:30001761-30001783 TATTATATGCATAATGAGAAGGG + Intergenic
988959911 5:36359371-36359393 AATAATATGCATTGGTTGAAAGG + Intergenic
989691545 5:44151115-44151137 AATTATATGCATGTGTAGAAGGG - Intergenic
991071765 5:62490976-62490998 TATTGAATGCATAAAATGAAAGG + Intronic
991388747 5:66119472-66119494 TATGATAAACATAAGTTAAATGG + Intergenic
992253811 5:74901691-74901713 TATTATATGGAAAAGATGATGGG - Intergenic
992879507 5:81092457-81092479 TATTAAATACATAAATTGATTGG + Intronic
993941166 5:94060907-94060929 TATTTTTTGCATCAGTTGATAGG - Intronic
995536035 5:113137495-113137517 ATTTATTTGCATATGTTGAATGG + Intronic
995946654 5:117655780-117655802 TAATATATGCATAAGTTATTTGG - Intergenic
996793725 5:127321213-127321235 TATTTTATCCATAAAATGAAAGG + Intronic
996833357 5:127764372-127764394 AATTAAATGTAGAAGTTGAAGGG + Intergenic
997077377 5:130695658-130695680 TATTATGTGGATAAGTTCACAGG + Intergenic
998234124 5:140383174-140383196 TTTAATATGCATTTGTTGAATGG - Intergenic
999019506 5:148148049-148148071 TCTTATATGAAGATGTTGAAGGG - Intergenic
1003056185 6:2822996-2823018 AATTATCTGCATAATTTTAATGG - Intergenic
1003399239 6:5778403-5778425 TATAATTTGCATATGGTGAAAGG - Intergenic
1004647646 6:17578107-17578129 TGTTATATGGAAAAGTTGAAGGG - Intergenic
1005273256 6:24188807-24188829 TATTATGTACATCAGTTTAATGG - Intronic
1008457734 6:51730866-51730888 TATTTTATGCCTAAGATGAATGG - Intronic
1008738370 6:54574908-54574930 TATTATACACATAACTTAAAAGG + Intergenic
1009025333 6:57992745-57992767 TATTAAATTCATAAGGTAAAAGG - Intergenic
1009200900 6:60744193-60744215 TATTAAATTCATAAGGTAAAAGG - Intergenic
1009372532 6:62924870-62924892 AATTATATCCTTGAGTTGAAGGG + Intergenic
1009532497 6:64837951-64837973 TGTTATATGCATATATTGCAAGG - Intronic
1010148311 6:72698552-72698574 CATTATATGAACATGTTGAAAGG + Intronic
1010493592 6:76504402-76504424 TATTTTTTGCATAAGGTGTAAGG + Intergenic
1012067045 6:94560796-94560818 TATTATATGCTTCAATTCAATGG - Intergenic
1012138847 6:95595161-95595183 TATTTTATGCAGAAAATGAAAGG - Intronic
1012306077 6:97659496-97659518 TACGAAATGCAAAAGTTGAAAGG + Intergenic
1012330829 6:97984288-97984310 TATTTTTTGCATAAATTGAGAGG - Intergenic
1012577195 6:100817659-100817681 TATTATATACATTAGATGAAAGG + Intronic
1012848269 6:104417314-104417336 TATTACATACATAACTTTAAAGG + Intergenic
1013490182 6:110639076-110639098 CTTCATATGAATAAGTTGAATGG + Intronic
1013856070 6:114573808-114573830 TATTATTTGCATAAATTTAAGGG - Intergenic
1015760965 6:136660032-136660054 CAGTATATGCATAAATTAAAAGG + Intronic
1016436412 6:144042340-144042362 TAATTTTTGCATAAGGTGAAAGG + Intronic
1016478391 6:144453699-144453721 TTTTAAATGTTTAAGTTGAATGG - Intronic
1016661822 6:146590005-146590027 TATAATATGCATTAATTTAAAGG - Intergenic
1016678593 6:146801512-146801534 TATTAGCTGCATAAATTCAAAGG + Intronic
1021109890 7:16681505-16681527 CATTATTTTCATAAGTTTAAAGG - Intronic
1022397494 7:30002787-30002809 AATTATATGGATAATTTAAAGGG + Intergenic
1023697248 7:42860303-42860325 TATTTTATGTATAAGGTGTAAGG + Intergenic
1024422327 7:49183182-49183204 TATGAGTTGCATTAGTTGAATGG + Intergenic
1024708116 7:51984093-51984115 CTTTATATACATAACTTGAAGGG + Intergenic
1028080182 7:86566248-86566270 TATTATATTAAAAGGTTGAAAGG - Intergenic
1028966432 7:96806858-96806880 TATTACATTTATAAGTTGTAAGG - Intergenic
1031128413 7:117802320-117802342 TATTTTTTGTATATGTTGAAAGG - Intronic
1031206595 7:118766595-118766617 CATTATCTGCATATGTAGAATGG - Intergenic
1031304637 7:120110898-120110920 TTTTATTTGCATAAATTTAAGGG + Intergenic
1031345113 7:120655529-120655551 GTTTATATGCAGTAGTTGAAGGG + Intronic
1031757143 7:125659326-125659348 TTTTATATGATAAAGTTGAAGGG - Intergenic
1031841614 7:126748235-126748257 GATAATATGATTAAGTTGAAAGG + Intronic
1032733737 7:134670776-134670798 TATTAAATGAATGAGTTGACTGG + Intronic
1037185660 8:16059411-16059433 TTTTATATGCAAAAGTTTTAAGG + Intergenic
1038709777 8:29932829-29932851 TATTATAGGTATAAGATGCAGGG - Intergenic
1039716140 8:40111049-40111071 TAATATATGCATTATTTTAAAGG + Intergenic
1039795998 8:40915737-40915759 TTTTATTTGTATAAGTTTAAGGG - Intergenic
1040633361 8:49241714-49241736 TATTATTTGCATATGTTGCATGG + Intergenic
1040789357 8:51207012-51207034 TAATATATGTTTAAGGTGAAAGG + Intergenic
1042302842 8:67304253-67304275 TATTGTATGAATAAGTTGTATGG - Intronic
1043822672 8:84887881-84887903 TCTTATATGCATATATTTAAGGG + Intronic
1044862555 8:96537008-96537030 TATAATATAGATAAATTGAATGG - Intronic
1045042139 8:98235855-98235877 TATAATATTAATCAGTTGAAGGG - Intronic
1045537785 8:103048744-103048766 TATTATATGGATAGGTATAATGG + Intronic
1045745394 8:105413410-105413432 TTTTATATGTATATTTTGAAAGG + Intronic
1045814463 8:106263119-106263141 TATTGTAGGCATAAGTTGAATGG - Intergenic
1046948053 8:119993022-119993044 GACTACATGCATGAGTTGAATGG + Intronic
1047014327 8:120707142-120707164 TGAAATATGCATAAGTTGCAGGG + Intronic
1047135917 8:122078482-122078504 AATTATAAGCAAAATTTGAAAGG + Intergenic
1047909028 8:129506534-129506556 TATTAAATAGATTAGTTGAATGG + Intergenic
1050245406 9:3684270-3684292 TAATATATACATGAGTTGAATGG + Intergenic
1051841682 9:21404961-21404983 TATTAGATACATAATTTGAAAGG - Intergenic
1051866612 9:21690503-21690525 TTATTTATTCATAAGTTGAAAGG - Intergenic
1052527046 9:29631323-29631345 AATTATATGAATGAATTGAAAGG - Intergenic
1055127778 9:72738764-72738786 AATTATAGTCATATGTTGAAGGG + Intronic
1055250771 9:74302430-74302452 TATTATATGTATATTTTAAATGG - Intergenic
1056914365 9:90732249-90732271 TGTTACATGCATAAGTGAAAAGG + Intergenic
1057945093 9:99319927-99319949 TATTATATGAATAATCTGTATGG - Intergenic
1058269104 9:102947141-102947163 TATCTTGTTCATAAGTTGAAAGG + Intergenic
1058388589 9:104468015-104468037 TATTGTTTGCTTAAGTGGAAGGG - Intergenic
1058433666 9:104941983-104942005 AATTATATGCATATGGTGATTGG - Intergenic
1203485004 Un_GL000224v1:44736-44758 TAATTTTTGTATAAGTTGAAAGG - Intergenic
1186621938 X:11250828-11250850 TATTATATTCACAAGTTCCAGGG + Intronic
1187856203 X:23637802-23637824 TAGGATATGCATAAGTCAAAAGG + Intergenic
1188213189 X:27447196-27447218 TATGATATGCATAAATGGACTGG + Intergenic
1188698065 X:33221825-33221847 TATAAAATGGATAATTTGAATGG + Intronic
1188762023 X:34044190-34044212 TATTATTTGTATAAATTTAAGGG - Intergenic
1188924869 X:36027230-36027252 TCTTACATGCATATGTTGCATGG + Intergenic
1188949728 X:36355752-36355774 TACTAAATGCATAAGTTCTAGGG + Intronic
1189450951 X:41129904-41129926 TATTAAATGCATAATGTGAGGGG + Intronic
1192591619 X:72364769-72364791 TCTTATATGCATATATTGCATGG - Intronic
1192693895 X:73394205-73394227 TAATTTTTGCATAAGTTGTAAGG + Intergenic
1193315490 X:80060301-80060323 TATTTTTTGCATACGGTGAAAGG + Intergenic
1193383920 X:80848383-80848405 TATTATATACAAAATTTTAAGGG - Intergenic
1193688367 X:84607317-84607339 TATTTTTTGCATATGATGAAAGG + Intergenic
1194053539 X:89101895-89101917 TTTTAGATTCATAAATTGAAAGG - Intergenic
1194372769 X:93094430-93094452 TATTCTCTGTATAAATTGAATGG - Intergenic
1195403025 X:104482059-104482081 TATTATAGCCATAAAATGAATGG - Intergenic
1195698871 X:107686912-107686934 TATTAAATGCCTAAATTGAAGGG + Intergenic
1196355774 X:114790387-114790409 TGTTATATGCATATGTTTGAAGG + Intronic
1197015763 X:121624561-121624583 TCTTATTTGCATAAATTTAAGGG + Intergenic
1197052761 X:122079664-122079686 TATTATATGCAAAAGTTAGATGG + Intergenic
1197060641 X:122176150-122176172 TATTGTAAGCATAAGAAGAATGG - Intergenic
1197647313 X:129032012-129032034 TAGTAAATACATCAGTTGAAGGG + Intergenic
1197830889 X:130641153-130641175 TATGATATGCGTAGGCTGAAGGG - Intronic
1198421683 X:136474775-136474797 TAGTCTATGCATAATTTGCAGGG + Intergenic
1199373255 X:147076463-147076485 TATTATATGCAGAGGCTCAAAGG - Intergenic
1199940059 X:152616576-152616598 TACTATATTCATAGATTGAAAGG - Intergenic
1200680810 Y:6208468-6208490 TATTCTCTGTATAAATTGAATGG - Intergenic
1200881839 Y:8222165-8222187 TATGATATACAAAACTTGAAAGG + Intergenic