ID: 906781617

View in Genome Browser
Species Human (GRCh38)
Location 1:48577715-48577737
Sequence GCATCCAGCAGAGCTGCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906781614_906781617 6 Left 906781614 1:48577686-48577708 CCGGGCACTGCAGAGAGAGAGTC 0: 1
1: 0
2: 1
3: 32
4: 1260
Right 906781617 1:48577715-48577737 GCATCCAGCAGAGCTGCAACTGG 0: 1
1: 0
2: 1
3: 22
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906781617 Original CRISPR GCATCCAGCAGAGCTGCAAC TGG Intronic
901239461 1:7684512-7684534 GCAGCCACCAGAGCTGCAAGTGG - Intronic
901336053 1:8450367-8450389 GCACCCAGCAGAGCTGCGTGTGG + Intronic
904058314 1:27686696-27686718 TGATCCTGCAGAGCTGCAGCTGG - Intergenic
904294017 1:29506032-29506054 GCAGACAGCAGAGCTGGGACTGG - Intergenic
906781617 1:48577715-48577737 GCATCCAGCAGAGCTGCAACTGG + Intronic
909137997 1:71826068-71826090 GCATCCAGGAGACCTGGCACTGG - Intronic
910676577 1:89821655-89821677 GGAACCAGCAGAGCCGAAACCGG - Intronic
915654412 1:157347672-157347694 TCATACAGGAGAGCTGCAGCTGG - Intergenic
918655918 1:187026613-187026635 GCTTCCATCAGAGCTTCAAAAGG - Intergenic
921354955 1:214277142-214277164 GCAGCCACCAGAGCTGGAAGAGG - Intergenic
922182652 1:223247386-223247408 GAAGCCAGCAGAGCTTCCACTGG + Intronic
922461229 1:225815749-225815771 TCATCTAGCAGAGCAGCAAGAGG - Intronic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
924253315 1:242157730-242157752 TCATCCAGGAGAGCTCCAACTGG - Intronic
1065318067 10:24483897-24483919 GCACCCAGCAGAGAGCCAACAGG + Intronic
1067932462 10:50576417-50576439 GCAGCCACCACAGCTGCCACTGG + Intronic
1070542544 10:77426811-77426833 GCATGCAGCAGTGCTGCAGAGGG - Intronic
1070999810 10:80818621-80818643 TCATACAGGAGAGCTCCAACTGG + Intergenic
1073466673 10:103698268-103698290 GCATTCAGCAGAACTCCACCTGG - Intronic
1073716562 10:106114756-106114778 GCATCCAGCAGAGCAGCTACCGG - Intergenic
1074025431 10:109628742-109628764 GCTTCCAGGAGAGCTGAAAAGGG + Intergenic
1075816748 10:125270536-125270558 CCATCCTGCTGAGCTGCAGCTGG + Intergenic
1075970271 10:126646260-126646282 GCATGCAGCAGGGCTCCATCAGG - Intronic
1076449103 10:130544051-130544073 ACAGTCAGCAGGGCTGCAACAGG + Intergenic
1076817108 10:132920451-132920473 GCAGCCAGCAGAGCAGCAGGAGG - Intronic
1078237264 11:9497028-9497050 GCATCCAGCAGGGCTGGGACTGG + Intronic
1079567713 11:21903099-21903121 GCATCCTGCTGAGCTGGTACAGG - Intergenic
1079698185 11:23510438-23510460 GCTCCTAGCAGAGCAGCAACTGG - Intergenic
1080848386 11:36046238-36046260 GCATGCAACAGAGCTGGTACAGG - Intronic
1081811461 11:45916530-45916552 CCATCCAGCAGGGCAGTAACTGG - Intronic
1083730855 11:64651771-64651793 GCAGCCAGCACAGCTCCAAGAGG + Intronic
1084920948 11:72469189-72469211 GCAGCCAGCAGAGCTGCCCCAGG - Intergenic
1089015490 11:115162029-115162051 TCAGCCAGCAGACCTGCATCTGG - Intergenic
1089632102 11:119790198-119790220 GCCTCCTGCACAGCTCCAACAGG - Intergenic
1091234198 11:134008848-134008870 GCAAACAGCAGAGCTGCCAAGGG + Intergenic
1092282000 12:7104652-7104674 GCATCCTGAACTGCTGCAACAGG + Intronic
1092637325 12:10466293-10466315 GCATACAGGAGAGCTCCAGCTGG - Intergenic
1093664388 12:21794952-21794974 TCATACAGGAGAGCTGCAGCTGG - Intergenic
1099486155 12:83232078-83232100 AACTCCAGCAGACCTGCAACAGG - Intergenic
1101510941 12:105391725-105391747 GCATACAGCAGAGATCTAACTGG + Intronic
1101718325 12:107330615-107330637 TCACACAGCAGAGCTGGAACCGG + Intronic
1102392825 12:112563361-112563383 GCATCCACAACATCTGCAACTGG - Intergenic
1104403785 12:128500167-128500189 GCATGAAGTAGAGTTGCAACTGG - Intronic
1104842249 12:131830721-131830743 GCACCCAGCAGGGCTGGAGCCGG + Intronic
1104960289 12:132485330-132485352 GCGGCCCGCAGAGCTGCAGCAGG + Intergenic
1105063095 12:133172168-133172190 GCAGCCTGCAGGGCTGCAATTGG + Intronic
1107671444 13:42750340-42750362 GCACCCAGCAGAGCAGCTCCTGG + Intergenic
1115856183 14:37632520-37632542 TCATACAGCAGAGCTCCAGCTGG - Intronic
1115940255 14:38601218-38601240 GCATACAGGAGAGCTCCAGCTGG - Intergenic
1118033135 14:61837851-61837873 GTATCCAGCAAAGCTGAAATTGG + Intergenic
1121227126 14:92329143-92329165 TCATCCAGCAGAGCTGGACAAGG - Intronic
1121870865 14:97405437-97405459 AGAGCCAGGAGAGCTGCAACAGG - Intergenic
1122175523 14:99915568-99915590 TCAACCTGCAGAGCTGCTACAGG - Intronic
1126283925 15:46988817-46988839 GCATCCAGCACAGCAGAAAGAGG - Intergenic
1126672506 15:51129157-51129179 GCGTCCAGCAGAGCTATCACAGG + Intergenic
1126841081 15:52718026-52718048 GCATCCAGCAGAGCAGGATGAGG - Intergenic
1128321409 15:66697311-66697333 GCATTCATCAGAGCTTCAAAAGG + Intergenic
1128778707 15:70343330-70343352 GCCACCAGCAGATCTGCCACAGG - Intergenic
1128852440 15:70973385-70973407 TCATACAGGAGAGCTCCAACTGG - Intronic
1130730815 15:86490188-86490210 ACTTTCAGCAGAGCTGCATCTGG - Intronic
1132914886 16:2338617-2338639 ACATCCAGAAAAGGTGCAACAGG - Intronic
1133297853 16:4763895-4763917 GCAGCCAGCAGCACTGCCACAGG + Intronic
1134396241 16:13866379-13866401 CCATCCACCATAGCTGCAAGAGG + Intergenic
1135544166 16:23354647-23354669 GCCTCCAGGGGAGCTGCATCTGG + Intronic
1136029082 16:27489781-27489803 GTAGCCACCAGAGCTGCAGCAGG - Intronic
1136534064 16:30888864-30888886 GCTTCCAGCAGTTCTGGAACAGG + Exonic
1141172023 16:81697504-81697526 GCTCCCAGCAGAGCTGCGACTGG - Intronic
1141684657 16:85563459-85563481 GCTTCCAGCACAGCTGTAATTGG - Intergenic
1142220168 16:88850351-88850373 GCAGTCAGCAGAGCTGCGTCCGG + Intronic
1142223360 16:88865860-88865882 GCCTCCAGGAGTGCAGCAACAGG - Exonic
1142868062 17:2803016-2803038 GCATGAAGCAGAGCTGCTAAGGG + Intronic
1145242951 17:21250289-21250311 GCAAGAAACAGAGCTGCAACAGG - Intronic
1150877362 17:68984967-68984989 GCACAAAGCACAGCTGCAACGGG + Exonic
1151595300 17:75074739-75074761 CCATCCAGCAGAGCCACAACCGG + Intergenic
1152599923 17:81257090-81257112 GCATGCAGGAGAGCTCCAGCAGG - Intronic
1153664760 18:7358969-7358991 GCATGCAGCAGAGCTGGGTCAGG - Intergenic
1153973128 18:10244576-10244598 GCAGGCAGCAGAGCTCCAAGGGG + Intergenic
1155505457 18:26528556-26528578 GCAGGCAGCAGAGCAGCAGCTGG - Intronic
1160419679 18:78735447-78735469 CCCTCCAGCAGAGCTGCCCCTGG + Intergenic
1161505302 19:4640426-4640448 GCCTCCAGCTGAGCTGGGACTGG - Intronic
1161595814 19:5150554-5150576 CCTTCCAGCAGAGGTGCAAGAGG - Intronic
1164618301 19:29679570-29679592 GCATCCTGCAGAGCTCTAAAGGG - Intergenic
1166669909 19:44703628-44703650 ACATCCTGCAGACCTTCAACAGG + Exonic
1167272315 19:48512305-48512327 GCTTCCAGCACAGATGCACCCGG + Intronic
1167291973 19:48629500-48629522 GCACCCAGCACAGGTGCACCAGG - Exonic
1168690330 19:58372878-58372900 CCATACAGCAGAGCAGGAACCGG - Intronic
925481254 2:4276895-4276917 GCATCCTGCAGACCTGCTAACGG - Intergenic
925744387 2:7032193-7032215 GATTCCAGCAGAGCTGCAAGGGG - Intronic
925744392 2:7032220-7032242 GATTCCAGCAGAGCTGCAAGGGG - Intronic
925744397 2:7032247-7032269 GATTCCAGCAGAGCTGCAAGGGG - Intronic
925744402 2:7032274-7032296 GATTCCAGCAGAGCTGCAAGGGG - Intronic
925744407 2:7032301-7032323 GATTCCAGCAGAGCTGCAAGGGG - Intronic
925744412 2:7032328-7032350 GATTCCAGCAGAGCTGCAAGGGG - Intronic
925744416 2:7032355-7032377 GATTCGAGCAGAGCTGCAAGGGG - Intronic
926419679 2:12684506-12684528 GCCTCCAGCAAAACTGCAAAAGG + Intergenic
926970572 2:18463618-18463640 TCATACAGGAGAGCTCCAACTGG - Intergenic
927295441 2:21447768-21447790 GCATGTAGCCGAGCTGCAAGTGG + Intergenic
927694273 2:25229737-25229759 GCACCAAGCAGAGTAGCAACAGG + Exonic
927897900 2:26796652-26796674 GCTTCCAGCAGAGCAGCAGTGGG - Intronic
928082877 2:28326078-28326100 GGACCCAGCAGAGCTGAACCTGG - Intronic
929959862 2:46488290-46488312 GCCCTCAGCAGAGCTGCAAGGGG + Intergenic
932324629 2:70849851-70849873 GCACCCAGCTAAGCTGCACCTGG + Intergenic
936892846 2:117392526-117392548 ACATCCAGCAGAGCAGCAGGAGG - Intergenic
937464943 2:122124537-122124559 TCATACAGGAGAGCTGCAGCTGG - Intergenic
938146078 2:128835805-128835827 TCTTCGAGCAGAGCTGCAGCTGG + Intergenic
938927638 2:136059102-136059124 GCCTCCTGCAGAGCTTCCACTGG + Intergenic
940734030 2:157428883-157428905 GCATCCAGCAGATTTTCTACTGG + Intronic
940957811 2:159748647-159748669 GCATCAAGCAGTGCCACAACAGG + Exonic
941360485 2:164545507-164545529 GCAGCCACCAGAGCTGGAAGAGG + Intronic
944319132 2:198315985-198316007 GAATCCAGAAGAGCTGAATCAGG - Intronic
945141049 2:206686513-206686535 GAGTCCTGCAGAGCTGCAATAGG + Intronic
945256282 2:207806180-207806202 GCAGCCAGCAGAGCTTTAAGGGG + Intergenic
948114040 2:235480431-235480453 TCATCCAGCAGTGCTGCTTCGGG + Intergenic
948652227 2:239455548-239455570 GCATGTTGGAGAGCTGCAACAGG - Intergenic
1171516365 20:25741319-25741341 AAATACAGCAGAGCAGCAACAGG + Intergenic
1171935518 20:31271829-31271851 GAATCCAGCAGAGAAGCAACAGG + Intergenic
1172135066 20:32681286-32681308 GCAGGCAGTGGAGCTGCAACTGG + Intergenic
1172968395 20:38855698-38855720 GGAGCCAGGAGAGCTGCAACAGG + Intronic
1174400637 20:50273976-50273998 GCAGCCAGCAGGGCTGGAGCAGG - Intergenic
1175392175 20:58634425-58634447 CCATCCAGCAGAGCAGGAAAAGG + Intergenic
1176255470 20:64150386-64150408 GCAGACAGCAGAGCTGCAGAGGG - Intergenic
1177147612 21:17423341-17423363 GCATCCAGGTAAGCTGCAGCTGG + Intergenic
1179983984 21:44911012-44911034 GCACCCAGGACAGCTGCAGCGGG + Intronic
1182151770 22:28032481-28032503 GCATGCAGCAGGTATGCAACGGG + Intronic
1183617896 22:38956200-38956222 AGACCCAGGAGAGCTGCAACAGG - Intronic
1184418446 22:44365325-44365347 GCACACAGCAGAGCTGGAATCGG + Intergenic
1185294184 22:50045322-50045344 TCAGCCACCAGAGCTGCAGCAGG - Exonic
1185398807 22:50605574-50605596 GCATCCAGACGAGCTGGAGCTGG + Exonic
949584503 3:5424690-5424712 TCATGCAGGAGAGCTGCAATGGG - Intergenic
949594513 3:5530378-5530400 TCATACAGGAGAGCTCCAACTGG - Intergenic
950556891 3:13701398-13701420 GCATCCAACACATCTGCCACAGG + Intergenic
951901196 3:27659321-27659343 GCATCCTGCAGACCTGAACCTGG + Intergenic
953083861 3:39647760-39647782 GGACCCAGCTGAGCTGTAACTGG - Intergenic
954512122 3:51134555-51134577 GCCTCCAGAAGAGCTGGAATGGG + Intronic
959231762 3:103663321-103663343 ACCTCCAGCAAAGCTGCAACTGG + Intergenic
959801078 3:110495761-110495783 TCATACAGGAGAGCTGCAGCTGG + Intergenic
962397707 3:135031428-135031450 GCATCCAGCGTAGCTGTGACTGG + Intronic
962640057 3:137376701-137376723 TCATACAGGAGAGCTGCAGCTGG - Intergenic
964371291 3:156003490-156003512 TTATACAGCAGAGCTGCCACTGG - Intergenic
965621860 3:170650546-170650568 TCATACAGGAGAGCTCCAACTGG - Intronic
967490567 3:190086449-190086471 GAATCCAGCAGAACTGCTGCAGG - Intronic
968696648 4:2033622-2033644 TCATTCAGGAGAGCTGCAGCTGG - Intronic
969458171 4:7312913-7312935 GCTCCCTGCAGAGCTGCAGCTGG + Intronic
969595090 4:8144174-8144196 GCACCCAGCAGAGCCTCAGCGGG + Intronic
969619505 4:8272059-8272081 GCACACAGCTGGGCTGCAACGGG - Intronic
969622564 4:8286008-8286030 GCATCCTGCAGGGCTGCAGCAGG - Intronic
969880250 4:10167394-10167416 GCTCCCAGCAGAGCTGAGACTGG - Intergenic
972169921 4:36333607-36333629 GGATCCAGCAGAGCAGCAGTAGG + Intronic
974165141 4:58191576-58191598 CCACCCAGCAGAGCTGGTACTGG - Intergenic
975632789 4:76419561-76419583 GCAACCAGCAGAGCTAGAAGAGG - Intronic
976956169 4:90903010-90903032 GAATGCAGCACAGCTGCAGCTGG + Intronic
978309246 4:107367735-107367757 GTCTCCAGCACAGCTGTAACGGG + Intergenic
981694442 4:147545911-147545933 GCATCAAGGAGAGCTAGAACTGG - Intergenic
986329152 5:6704768-6704790 GCATGTAGCAGAGCTGCATGGGG - Intergenic
988867630 5:35353457-35353479 TCATACAGGAGAGCTCCAACTGG - Intergenic
990115611 5:52386950-52386972 CCATCCAGCAGAGCTGCTTCTGG - Intergenic
994167736 5:96625752-96625774 GCATCCAACGAAGCTGCAACCGG - Intronic
995023460 5:107392574-107392596 GGATCCAGCTAAGCTGCACCTGG + Intronic
996154272 5:120078618-120078640 GCAACCAGCTGAGCTGCATCAGG - Intergenic
999372220 5:151062912-151062934 CCATACAGTAGAGCTGCAGCAGG + Intronic
1000433165 5:161175704-161175726 GCATCCAACATATATGCAACTGG - Intergenic
1001516109 5:172356298-172356320 GCTTCAAGCAGAGCTGGATCTGG - Intronic
1001585182 5:172829281-172829303 GCAGCCAGCTGAGTTGCACCTGG - Intergenic
1002802083 6:533439-533461 CCCTCAAGCAGAGCTGTAACTGG - Intronic
1002924454 6:1596862-1596884 GCATCCAGCATGTCTGAAACAGG + Intergenic
1007424916 6:41740592-41740614 GCAGCCAGCAGGGCTCCAGCGGG - Exonic
1008425152 6:51348709-51348731 TCATACAGGAGAGCTCCAACTGG - Intergenic
1009558898 6:65213252-65213274 GCCTCCAGCAGAGTTGCCGCAGG - Intronic
1015224081 6:130836490-130836512 GCACCCACCAGAGCTGGAACTGG - Exonic
1015910258 6:138162142-138162164 CCATCAAGGAGAGCTGCACCTGG + Exonic
1018320671 6:162604834-162604856 GCCTCCAGCAAAAGTGCAACTGG + Intronic
1018653691 6:166011887-166011909 GCATTCAGCAGAGTCGGAACTGG + Intergenic
1018860673 6:167708812-167708834 GCATCCTGCAGAGGTGCACACGG - Intergenic
1023046558 7:36215227-36215249 GCACCCCGCAGCGCTGCACCAGG + Intronic
1023697689 7:42864834-42864856 TCATACAGCAGAGCTCCAGCTGG - Intergenic
1023750135 7:43364537-43364559 GCAGCCAGCACAGCTGCTGCAGG - Intronic
1024125786 7:46293354-46293376 TCATCTAGCAGAGCTTCAAGTGG + Intergenic
1024273573 7:47659963-47659985 GCATCCAGCAGGGATGCTGCCGG - Exonic
1030330319 7:108263490-108263512 GCATCAGGCAGTGCTGAAACAGG + Intronic
1030918392 7:115346844-115346866 GCATGGAGCAGAGCTGCCAAAGG - Intergenic
1031969398 7:128053379-128053401 GCATCTCACAGAGCTGGAACAGG - Intronic
1039801871 8:40964756-40964778 TCATACAGGAGAGCTCCAACTGG + Intergenic
1040506301 8:48051774-48051796 GCATCCAGCAGGGAGGCACCAGG + Intronic
1040914037 8:52550686-52550708 GCAGCCACCAGAGCTGGAACAGG - Intronic
1042886751 8:73560693-73560715 GCATCCAGCACACCTCCAAGAGG + Intronic
1043446582 8:80325360-80325382 GCTGCCAGCAGAGCTACACCTGG - Intergenic
1044896263 8:96895115-96895137 GAAAACAGTAGAGCTGCAACTGG - Intronic
1045185097 8:99830001-99830023 TCATACAGGAGAGCTCCAACTGG - Intronic
1046276638 8:111970328-111970350 TCATCCAGCAAAGCTACTACTGG + Intergenic
1048575590 8:135687376-135687398 GCATACAGCAGAGTGGCCACTGG - Intergenic
1049065432 8:140309915-140309937 TCATCAGGCAGAGCTGCAAGGGG - Intronic
1055358467 9:75462499-75462521 GAACCCAGAAGAGCTGCCACAGG + Intergenic
1055514338 9:77020867-77020889 GGCTCCAGCAGAGAGGCAACGGG - Exonic
1056759182 9:89403005-89403027 GCATCCCACAGAGGTGCACCTGG - Exonic
1059992893 9:119881967-119881989 GCAGCCAGCTGAGATGAAACGGG - Intergenic
1060186886 9:121568945-121568967 GCTTCCAGGAGATCAGCAACCGG - Intronic
1060433312 9:123569812-123569834 GCAACCAGCAAAGCAGCAAGAGG + Intronic
1061227397 9:129288699-129288721 GCAACCAGCAGAGATGCCACGGG - Intergenic
1062589252 9:137266090-137266112 GCAGCCAGCAGGGCGGCCACAGG - Intronic
1189211507 X:39287869-39287891 GCATCAAACACAGCTCCAACCGG + Intergenic
1192940818 X:75909887-75909909 GCATCCAGCAGAGGAGAAAGAGG - Intergenic
1193351962 X:80474555-80474577 TCATACAGCAGAGCTCCAGCTGG - Intergenic
1193754584 X:85392185-85392207 GCAGCCCGCAGAACTGCAATAGG - Intergenic
1194208432 X:91039574-91039596 GCATACAGGAGAGCTCCAGCAGG - Intergenic
1194242644 X:91470528-91470550 TCATACAGCAGAGCTCCAGCTGG + Intergenic
1195230712 X:102844151-102844173 CCATCCAGCAGTGCTGCATTGGG - Intergenic
1196964257 X:121038597-121038619 CCAGCCAGCAGAGCAGCATCAGG - Intergenic
1199410360 X:147515198-147515220 GTTTCCAGAAAAGCTGCAACAGG + Intergenic
1199773329 X:150989243-150989265 GCATCCAGGAGACCAGCAGCAGG - Exonic
1201913668 Y:19158921-19158943 GAATCCAACAGACCTGCAGCTGG + Intergenic