ID: 906782382

View in Genome Browser
Species Human (GRCh38)
Location 1:48584236-48584258
Sequence TCTTGAATGTAGACAATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 197}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906782382 Original CRISPR TCTTGAATGTAGACAATGGA AGG (reversed) Intronic
900016976 1:158597-158619 GCTGGAATATAGAAAATGGATGG - Intergenic
900047237 1:517189-517211 GCTGGAATATAGAAAATGGATGG - Intergenic
900069451 1:759046-759068 GCTGGAATATAGAAAATGGATGG - Intergenic
900508661 1:3044891-3044913 ACTTGAAGGTAGAGAGTGGAAGG - Intergenic
903291664 1:22318035-22318057 TCTTGAATGACTACAATGGGTGG + Intergenic
903968463 1:27103818-27103840 TGTTAAATAGAGACAATGGAAGG - Intronic
906782382 1:48584236-48584258 TCTTGAATGTAGACAATGGAAGG - Intronic
907591697 1:55679678-55679700 TCTTGAAGACAGACGATGGATGG + Intergenic
909436614 1:75649461-75649483 TCTTGAAGGAAGTGAATGGAAGG - Intergenic
909650802 1:77974019-77974041 TCTAGAATGTTGACAATGTTGGG - Intronic
909732632 1:78913618-78913640 ACTTGAGTGTAGAAGATGGAAGG + Intronic
910653358 1:89593640-89593662 TCTTGAAGGTAAACACTGCAAGG - Exonic
912036136 1:105317875-105317897 TCTTGAAAATAGACAGTAGAGGG - Intergenic
912041007 1:105390534-105390556 TCTTGGAGGTAGAGAATAGAAGG - Intergenic
912744657 1:112235653-112235675 TCTTGAAGTTAGAAAAGGGATGG - Intergenic
913909830 1:124657318-124657340 AGTTGAATGTACACAACGGAAGG - Intergenic
915453346 1:156022294-156022316 TCTTGGAGGTGGAGAATGGAAGG - Intergenic
919835698 1:201571630-201571652 TCTTGACTGTGGATAATTGAAGG - Intergenic
919899928 1:202036610-202036632 TCTTGAAAGAACACAATGGGGGG + Intergenic
920877856 1:209854182-209854204 TCTGAAATATAGACAAAGGATGG + Exonic
922104815 1:222504445-222504467 GCTGGAATATAGAAAATGGATGG - Intergenic
922265124 1:223976959-223976981 GCTGGAATATAGAAAATGGATGG - Intergenic
923482878 1:234400920-234400942 TCTGGCTTGTAAACAATGGAAGG - Intronic
924346989 1:243081969-243081991 GCTGGAATATAGAAAATGGATGG - Intergenic
924573606 1:245259614-245259636 TCTTGAATGTTGATAATTAATGG + Intronic
1063092443 10:2879260-2879282 TCATTAATGTAGACAAATGAGGG - Intergenic
1066729359 10:38422897-38422919 GCTGGAATATAGAAAATGGATGG + Intergenic
1068466999 10:57406873-57406895 TCTTGGACCTAGATAATGGATGG - Intergenic
1069255417 10:66325568-66325590 TTTTCAATGAAGACAATGAAGGG + Intronic
1069758808 10:70793298-70793320 TTTTGAATGTACACAAATGAAGG - Intergenic
1070291839 10:75122173-75122195 TTTTTAATGTAGACAGTGAAAGG + Intronic
1071714511 10:88081811-88081833 TCCTGCATGAAGACAATGGCTGG + Intergenic
1073715828 10:106106336-106106358 TCTTGAATGAAGTCAGTGTATGG + Intergenic
1073837635 10:107463179-107463201 TCTTGAATGTAGCCAGGGCAGGG + Intergenic
1074343972 10:112662797-112662819 TCTTGTATTTAGATAATAGAAGG + Intronic
1076427458 10:130377917-130377939 TCTTGAATGATGACAATGCCAGG - Intergenic
1076973578 11:153812-153834 GCTGGAATATAGAAAATGGATGG - Intergenic
1077385246 11:2266534-2266556 TCTTCAATGAAGACACTGGAGGG + Intergenic
1077638266 11:3858199-3858221 TTTTGAATGTAGACATTGGCTGG + Intronic
1078107430 11:8367183-8367205 TCATGTTTGTAGACAATGGAGGG + Intergenic
1083687436 11:64385001-64385023 GCTTGAATATACACCATGGAAGG - Intergenic
1083869214 11:65476932-65476954 TCCTGAATGCAGACAATGTAGGG + Intergenic
1085657185 11:78327035-78327057 TCTTGAGTATAGACAAAGAATGG - Intronic
1087965356 11:104406135-104406157 TCTAGAATGTAGCCAATAAAGGG + Intergenic
1088381567 11:109199069-109199091 TTTTTAATGGAGAGAATGGAAGG - Intergenic
1088859015 11:113782531-113782553 TCTTTCATGTAGACCCTGGAAGG - Intergenic
1093232297 12:16561328-16561350 TCTTTAAAGTTGATAATGGAGGG + Intronic
1093526735 12:20112398-20112420 TTTTGCAGGTAGACAAAGGAGGG - Intergenic
1094153731 12:27314841-27314863 TTTTAAAAGTAGAAAATGGAGGG - Intronic
1095396885 12:41771867-41771889 TGGTGAATGCAGACCATGGAAGG - Intergenic
1095825489 12:46526185-46526207 TCTGGAATGTAGACAATCCTGGG - Intergenic
1096299709 12:50416062-50416084 CTTTGAAAGTACACAATGGAAGG + Intronic
1097318644 12:58201257-58201279 TCTAGAATGGAGTCAATGGAGGG + Intergenic
1098887696 12:75976903-75976925 TCTAGAAGGTAAACAAAGGAGGG + Intergenic
1098921386 12:76305347-76305369 CCTTGTAAGTTGACAATGGATGG + Intergenic
1099917899 12:88918439-88918461 TCTTGTATGTAGAAAATAGTAGG + Intergenic
1103175058 12:118855725-118855747 TCTTGCATGTAAACAGTGGGTGG + Intergenic
1105800648 13:23900475-23900497 TCTTTAATGTAGAACATTGAGGG + Intronic
1105941765 13:25153951-25153973 TCTTAGATGCAGACAAGGGAAGG + Intergenic
1106006970 13:25779777-25779799 TCTTTGATGTTGACAATGGGAGG + Intronic
1106110020 13:26768688-26768710 TCTTGAAAAGAGAAAATGGAAGG + Intergenic
1108140673 13:47417411-47417433 TCTTGTATGAAGACCATGGCTGG + Intergenic
1109449487 13:62491426-62491448 TCTTGCAAATAGACAATGTAAGG - Intergenic
1114034012 14:18604235-18604257 TCTTGAATGTACATAATGTTTGG - Intergenic
1114124633 14:19710776-19710798 TCTTGAATGTACATAATGTTTGG + Intergenic
1114938596 14:27576530-27576552 TCTTGAAGGCAGAAGATGGATGG - Intergenic
1115924427 14:38414700-38414722 TCTTGAATATAGCACATGGATGG - Intergenic
1116194265 14:41702370-41702392 TATTGAAAGTATACAATGTATGG - Intronic
1116352914 14:43888310-43888332 TATTAAATGTAGACAATGTGGGG + Intergenic
1119135136 14:72211323-72211345 TCTTGAATTTAGAGACTTGAAGG + Intronic
1121161253 14:91743514-91743536 TCATGAATTTAAACAATTGATGG + Intronic
1124420134 15:29513927-29513949 TCTAGAATGTAGACACTGCAAGG - Intronic
1126975537 15:54175087-54175109 TCATGAATGTAGCCAAAGGCTGG - Intronic
1131398447 15:92105325-92105347 TCTTTAGTGGAGACAATGAAAGG - Intronic
1134293964 16:12928370-12928392 TGTAAAATGCAGACAATGGATGG - Intronic
1137859845 16:51835470-51835492 TCTTGAATGTGAACCATGGGTGG + Intergenic
1139236697 16:65347105-65347127 TTTTGAATGGAGACAAATGATGG + Intergenic
1140547017 16:75820557-75820579 GTTTGACTATAGACAATGGAGGG + Intergenic
1142446684 16:90143860-90143882 GCTGGAATATAGAAAATGGATGG + Intergenic
1142460821 17:91609-91631 GCTGGAATATAGAAAATGGATGG - Intergenic
1148202275 17:45757051-45757073 TCTGTAATGTAGACCATGAATGG + Intergenic
1150479455 17:65498098-65498120 TATTGAGGGTAGAGAATGGAAGG + Intergenic
1155340570 18:24810506-24810528 TTTTCACTGTAGCCAATGGAGGG + Intergenic
1155594262 18:27465770-27465792 TCTTGAATGTAACCATTGAAAGG + Intergenic
1156083336 18:33367263-33367285 TCATGAATATAGAGAATAGATGG + Intronic
1156208496 18:34912285-34912307 TGTTGAATGTAAACATTTGAGGG - Intergenic
1156802213 18:41129879-41129901 AATTGAATATAGACAAGGGAAGG + Intergenic
1157522237 18:48353317-48353339 TTGTGATTTTAGACAATGGAGGG - Intronic
1158277202 18:55781062-55781084 TCTTGAAAGCAGTAAATGGAGGG + Intergenic
1159049052 18:63400134-63400156 TCATCAATGAAGATAATGGAGGG + Exonic
1159450593 18:68597222-68597244 TATTGCCTGTATACAATGGATGG + Intergenic
1160650523 19:223971-223993 GCTGGAATATAGAAAATGGATGG - Intergenic
1166627352 19:44370886-44370908 CCTTAAATGGAGACTATGGAGGG + Intronic
925986775 2:9222812-9222834 CCAGGAGTGTAGACAATGGAAGG - Intronic
927123236 2:19988972-19988994 TGTTGAATGTAAACATCGGATGG - Intronic
927361955 2:22246372-22246394 TCATGGATGTAGAGAATAGAAGG + Intergenic
929880729 2:45835336-45835358 CCATGAATGTAGACATTGGGTGG - Intronic
930635128 2:53796281-53796303 TCTTGAAGGTAAAGAATGGGAGG - Intronic
931195076 2:60044484-60044506 TCATGAATGCTGACAATGGAGGG + Intergenic
931975560 2:67640291-67640313 TCTTTAAGATGGACAATGGAAGG + Intergenic
935368351 2:102318501-102318523 TCTGGAATATAGACAAGTGAAGG + Intronic
935574641 2:104696166-104696188 CTTTGAATGTTGGCAATGGAAGG - Intergenic
936479337 2:112870599-112870621 GGTTGAATGTAGACACTGCAGGG + Intergenic
936699480 2:114993532-114993554 AATTCAATGTAGATAATGGATGG + Intronic
938089366 2:128421138-128421160 TTTGGAATCTAGAAAATGGATGG - Intergenic
938546146 2:132333671-132333693 CCTTAAATGGAGACTATGGAGGG - Intergenic
941659801 2:168184060-168184082 TCTGGAATGTAGATTAAGGATGG - Intronic
942432717 2:175931075-175931097 TCTTTAATGTAGAAATTGGGTGG - Intronic
942552632 2:177135382-177135404 TCTTGTGTGTAGAATATGGAGGG - Intergenic
944138710 2:196431024-196431046 TCTTGAAAGTAGCCAAAGGAGGG + Intronic
944792783 2:203150061-203150083 TCTTGAGTATAGACTATGAATGG + Intronic
944902661 2:204231509-204231531 TCTTGAATGAATACAGTGGCAGG + Intergenic
946630458 2:221662024-221662046 TTTTGAATGTAGACAAGAGATGG + Intergenic
947103194 2:226643500-226643522 TCCTGAGTATAGACAATTGATGG - Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1170100174 20:12690360-12690382 ACTTGAAGGTGGAGAATGGAAGG + Intergenic
1171875010 20:30566404-30566426 CCTTAAATGGAGACTATGGAGGG - Intergenic
1177630122 21:23715588-23715610 GCTTGAATGTAGACAGAGCATGG - Intergenic
1177673846 21:24270961-24270983 CCTTGAGAGTAGACAAAGGAGGG - Intergenic
1178709500 21:34902359-34902381 CCTTAAATGTGGACAATGGTGGG + Intronic
1180458131 22:15531277-15531299 TCTTGAATGTACATAATGTTTGG - Intergenic
949832789 3:8233873-8233895 GCATGAATGTACACATTGGAAGG - Intergenic
950089416 3:10284891-10284913 ACTTGACTGTAGGCAACGGATGG - Intronic
954170784 3:48800640-48800662 GCTAGAATGTAGAAATTGGAAGG + Intronic
957827643 3:85469373-85469395 TCATCAATGTAGACAAGGGTGGG + Intronic
959050155 3:101516966-101516988 TCTTGAAGGTAAACTATTGAAGG + Intergenic
959562476 3:107798579-107798601 TCTGGAGTGTTGAAAATGGATGG - Exonic
962177810 3:133173566-133173588 TCATTAATGTGGACAATGGAAGG - Intronic
964016081 3:151948412-151948434 TCTTGAATCTAGGCACTGAAAGG - Intergenic
965380981 3:167987756-167987778 TCTTGAAGATAGAGAGTGGAGGG + Intergenic
968367310 3:198196014-198196036 GCTGGAATATAGAAAATGGATGG + Intergenic
970165160 4:13228920-13228942 TCTTGAATATAGCACATGGATGG - Intergenic
970208502 4:13681411-13681433 TCTTGAATTAAGACTATAGATGG - Intergenic
974050254 4:56935192-56935214 CTATGAATGTTGACAATGGAAGG + Exonic
975362462 4:73486891-73486913 CAATGAATGTAGACAAGGGAAGG - Intronic
976219930 4:82748234-82748256 TCTTGTTTCTGGACAATGGATGG - Intronic
976660457 4:87535243-87535265 TCTGAAATGGAGAAAATGGAAGG + Intergenic
977095031 4:92731118-92731140 TATTAAATGTAAACAATAGATGG - Intronic
979255730 4:118605718-118605740 GCTGGAATATAGAAAATGGATGG + Intergenic
979332615 4:119434819-119434841 GCTGGAATATAGAAAATGGATGG - Intergenic
979981239 4:127257948-127257970 TCTTAAATGGAGATAATGGGAGG + Intergenic
980603866 4:135063829-135063851 TGTTAAATGTAGAAAATAGATGG - Intergenic
980809399 4:137855259-137855281 TCTAGAATCTAGAAAATGCAAGG + Intergenic
982665539 4:158257469-158257491 TCTTGAAAGTCAACAATGCATGG - Intergenic
990700875 5:58473825-58473847 TCTTTAATTTAAAAAATGGAGGG + Intergenic
993572078 5:89553530-89553552 TCTTGCAGGTAGACTAGGGAAGG + Intergenic
993675469 5:90810930-90810952 TCTTCAATATAAACAATGGATGG - Exonic
994023740 5:95058523-95058545 TCTGGAAAGTAGGCAATGGAGGG - Intronic
994109905 5:95990066-95990088 TCTAGAATCTGGAAAATGGAAGG - Intergenic
996755660 5:126932496-126932518 TCTTGAATCTTGCCACTGGATGG + Intronic
999958058 5:156723930-156723952 TCTGCAATGTACAGAATGGATGG + Intronic
1000231772 5:159322239-159322261 TCTTCAATGTAGACAAGGAAGGG + Intronic
1002726535 5:181301235-181301257 GCTGGAATATAGAAAATGGATGG + Intergenic
1002912208 6:1498866-1498888 TTTTGTAGGTAGACAATGAATGG - Intergenic
1004997600 6:21209265-21209287 TCTTGAACGTGGACAAAGGATGG - Intronic
1005771564 6:29078103-29078125 ACTTTAATGTAGTCAATGGAAGG - Intergenic
1009326916 6:62362394-62362416 TTTAGAAATTAGACAATGGATGG + Intergenic
1010933951 6:81837756-81837778 TCTTGTAAGTAGAAAATGGTTGG + Intergenic
1011016486 6:82761542-82761564 TCTTCAATCTCCACAATGGAAGG + Intergenic
1011362545 6:86543372-86543394 ACTTGAAGGTAGACAGTGGAAGG + Intergenic
1012363014 6:98406907-98406929 TTTTGAATGGAGACAAGAGATGG - Intergenic
1013044826 6:106474760-106474782 TGTGGAATGGAGACAAGGGAGGG + Intergenic
1015859657 6:137662174-137662196 TCTTGAATTTATACAATGACTGG + Intergenic
1017746521 6:157451860-157451882 TCTTGAATATTAATAATGGAAGG + Intronic
1018498733 6:164379260-164379282 TCAGGAAAGTAGAAAATGGATGG - Intergenic
1019897746 7:3995633-3995655 TCCTGAATGAAGACACAGGAGGG - Intronic
1021335169 7:19391597-19391619 TTTTGAAAGTAGACACTGGGGGG - Intergenic
1021667660 7:23002411-23002433 TCTTCATGGTAGAAAATGGAAGG - Intronic
1022972591 7:35531175-35531197 TCATGAATATAGACAGTAGAAGG + Intergenic
1023237745 7:38108054-38108076 TCTTGGATGAAAAAAATGGATGG - Intergenic
1023397806 7:39767538-39767560 GCTGGAATATAGAAAATGGATGG + Intergenic
1024071422 7:45788853-45788875 GCTGGAATATAGAAAATGGATGG + Intergenic
1024408993 7:49016756-49016778 TCTTGAGAATAGAGAATGGAAGG + Intergenic
1024920547 7:54549560-54549582 ACTGGCATGTAGACAATGGGGGG + Intronic
1027204648 7:76088143-76088165 GCTGGAATATAGAAAATGGATGG - Intergenic
1028505787 7:91568822-91568844 TCTGGAGTGTGGACAAAGGATGG - Intergenic
1028687135 7:93603194-93603216 TCTAGAATCTAAACCATGGATGG + Intronic
1028949048 7:96613098-96613120 TCTAGAGTCTAGACAATGCATGG - Intronic
1030078947 7:105760886-105760908 ACTGGAATATAGACAATGAAAGG + Intronic
1030333564 7:108298762-108298784 TCTTGAAGAGAGACAAAGGAAGG - Intronic
1031199381 7:118660368-118660390 TCTGGAATGCAGACAGTGCAAGG + Intergenic
1032048052 7:128626429-128626451 GCTGGAATATAGAAAATGGATGG + Intergenic
1033139025 7:138808719-138808741 CCTTAAATGTAGACAATTAAGGG - Intronic
1033676830 7:143549670-143549692 TCCTGGAGGTAGACAATAGACGG - Intergenic
1033695005 7:143779765-143779787 TCCTGGAGGTAGACAATAGACGG + Intergenic
1035354147 7:158266956-158266978 TCTTGGATGTAGACGTGGGAGGG - Intronic
1036429168 8:8674066-8674088 TCTTGAAGCTAGACACTGCATGG - Intergenic
1038056581 8:23863994-23864016 TCTTGACTTGAGAAAATGGAGGG + Intergenic
1039202253 8:35108846-35108868 TCTTGAAAGTGGACCATGGTAGG + Intergenic
1039312013 8:36327092-36327114 TTTTGATTGCAAACAATGGAAGG + Intergenic
1041413633 8:57583375-57583397 CCCTGAATGTAGAAAATGGAAGG - Intergenic
1042403464 8:68376460-68376482 CCTTGAAAGTAGAGAATGAAGGG + Intronic
1043968561 8:86506026-86506048 TTTTGAATGGAGTCAAGGGAAGG + Intronic
1046183575 8:110684260-110684282 AGTTTAATGTACACAATGGATGG - Intergenic
1048114970 8:131511010-131511032 TGTTGAATGAATAAAATGGAAGG + Intergenic
1050029356 9:1368854-1368876 TCCTGACTGGAGAAAATGGAAGG + Intergenic
1050926363 9:11268612-11268634 TTTTAAATGTATACATTGGAAGG - Intergenic
1051233394 9:14975485-14975507 TCATGATTGTAGACAATGTGTGG - Intergenic
1058248347 9:102659446-102659468 TCATGTATGTAGACAGTAGAAGG + Intergenic
1058835749 9:108857306-108857328 GCTGTAATGTAGAGAATGGATGG + Intergenic
1059069735 9:111122799-111122821 TATTGATTGTAGACAATATATGG + Intergenic
1062751665 9:138258863-138258885 GCTGGAATATAGAAAATGGATGG + Intergenic
1186387241 X:9122215-9122237 TATACAATGTATACAATGGATGG - Intronic
1186913867 X:14198844-14198866 TCTTGAATGCAGCAAATGGTTGG + Intergenic
1187618870 X:21028394-21028416 TCTTGTATTTTGACAAGGGAGGG + Intergenic
1189135323 X:38543177-38543199 CCCTCCATGTAGACAATGGATGG + Intronic
1189915764 X:45854131-45854153 TCTTGAATGTAGACTAGTCATGG - Intergenic
1190616438 X:52238435-52238457 TCTCGAAGGTAGCCAATGGATGG - Intergenic
1192390120 X:70717210-70717232 TTTTGAATATATAGAATGGATGG - Intronic
1192875738 X:75227542-75227564 TCCTGAATATAGCTAATGGAAGG + Intergenic
1193727264 X:85057257-85057279 ACTGGAATGTGGACAAAGGATGG - Intronic
1196531450 X:116791781-116791803 TCTAGAATCTGGAAAATGGAAGG - Intergenic
1197377405 X:125698452-125698474 ACTTGAAGGTAGAGCATGGAAGG - Intergenic
1198481078 X:137041285-137041307 TCTTGAATGGAGGGATTGGATGG + Intergenic
1199355359 X:146856730-146856752 TTTTCAATGTAAATAATGGAGGG - Intergenic
1199864064 X:151827371-151827393 CCTTGATTGTTGACAATGAATGG - Intergenic