ID: 906787537

View in Genome Browser
Species Human (GRCh38)
Location 1:48629129-48629151
Sequence AGTACATAGTTAGATGCTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906787537 Original CRISPR AGTACATAGTTAGATGCTAG TGG Intronic
903037885 1:20506310-20506332 AGTACTGTGTTAGAAGCTAGAGG + Intronic
906787537 1:48629129-48629151 AGTACATAGTTAGATGCTAGTGG + Intronic
908475495 1:64483872-64483894 AGAACAGAGTTATATGCAAGGGG - Intronic
909138773 1:71836086-71836108 AGTACATAGTCAGAGATTAGGGG - Intronic
911559200 1:99383356-99383378 AGTCCCTAGTTAGAGGTTAGTGG - Intergenic
912359311 1:109081739-109081761 AGTACATAGTTGGATACTGAAGG + Intergenic
912657971 1:111504639-111504661 TGTACATATTTAGATGCTTAAGG - Intronic
913684946 1:121222709-121222731 TGTTCATAGTTAGGTACTAGTGG + Intronic
916287683 1:163128967-163128989 GGTACCTAGTCAGATGCTACTGG - Intronic
916358662 1:163942428-163942450 AATTCATAGTTAGAATCTAGAGG - Intergenic
919511404 1:198469844-198469866 AGTAGAAAGTTGGTTGCTAGAGG + Intergenic
921622886 1:217345846-217345868 AGTACAAGGATAGATGCTAGAGG + Intergenic
922447854 1:225712609-225712631 AGTAGATTGTTGGTTGCTAGGGG - Intergenic
1065446920 10:25812260-25812282 AGGCCATAGTTTCATGCTAGTGG + Intergenic
1065718229 10:28595549-28595571 ATTGCATATTTACATGCTAGTGG + Intronic
1069312081 10:67050732-67050754 AGTAAATAATTTGATGCGAGTGG - Intronic
1071239835 10:83693254-83693276 AATACTTATTTAGCTGCTAGGGG + Intergenic
1073419666 10:103414337-103414359 AGTACCTAATTATATGCTTGAGG - Intronic
1073538573 10:104299779-104299801 AGAAAATAGTTAGAAGCTACAGG - Intronic
1073847450 10:107573921-107573943 AATACATAGTTAGGTCATAGGGG + Intergenic
1078026981 11:7705332-7705354 AGTTCATAGTCCGATGATAGAGG - Intronic
1081516320 11:43833882-43833904 AGTACATAATTACATTATAGAGG + Intronic
1081552428 11:44126310-44126332 AGCACACTGTTAGATGCTATGGG + Intronic
1082726540 11:56743586-56743608 AGTACATAGGTGTATGCAAGTGG + Exonic
1086008683 11:82071541-82071563 AGTACAAAGTTAGATAGAAGTGG - Intergenic
1086253863 11:84850515-84850537 AGTACATTGTTGGATACAAGTGG - Intronic
1093961695 12:25280659-25280681 AGTATATAGATATATGTTAGTGG - Intergenic
1099065492 12:77973309-77973331 ATTACATAGATAGATGATAGAGG + Intronic
1099214172 12:79834060-79834082 GGTACATTGTTAGATGCTACAGG + Intronic
1101195888 12:102381829-102381851 AGTATAAAGTTAGAGGCTAAAGG - Intergenic
1101305261 12:103521718-103521740 AGTCCCTAGTTAGAGGTTAGTGG - Intergenic
1101865650 12:108517752-108517774 AGTGCATTGTTAGATGGTGGTGG + Intronic
1102360058 12:112278175-112278197 AGTAGATTGGTAGATGCCAGGGG + Intronic
1108961145 13:56231961-56231983 AGTACATATTTATAAGTTAGTGG - Intergenic
1120800583 14:88683921-88683943 AGTACATTGTTAAATGTAAGTGG - Intronic
1123020434 14:105395474-105395496 GGTACATAGTGAGATGCTGCTGG + Exonic
1128645351 15:69374775-69374797 AGGGAATAGTTAGAGGCTAGCGG - Intronic
1130162127 15:81412253-81412275 AGTACATAGTGAGATTACAGTGG - Intergenic
1131848178 15:96510189-96510211 ACTACGCAGTTAGATGATAGTGG + Intergenic
1134461929 16:14437011-14437033 AATAAATAGATAGATGCTGGAGG - Intronic
1135646096 16:24163274-24163296 AGGACATAGTTATAGGCTAGTGG + Intronic
1137913434 16:52402966-52402988 AGTACTGAGACAGATGCTAGGGG + Intergenic
1148136709 17:45297293-45297315 AGTAGATGGGCAGATGCTAGGGG - Intronic
1150726660 17:67656514-67656536 CGTTCATAGATAGATACTAGGGG + Intronic
1155469510 18:26176303-26176325 AGTACATAGTTAGTGGCTTCAGG - Intronic
1156286865 18:35705385-35705407 ATTAGATTGTTAGATCCTAGAGG + Intronic
1156410356 18:36822331-36822353 AAGACATAGTTAGAATCTAGAGG - Intronic
929307126 2:40376219-40376241 TGTACATTGTTAGATGCTTAAGG - Intronic
930960749 2:57258558-57258580 AGCAGAGAGTTAAATGCTAGAGG - Intergenic
933099735 2:78238398-78238420 AGAACATAGTTACAAGCCAGAGG - Intergenic
935209942 2:100930879-100930901 AGTCTATAGTTTGATCCTAGTGG + Intronic
935352882 2:102169294-102169316 AGTGCAGAGCTAGATGCTTGTGG - Intronic
936004598 2:108872433-108872455 ACTACATAGTTATATGCAAAAGG + Intronic
942956178 2:181776010-181776032 AGTCTATAGTTTAATGCTAGAGG - Intergenic
943766203 2:191665122-191665144 AGTACAGAGGTAGATTCTAGGGG - Intergenic
944612355 2:201424490-201424512 AGTGCATAGTTATAAACTAGTGG - Intronic
944824696 2:203470204-203470226 AGTAAATAGTTACATGCATGTGG + Intronic
945700440 2:213162815-213162837 AGAACATAGTGGGAAGCTAGTGG - Intergenic
946162568 2:217844931-217844953 AATACAATGTTAGATGCAAGTGG + Intronic
946823838 2:223656419-223656441 GGTACATAGTTAGTGGTTAGTGG - Intergenic
1170552963 20:17492832-17492854 AGTACAAAGATAGATACTGGAGG + Intergenic
1184233929 22:43173115-43173137 TGTACATAGTCAGAGGCTGGCGG - Intronic
949574015 3:5321234-5321256 AGCACAGAGATAGATGCTTGAGG + Intergenic
951138568 3:19133892-19133914 CGTACTTAGTTAAATGGTAGGGG + Intergenic
952844051 3:37672040-37672062 AGTATCCAGATAGATGCTAGTGG + Intronic
958551983 3:95626664-95626686 TGCGCATAGTAAGATGCTAGTGG + Intergenic
958675393 3:97263994-97264016 AGAAAAAAGTTAGATTCTAGGGG - Intronic
963268690 3:143264890-143264912 AGGAGATAGATAGATACTAGAGG - Intergenic
967913068 3:194557893-194557915 AGTACATGGTGAGATGCAGGAGG + Intergenic
973830948 4:54758150-54758172 AGTACATATATAGATGTTATAGG + Intergenic
978214070 4:106176347-106176369 AGTAGATTGATAGTTGCTAGAGG - Intronic
981444284 4:144817781-144817803 AGTACAAAGATAGATACCAGAGG + Intergenic
983802299 4:171947776-171947798 AGTACATATTAGGCTGCTAGTGG - Intronic
989232006 5:39097534-39097556 AGTACAATGATAGATACTAGAGG - Intergenic
990039276 5:51359654-51359676 AGTGCAATGATAGATGCTAGAGG - Intergenic
990663458 5:58045236-58045258 AGTCCATAGTTAGATTTTGGTGG - Intergenic
994138156 5:96311778-96311800 AGGACATACTTAGATGAAAGTGG - Intergenic
999000813 5:147921154-147921176 AGTACTTAGGTAGGTGCTTGAGG + Intergenic
1000024368 5:157346096-157346118 ATTACATAGTTATATGGTACTGG + Intronic
1001999316 5:176188711-176188733 AGTGCTTATTTAGCTGCTAGAGG + Intergenic
1008460047 6:51758090-51758112 AGAACATTGTTAGGTGCTATGGG - Intronic
1009768360 6:68111818-68111840 AGTACATATTAAGATGCCACGGG - Intergenic
1013713120 6:112924700-112924722 AGAATGTTGTTAGATGCTAGGGG + Intergenic
1015369406 6:132434137-132434159 AGTACATATTTATATAGTAGGGG - Intergenic
1017565095 6:155675280-155675302 AGTACATTCTTAGAGGATAGGGG + Intergenic
1017570016 6:155734239-155734261 AGTACATTGTGAGATCCTTGAGG - Intergenic
1017900755 6:158716708-158716730 AATACATAGTGAGAGGATAGAGG + Intronic
1018960394 6:168443312-168443334 AGTAAATAGTTAGATGAGACAGG - Intronic
1023513095 7:40973977-40973999 TGTTCATAGTTAGCTGCTAATGG + Intergenic
1038439031 8:27558846-27558868 AGTACCTAGTTAGAGGCTGGGGG + Intergenic
1039409850 8:37343586-37343608 AGGCCATACTTAGATGCAAGTGG - Intergenic
1039631220 8:39113554-39113576 TGTACAAAGTGAGATGCTAGTGG - Intronic
1041701029 8:60789147-60789169 AATACACAGCTAGATGGTAGAGG - Intronic
1042055165 8:64756641-64756663 AGCAGATTGTGAGATGCTAGCGG - Intronic
1042491681 8:69406425-69406447 AATACGTAGTGAGAGGCTAGGGG - Intergenic
1043791331 8:84470806-84470828 AGTATATAATTATATGTTAGAGG + Intronic
1044588461 8:93890356-93890378 AGTACATAGGTAAATGATATTGG - Intronic
1044889243 8:96814970-96814992 AGTACATTGGTAGTTGCCAGGGG + Intronic
1046454203 8:114438002-114438024 AGAACATACATACATGCTAGAGG - Intergenic
1050753588 9:8971591-8971613 ATTACATGTTTAGATTCTAGTGG + Intronic
1051426859 9:16940783-16940805 AGTACATAATGAGAAGCAAGGGG - Intergenic
1051507915 9:17845810-17845832 AGTCCATAGTTAGAGGTTAGTGG + Intergenic
1060361496 9:122962542-122962564 AGTACATTGTAAGTTCCTAGAGG + Intronic
1192374139 X:70541970-70541992 AGTTGATATTTAGAAGCTAGTGG - Intronic
1193413246 X:81190503-81190525 AGTAGATTGGTAGTTGCTAGAGG - Intronic
1196466584 X:115978055-115978077 ATTCCATTGTAAGATGCTAGAGG - Intergenic
1200492886 Y:3850170-3850192 AATACATACTCAGAGGCTAGTGG - Intergenic
1201192237 Y:11454625-11454647 AGTAAATCGTTGGTTGCTAGAGG - Intergenic