ID: 906791982

View in Genome Browser
Species Human (GRCh38)
Location 1:48667142-48667164
Sequence GTACATCTCCACCTCTTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 96}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906791982_906791983 -3 Left 906791982 1:48667142-48667164 CCTTTCAAGAGGTGGAGATGTAC 0: 1
1: 0
2: 0
3: 7
4: 96
Right 906791983 1:48667162-48667184 TACTCCTCTGTCCTTCAGTGTGG 0: 1
1: 0
2: 1
3: 20
4: 307
906791982_906791986 2 Left 906791982 1:48667142-48667164 CCTTTCAAGAGGTGGAGATGTAC 0: 1
1: 0
2: 0
3: 7
4: 96
Right 906791986 1:48667167-48667189 CTCTGTCCTTCAGTGTGGGCTGG 0: 1
1: 0
2: 6
3: 81
4: 387
906791982_906791984 -2 Left 906791982 1:48667142-48667164 CCTTTCAAGAGGTGGAGATGTAC 0: 1
1: 0
2: 0
3: 7
4: 96
Right 906791984 1:48667163-48667185 ACTCCTCTGTCCTTCAGTGTGGG 0: 1
1: 0
2: 3
3: 45
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906791982 Original CRISPR GTACATCTCCACCTCTTGAA AGG (reversed) Intronic
900179239 1:1304116-1304138 GTCCGTCTCCACCTCGTCAATGG + Exonic
903784949 1:25854282-25854304 ATGAAGCTCCACCTCTTGAAGGG + Intronic
904146212 1:28394133-28394155 CTACATCTTGACTTCTTGAAAGG - Intronic
906699514 1:47847720-47847742 GGACATTTCCCCCTCTTGACTGG - Intronic
906791982 1:48667142-48667164 GTACATCTCCACCTCTTGAAAGG - Intronic
907523000 1:55037497-55037519 GTACATTTCAACATTTTGAACGG - Intergenic
908299813 1:62752989-62753011 GTAAATTTCAAGCTCTTGAAAGG - Intergenic
913509270 1:119547589-119547611 GCACCTCTCCAGCTCTTGTAAGG + Intergenic
913681699 1:121192039-121192061 TTTCATCTCCTGCTCTTGAAGGG - Intronic
914033535 1:143979665-143979687 TTTCATCTCCTGCTCTTGAAGGG - Intergenic
914155912 1:145088307-145088329 TTTCATCTCCTGCTCTTGAAGGG + Intronic
917649510 1:177063051-177063073 CTACTTCTCTACCTATTGAAAGG - Intronic
917725139 1:177820961-177820983 GTCCCTCTCCACCTCTGGACAGG + Intergenic
920469015 1:206210555-206210577 TTTCATCTCCTGCTCTTGAAGGG - Intronic
1063042445 10:2357270-2357292 GTTCATATCCACCACTTGATTGG + Intergenic
1064873434 10:19965394-19965416 GCACATATCCACCTGTTCAATGG - Intronic
1067757883 10:49018949-49018971 GTACAGGTCCACCTTGTGAAAGG + Exonic
1071198067 10:83184752-83184774 GTAAGGCTCCACCTCTTGAAGGG + Intergenic
1071672156 10:87618826-87618848 GGACATCTCCACCCCTGAAAGGG - Intergenic
1071915283 10:90288571-90288593 ATATAGCTCCACCTCTTGATGGG - Intergenic
1074789239 10:116869635-116869657 TACCATCTCCACCTCTTGCAAGG - Intronic
1089779869 11:120866234-120866256 GTTCACCTCCACCTCTGGGAAGG + Intronic
1090433418 11:126665663-126665685 GGACTTCTCCACCTCCAGAATGG + Intronic
1092124189 12:6064245-6064267 GTCCAGCTCCCCCTCCTGAAAGG - Exonic
1095495437 12:42779262-42779284 GTAAACCTCCATCTCCTGAAAGG - Intergenic
1096651871 12:53065836-53065858 GTAGATCTGCACCCCTTGAGTGG - Exonic
1098321943 12:69254600-69254622 TTACTTCTCCAGCTCTAGAATGG + Intronic
1099123088 12:78717354-78717376 TTACAGCTCCACGGCTTGAATGG - Intergenic
1102272363 12:111548637-111548659 GTACTTTTCCACATCTTGAATGG - Intronic
1107410980 13:40158590-40158612 ATTCAACTCCACCTCTTGATGGG + Intergenic
1109714441 13:66203151-66203173 GTACATATTTAGCTCTTGAAGGG + Intergenic
1109915609 13:68981898-68981920 ATTAATCTCCACCTCCTGAAGGG - Intergenic
1110271545 13:73596797-73596819 GTACATCTCCAATTTTTAAAGGG + Intergenic
1110843117 13:80165323-80165345 GTTCATCTCTGCCTTTTGAAAGG + Intergenic
1111955872 13:94757951-94757973 TGACATCTCCAACTCTTGTAGGG + Intergenic
1114580226 14:23750620-23750642 TGACATCTCCAGCTCTTGTAGGG - Intergenic
1115788210 14:36850107-36850129 ATACATCTCTTCCTCTGGAAGGG - Intronic
1116879457 14:50150109-50150131 GTCCACCTCCACCAATTGAATGG - Exonic
1119623007 14:76147026-76147048 GTACATATCTATCTCTTGGATGG - Intergenic
1120376322 14:83712223-83712245 GTACATCTTCCCCTCTAAAAAGG - Intergenic
1124134029 15:27018280-27018302 CTAAATTTCCACCTCCTGAAAGG - Intronic
1139156697 16:64451986-64452008 GTACATCTCCTCCTCTGAACTGG + Intergenic
1149260409 17:54874335-54874357 GTACCTTTCCACATCTGGAAAGG + Intergenic
1150211169 17:63442299-63442321 GTACACCCCCACCTCTGGCATGG - Intronic
1150556972 17:66263129-66263151 GTACATCTCCAGGTCTCCAAGGG + Intergenic
1152545209 17:80997014-80997036 GATCCTCTCCACCTCTTCAATGG - Exonic
1159639687 18:70849045-70849067 GTACATCTGCATATCTTGGAGGG - Intergenic
1159781377 18:72664465-72664487 GTAAATCCTCACCTCTTGATAGG - Intergenic
1161641558 19:5426877-5426899 GTACATCTCCCCCACTGGGAGGG - Intergenic
1162223445 19:9199305-9199327 GCAGCTCTCCACCTCCTGAAAGG + Intergenic
1164974156 19:32559364-32559386 GTATAGCTCCACCCATTGAAAGG + Intergenic
1167144724 19:47674935-47674957 ATTGAGCTCCACCTCTTGAAAGG + Intronic
1168667453 19:58215124-58215146 GTTAAACTCCATCTCTTGAAGGG + Intergenic
927517234 2:23679552-23679574 AATCATCTCCACCTCTTGACGGG + Intronic
930593167 2:53354440-53354462 GTACATCCCAAACTCATGAATGG + Intergenic
933502090 2:83126244-83126266 ATAAATCTCCACCTCTTTAATGG - Intergenic
933833211 2:86226817-86226839 ATTAATCTCCACCTCTTGAAGGG - Intronic
934020879 2:87950581-87950603 GTTCAGCTTCACTTCTTGAAAGG - Intergenic
934895838 2:98118833-98118855 TTGCCTCTCTACCTCTTGAAAGG + Intronic
947517579 2:230820935-230820957 ATACATCTCCACTTTTTTAAGGG - Exonic
1168780785 20:487957-487979 GTCCATCTCCTCCTGTTGAGTGG + Intronic
1173987898 20:47276687-47276709 GTAAACCTCCATCTCTTGCATGG + Exonic
1177856223 21:26403647-26403669 CTACTTTTCCACCTCTTGAAAGG + Intergenic
1178789489 21:35686904-35686926 TTATATTTCCACCTCTTCAAGGG + Intronic
1183771992 22:39934629-39934651 GGACCTCTCCACCTCTGCAACGG - Intronic
950691046 3:14658157-14658179 GTCCTTCTCCATCTCTAGAATGG + Intronic
952701080 3:36328340-36328362 GAACATGTTGACCTCTTGAATGG + Intergenic
953618925 3:44515756-44515778 GTCCAGCTCCATCTCTTGAAGGG - Intergenic
955802455 3:62700230-62700252 ATTAAGCTCCACCTCTTGAAGGG - Intronic
958723673 3:97877211-97877233 ATACTTGTCCTCCTCTTGAAGGG - Exonic
964757546 3:160102258-160102280 TGACATCTCCATCTCTTGTAGGG - Intergenic
967540741 3:190664790-190664812 ATTCAGCTCCACCTCTTGGATGG + Intergenic
967861336 3:194154163-194154185 GAAAAACTCCACCTCTTGACTGG - Intergenic
968617865 4:1588334-1588356 ATTAAGCTCCACCTCTTGAAGGG - Intergenic
970623632 4:17852705-17852727 GTCCATCTCCACCATCTGAATGG + Intronic
974679159 4:65138237-65138259 GCACCTCTTCACCTCTTTAAAGG + Intergenic
976543344 4:86304008-86304030 GTCCATTTCCAAGTCTTGAACGG + Intronic
977317327 4:95466847-95466869 GTTAGACTCCACCTCTTGAATGG - Intronic
990103916 5:52231984-52232006 GTCCATCTCCTGCTCTTGAAAGG - Intergenic
996805778 5:127452638-127452660 TATCATCTCCACCTCTGGAAGGG - Intronic
998905039 5:146895827-146895849 GTCCATCTCCACCACAGGAAAGG + Intronic
1002842405 6:917615-917637 ATCCATCTCCTCCTCTTGACAGG - Intergenic
1005477270 6:26219986-26220008 GGACAGCTCCATCTCTGGAATGG - Intergenic
1008786584 6:55175323-55175345 GTTCATTACCACCTCTTGACTGG - Intronic
1008946330 6:57101076-57101098 GGACATCTCCACCTCTAAAGAGG + Intronic
1008948072 6:57121511-57121533 ATACCTCTCCACTTCTTGAGAGG + Intronic
1009296130 6:61950224-61950246 GTACAGCTCCAAGACTTGAATGG + Intronic
1011474999 6:87742663-87742685 GTTAAGTTCCACCTCTTGAAAGG + Intergenic
1015426640 6:133077844-133077866 GTGCACCTCTACCTCTTCAATGG + Intergenic
1021378144 7:19934240-19934262 GTACATTTCCATCACTTCAAAGG - Intergenic
1027156375 7:75771211-75771233 GTACAACTCCACCAATTTAAAGG + Intronic
1029669547 7:102019684-102019706 GTACAACTCCACCACGGGAAGGG - Intronic
1030297521 7:107943863-107943885 CTCCAGCTCCACCTTTTGAAGGG - Intronic
1038048081 8:23784064-23784086 GTGGATCCCCACCTCATGAAAGG - Intergenic
1040644366 8:49381166-49381188 AAACATCTGCACCTCTTTAAAGG + Intergenic
1044326342 8:90863052-90863074 GTCCATCTCAAGCGCTTGAATGG + Intronic
1044656866 8:94557643-94557665 GAACAGCTCCCTCTCTTGAAGGG + Intergenic
1045317221 8:101053554-101053576 ATTCAGCTCCATCTCTTGAAGGG - Intergenic
1046640801 8:116728696-116728718 AGACCTCTCCACTTCTTGAAAGG + Intronic
1195416780 X:104628968-104628990 GTCTATCTCCATCTCTTTAATGG - Intronic
1196111565 X:111952247-111952269 GTAGATCTCAGCCTCCTGAAGGG + Exonic
1199123645 X:144088546-144088568 GTTCAGCTTCACTTCTTGAAAGG + Intergenic
1199497580 X:148470419-148470441 GTTCATGTCCTCCTCTTCAAAGG - Intergenic
1200046453 X:153405353-153405375 ATCCAGCTACACCTCTTGAAAGG - Intergenic