ID: 906793614

View in Genome Browser
Species Human (GRCh38)
Location 1:48679427-48679449
Sequence AAGCCTGCTCAGTACAACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906793611_906793614 -2 Left 906793611 1:48679406-48679428 CCTGACAGGCCTAGGACGATGAA 0: 1
1: 0
2: 0
3: 1
4: 54
Right 906793614 1:48679427-48679449 AAGCCTGCTCAGTACAACCAGGG 0: 1
1: 0
2: 1
3: 10
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906793614 Original CRISPR AAGCCTGCTCAGTACAACCA GGG Intronic
906793614 1:48679427-48679449 AAGCCTGCTCAGTACAACCAGGG + Intronic
907332402 1:53679692-53679714 AAGCATGCTCAGAGCAGCCAAGG - Intronic
908000023 1:59670770-59670792 CAGCCTGCTCTGTACAAGCAGGG + Intronic
910666384 1:89729355-89729377 AAGCCTGCTTAGACCAACCCAGG - Intronic
912509681 1:110180432-110180454 CAGCCAGCTCAGCTCAACCATGG - Intronic
918088229 1:181263531-181263553 AAGGCTGCTCCTTACAACCAAGG + Intergenic
1063246398 10:4224176-4224198 AAAGCTACTCAGAACAACCACGG - Intergenic
1063381688 10:5589850-5589872 AAGCCTGCCCCGAACAACCTCGG - Intergenic
1063865113 10:10355854-10355876 AAGTCTGTGCAGTAAAACCAAGG + Intergenic
1065574641 10:27105156-27105178 AAGCCTGCTCACGAAGACCATGG + Intergenic
1067656099 10:48192739-48192761 AGGCCTGCTGAGTACATCAATGG - Exonic
1070139131 10:73723808-73723830 AAGCCTCCTGAGTACAGCAAAGG - Intergenic
1070528595 10:77316613-77316635 TAGCCTGCTTATTACAAGCAAGG + Intronic
1074969448 10:118523784-118523806 AACCCTTCTCAGCATAACCATGG + Intergenic
1085014395 11:73163390-73163412 AAGCCAGCTCAAGACAACCCTGG + Intergenic
1087446744 11:98265067-98265089 AACATTGTTCAGTACAACCAAGG + Intergenic
1092542095 12:9426374-9426396 AAGAGTGCTCAGTACAATCTAGG + Intergenic
1094039146 12:26104678-26104700 GAGCATGCACAGCACAACCAAGG - Intergenic
1099976099 12:89546842-89546864 AAGGAGGCTCACTACAACCAAGG + Intergenic
1104389724 12:128381575-128381597 AAGCCTGCTCAGTCCTTCCTAGG + Intronic
1105577671 13:21669272-21669294 AAGCCCGCTCTGTACCACCGCGG + Intergenic
1106132499 13:26951870-26951892 CAGCCTGCTAATTCCAACCAAGG + Intergenic
1107054244 13:36086286-36086308 GAGTCTGCTCTGTACCACCAGGG + Intronic
1111800257 13:92972538-92972560 AAGCATACACAGTACAACCTGGG - Intergenic
1113143048 13:107175817-107175839 AAGACTGCTAACTTCAACCAAGG - Intronic
1113423750 13:110190438-110190460 AAACCTGCTCAGACCAACCTGGG + Intronic
1117662277 14:58020201-58020223 AAGCCTGTTCAGTACACCCATGG + Intronic
1120550354 14:85863813-85863835 AAGCATGCTCAGAACAAGAAGGG - Intergenic
1121565944 14:94909021-94909043 AAGCCTGCTGACTCCAAACATGG + Intergenic
1122573870 14:102728383-102728405 AAGCCTGCTGTGTACACCGAGGG + Exonic
1125237950 15:37537884-37537906 AAGCCTGCTGAGAACCACTATGG - Intergenic
1125551540 15:40548706-40548728 ATGCCGGCTCAGAACTACCAAGG + Intronic
1129752641 15:78076972-78076994 AAGGCTGCACAGGACATCCACGG + Intronic
1132674382 16:1115639-1115661 AGGCTTGCTCAGCAGAACCATGG + Intergenic
1135903778 16:26491486-26491508 GAGCCTACTCAGGGCAACCATGG + Intergenic
1137368163 16:47878793-47878815 AACCCTGCTCAGGACCTCCAGGG - Intergenic
1140248234 16:73270700-73270722 CAGGCTGCTCATTAGAACCAGGG + Intergenic
1142896124 17:2980319-2980341 AAGCTTGCTCAGTCCAGCCAAGG - Exonic
1143212274 17:5197167-5197189 AAGTCTGTTTAATACAACCACGG - Intergenic
1145224378 17:21115936-21115958 ATTCCTGCTCAGTAGAACCCAGG - Intergenic
1146666228 17:34705840-34705862 AGTCCTGATCAGTGCAACCAGGG + Intergenic
1149538156 17:57448454-57448476 AAACCTGTTCCGTACACCCACGG - Intronic
1150782537 17:68134790-68134812 AAGCCTGAGCAGTCCAACCGGGG - Intergenic
1151186621 17:72369482-72369504 AAGCCTGCTCCATACTTCCAGGG - Intergenic
1151304019 17:73251340-73251362 AAGCCTGCTCAGAACCAGCAGGG + Intronic
1153300803 18:3590465-3590487 AACCCTGCTCTGTACACACAGGG - Intronic
1155834677 18:30566522-30566544 AATCCTGCTAAATACAACAAAGG + Intergenic
1156317405 18:35983345-35983367 AAGACAGCTCAGTATAGCCATGG + Intergenic
1159038185 18:63297533-63297555 AAGGCTGCTCTGTGCCACCAAGG - Intronic
1163032549 19:14553903-14553925 AGCCCTGGTCAGTGCAACCAGGG - Intronic
1163441519 19:17324538-17324560 AAGCCTGCTTAGTATCTCCAGGG - Intronic
1163863433 19:19754301-19754323 AAGTCTGGTCAGTAAAAACATGG - Intergenic
1164030644 19:21400644-21400666 CAGCCTGCTCACTCCAGCCATGG + Intronic
1164225934 19:23245978-23246000 TAGCCTGCTCACTCCAGCCATGG - Intronic
925270148 2:2600044-2600066 ATGCTTGCTCAGTACACACAAGG - Intergenic
930243040 2:48955825-48955847 ATGCATGCTCAGTGCAACCAGGG - Intergenic
931758563 2:65395979-65396001 AAGCCTGCTCAGTTCAAATCTGG + Intronic
938679578 2:133675970-133675992 AAGTCTTCTCAGTAAAACAATGG - Intergenic
940899849 2:159116608-159116630 AAGGCTGCTCTGTACTACGATGG - Intronic
944494346 2:200291210-200291232 CAGCCTGCTCAGTTCAGCCCAGG - Intergenic
944916542 2:204366502-204366524 AAGCCTGCTTAGCATAACAAAGG + Intergenic
945999364 2:216468090-216468112 AAGCCTGCTTAGAACAACTTGGG - Intronic
946248856 2:218401187-218401209 ACCCCTGCTCAGGACAGCCAGGG - Intronic
1172928413 20:38562624-38562646 AAACATGCCCAGTCCAACCAGGG - Exonic
1173776156 20:45708193-45708215 TAGCCTGATGAGTGCAACCAAGG - Exonic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1177427790 21:20947429-20947451 GATCCTGCTTAGTACAACAAAGG + Intergenic
1181416966 22:22767210-22767232 AAGTCTTTTCAGTACAACCTGGG + Intronic
952498736 3:33939104-33939126 AAGCCTGCTCAGCAATAACAGGG - Intergenic
952670046 3:35955398-35955420 AAGCCTCCTCAGTTCTACCAGGG + Intergenic
952791196 3:37201923-37201945 AACCCTGCTTGGTACAACAAGGG + Intergenic
956331547 3:68115809-68115831 AAGCCTGCTCAATGTAACTAGGG + Intronic
961135523 3:124506348-124506370 ATGCGTGCTCAACACAACCAGGG - Intronic
964045328 3:152317115-152317137 AGACCTGCTAACTACAACCAAGG - Intronic
967206135 3:187123677-187123699 AACCCTAACCAGTACAACCAGGG - Intronic
969159951 4:5247973-5247995 AAGTCTGCTCAGGGCAGCCATGG + Intronic
980093810 4:128468976-128468998 CAGCCTTCCCAGTACAACCATGG + Intergenic
982721373 4:158863472-158863494 ATGGCTGCTCAGCACTACCAGGG + Intronic
983814815 4:172110636-172110658 GAGTCTGTTCTGTACAACCAAGG - Intronic
985468163 5:17520-17542 AATCCTCCTCAGTACTATCAAGG + Intergenic
985480389 5:107001-107023 AGGCCTGCTCAGTGCAGACATGG + Intergenic
985797589 5:1974757-1974779 AACTCTGCTCACTACATCCAGGG - Intergenic
996253451 5:121368222-121368244 AAGACTGCCCAGTCCAAACATGG - Intergenic
1001170372 5:169413844-169413866 TTGCCTTCTCAATACAACCATGG - Intergenic
1002592142 5:180298208-180298230 AAGGCTGCTCTGTACAAACCAGG + Intergenic
1004525568 6:16404329-16404351 AAACATGCTCAGTTCAAACAAGG - Intronic
1007582875 6:42969613-42969635 AAGCCTGCTTAGAACATCCCTGG - Intronic
1014965906 6:127750145-127750167 CAGCCTTCTCATTACAACCTAGG - Intronic
1018618858 6:165711715-165711737 AAGCCTGTTCAGAACAACCCAGG + Intronic
1025265624 7:57454528-57454550 CAGCCTGCTCACTCCAGCCATGG + Intronic
1029321326 7:99763129-99763151 CAGCCTGCACAGCACACCCAGGG + Intronic
1031422876 7:121570188-121570210 AACCATGCTCAGTCCAACCTTGG + Intergenic
1031575471 7:123410676-123410698 AAGCCTCCTCAGTACATGCCAGG - Intergenic
1035357214 7:158283452-158283474 CAGGCTTCTCAGTAGAACCAGGG + Intronic
1035514084 8:217083-217105 AATCCTCCTCAGTACTATCAAGG + Intergenic
1038424890 8:27458662-27458684 CAGCCTGAGCAGTACAGCCAGGG - Exonic
1040288348 8:46111776-46111798 CAGCCTGCTCAGGACAGCCCTGG + Intergenic
1040292268 8:46131593-46131615 CAGCCTGCCCAGGACAACCCTGG + Intergenic
1040310878 8:46236210-46236232 CAACCCGCTCAGTACAACCCTGG - Intergenic
1040340048 8:46435891-46435913 CAGCCTGCCCAGGACAACCCTGG + Intergenic
1040341371 8:46442825-46442847 CAGCCTGCCCAGGACAACCCTGG + Intergenic
1040341441 8:46443167-46443189 CAGCCTGCTCAAGACAACCCAGG + Intergenic
1040455633 8:47594595-47594617 AAGCCTGCTCTCTTTAACCAAGG - Intronic
1040518398 8:48153474-48153496 AAGCCTGCTCTCTCCAACCAAGG + Intergenic
1040545113 8:48393022-48393044 ACGACTGCTCAGAACAACCCAGG + Intergenic
1043406397 8:79938953-79938975 TAGCCAGCTCAGCACATCCAAGG - Intronic
1047378447 8:124329534-124329556 AAACTTGGTCAGTAAAACCAAGG + Intronic
1048746548 8:137620853-137620875 AAGCCAGCTCACTACAACAAAGG - Intergenic
1053252541 9:36587157-36587179 AAGCCTGATGACTAAAACCATGG - Intronic
1053523449 9:38805216-38805238 AATACAGCACAGTACAACCATGG - Intergenic
1054195677 9:62029635-62029657 AATACAGCACAGTACAACCATGG - Intergenic
1054642730 9:67559054-67559076 AATACAGCACAGTACAACCATGG + Intergenic
1057772206 9:97978736-97978758 AAGCCACCTCAGTAGTACCAGGG + Intergenic
1058318197 9:103595182-103595204 AACCTTGCTCAGGACATCCATGG - Intergenic
1061808146 9:133147909-133147931 AGGCCTCCTCACTCCAACCAGGG + Intronic
1185811788 X:3117146-3117168 AAGCAAGCTATGTACAACCAAGG + Intergenic
1186384543 X:9095422-9095444 TAGCATGCTCAGCACAGCCAAGG + Intronic
1193819613 X:86146741-86146763 GATCCTGCTAAGTACAACTAGGG + Intergenic
1201800643 Y:17951368-17951390 AAGCCTGAGCTGTCCAACCATGG + Intergenic
1202360418 Y:24103886-24103908 AAGCCTGAGCTGTCCAACCATGG + Intergenic
1202510360 Y:25566232-25566254 AAGCCTGAGCTGTCCAACCATGG - Intergenic