ID: 906793618

View in Genome Browser
Species Human (GRCh38)
Location 1:48679438-48679460
Sequence GTACAACCAGGGCCACAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 251}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906793611_906793618 9 Left 906793611 1:48679406-48679428 CCTGACAGGCCTAGGACGATGAA 0: 1
1: 0
2: 0
3: 1
4: 54
Right 906793618 1:48679438-48679460 GTACAACCAGGGCCACAGTGGGG 0: 1
1: 0
2: 2
3: 26
4: 251
906793612_906793618 0 Left 906793612 1:48679415-48679437 CCTAGGACGATGAAGCCTGCTCA 0: 1
1: 0
2: 3
3: 3
4: 83
Right 906793618 1:48679438-48679460 GTACAACCAGGGCCACAGTGGGG 0: 1
1: 0
2: 2
3: 26
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906793618 Original CRISPR GTACAACCAGGGCCACAGTG GGG Intronic
902379023 1:16043967-16043989 ATCCCACCAGGGCCAAAGTGAGG - Intronic
906474175 1:46156746-46156768 GCAGTACCAGGGCCAGAGTGTGG - Intronic
906793618 1:48679438-48679460 GTACAACCAGGGCCACAGTGGGG + Intronic
907023768 1:51095037-51095059 GTACCAGCTTGGCCACAGTGGGG + Intergenic
908113605 1:60920507-60920529 TTAAAGCCAGGACCACAGTGAGG + Intronic
910379263 1:86608770-86608792 GTACCAGCATGGCCACAGTGGGG - Intergenic
912036637 1:105324739-105324761 GTACCAGCATGGCCACAGAGTGG - Intergenic
914253053 1:145937687-145937709 CTACTACCAGGGCAACAGGGAGG - Exonic
917300575 1:173570143-173570165 GTACCAGCTTGGCCACAGTGGGG - Intronic
917712863 1:177704842-177704864 GTACAACCAGGGCCTCTGGTGGG - Intergenic
918199663 1:182255361-182255383 GTACAGCAAGGGCCCCAGAGAGG + Intergenic
919272065 1:195360601-195360623 GTACTAGCATGGCCACAGTGGGG + Intergenic
921823124 1:219640599-219640621 GTACCAGCTGAGCCACAGTGGGG + Intergenic
923879003 1:238083477-238083499 GTACCAGCATGGCCACAGTGGGG - Intergenic
1063719990 10:8570426-8570448 CTACAACCTGGGCAACAGAGTGG - Intergenic
1066178180 10:32932531-32932553 ATACAAGCAGGGCCAAATTGTGG - Exonic
1068241901 10:54313407-54313429 GTACAACAAGGGAGATAGTGAGG + Intronic
1068935975 10:62636175-62636197 CCACACCCAGGGCCACACTGTGG + Intronic
1069754831 10:70767547-70767569 CTCCAACCTGGGCCACAGAGTGG + Intergenic
1070628991 10:78070963-78070985 ACACAAACAGTGCCACAGTGTGG - Intergenic
1071197225 10:83175480-83175502 GTACCAACACTGCCACAGTGGGG - Intergenic
1073393313 10:103197272-103197294 GGCCATCCAAGGCCACAGTGGGG - Intergenic
1073786040 10:106890724-106890746 GTACAAACAGGGCCAATGTTAGG - Intronic
1075496393 10:122922958-122922980 GTACGAGCTCGGCCACAGTGGGG + Intergenic
1076746405 10:132517024-132517046 GTCTGGCCAGGGCCACAGTGGGG + Intergenic
1076808819 10:132876111-132876133 GGACACCCCTGGCCACAGTGAGG - Intronic
1078132465 11:8624161-8624183 GATCAGCCATGGCCACAGTGAGG + Intronic
1080128581 11:28766740-28766762 GTACTAGCTTGGCCACAGTGGGG + Intergenic
1081073712 11:38642351-38642373 GTACCAGCTTGGCCACAGTGGGG - Intergenic
1082183798 11:49154375-49154397 CTCGAACCTGGGCCACAGTGAGG + Exonic
1082788375 11:57330226-57330248 GTCCAGCCCGGGCCACAGCGAGG + Intronic
1083659084 11:64243920-64243942 TGCCAACCAGGGCCACAGGGAGG - Intronic
1084330114 11:68425201-68425223 CCACCACCAGGGCCACAGGGCGG - Exonic
1085178451 11:74511275-74511297 ATACCACCTTGGCCACAGTGGGG + Intronic
1086682561 11:89690977-89690999 CTCGAACCTGGGCCACAGTGAGG - Intergenic
1087032015 11:93715477-93715499 GTACCAGCTTGGCCACAGTGGGG - Intronic
1087472972 11:98600837-98600859 GTACCAGCTTGGCCACAGTGGGG - Intergenic
1089467213 11:118693014-118693036 GTACAGCCAGGCCTTCAGTGGGG - Intergenic
1090065301 11:123498225-123498247 GTACAAGCTTGACCACAGTGAGG - Intergenic
1092764026 12:11836498-11836520 AAGCAACCAGGGCCACCGTGTGG - Intronic
1093931812 12:24961475-24961497 GTACCAGCTTGGCCACAGTGGGG + Intergenic
1094424609 12:30305341-30305363 GTACAAATAAGGCCACAGTATGG + Intergenic
1097333344 12:58355879-58355901 CTCCAGCCTGGGCCACAGTGTGG - Intergenic
1098649062 12:72941392-72941414 GTACCAGCTGGGCCACAGTGGGG - Intergenic
1098738678 12:74141958-74141980 ATACAATCAGGGACAAAGTGGGG + Intergenic
1099024513 12:77448403-77448425 GTACCAGCTTGGCCACAGTGGGG + Intergenic
1102208108 12:111104582-111104604 GAGGAACCAGGGCCACAGCGAGG - Intronic
1103240225 12:119407075-119407097 GGACATCCAGGGCCATAGGGGGG + Intronic
1103472046 12:121189923-121189945 GAACAACCAGGGCCAGTGCGGGG - Intergenic
1104898617 12:132176132-132176154 GTGCAGCCAGGGCCAAGGTGAGG - Intergenic
1109283263 13:60381432-60381454 GTATAACAAGGGTCACAGTCAGG + Intergenic
1111291940 13:86182731-86182753 CTACCACCTTGGCCACAGTGGGG + Intergenic
1111639319 13:90947441-90947463 GTACCAGCTTGGCCACAGTGGGG + Intergenic
1113701262 13:112390325-112390347 GCAGAGCCAGTGCCACAGTGGGG + Intronic
1113871435 13:113562259-113562281 AAACATCCAGGGCCCCAGTGTGG + Intergenic
1114055491 14:18964563-18964585 CAACACCCAGGTCCACAGTGTGG - Intergenic
1114107054 14:19437200-19437222 CAACACCCAGGTCCACAGTGTGG + Intergenic
1117264920 14:54076793-54076815 GTACCAGCATGGCCACAGTGGGG - Intergenic
1117483116 14:56168662-56168684 GTACCAGCACGGCCACAGGGGGG - Intronic
1117739034 14:58797059-58797081 GTACAGACAGGTCCAGAGTGAGG + Intergenic
1119096811 14:71840419-71840441 GTACCAGCTCGGCCACAGTGGGG - Intergenic
1120426185 14:84351098-84351120 GTACCACCTTGGCTACAGTGGGG + Intergenic
1121634657 14:95445781-95445803 ATACACCCAGGGCCACACAGTGG + Intronic
1123041845 14:105493476-105493498 GTTCAGCCAGGCTCACAGTGGGG - Intronic
1124589096 15:31037181-31037203 GTAGACCCAGGGCCTCAGAGAGG + Intronic
1126440547 15:48683660-48683682 GTACCAGCCTGGCCACAGTGGGG + Intergenic
1126709438 15:51441122-51441144 GTACCAACAGTGCCACAGGGGGG - Intergenic
1126979824 15:54228342-54228364 GTACCAGCTTGGCCACAGTGGGG - Intronic
1128671100 15:69575370-69575392 GTACAGCCAGGGCTAGAGAGTGG - Intergenic
1129134897 15:73539505-73539527 TTACAACCTGGGAAACAGTGAGG - Intronic
1129152152 15:73696033-73696055 GCAGAAGCAGGGCCACAGGGAGG - Intronic
1130670091 15:85904339-85904361 GTACATCCAGGACAACAGTTTGG + Intergenic
1131682801 15:94741818-94741840 GTAGAACTAGTGCCATAGTGGGG - Intergenic
1132230630 15:100181301-100181323 GTACCAGCTTGGCCACAGTGGGG - Intronic
1132862842 16:2079980-2080002 GTGAACCCAGGGCCACAGGGAGG - Intronic
1133813841 16:9181480-9181502 CTCCAGCCAGGGCAACAGTGAGG + Intergenic
1134407037 16:13969789-13969811 GTACCAGCTTGGCCACAGTGTGG - Intergenic
1135687260 16:24507750-24507772 CTCCAGCCAGGGCAACAGTGCGG + Intergenic
1135879562 16:26240825-26240847 GTACCAGCATGGCCACAGTGGGG + Intergenic
1136676579 16:31913899-31913921 GTACCAGCTTGGCCACAGTGGGG - Intronic
1137475912 16:48810526-48810548 GCCCACCCAGGGCCACAGAGCGG + Intergenic
1138504803 16:57472937-57472959 GAACTACCAGGGCCACAGGAGGG - Exonic
1139959624 16:70710153-70710175 ACACAGCCAGGGCCACAGAGGGG + Intronic
1142033005 16:87847705-87847727 CTGCACCCAGGGTCACAGTGGGG + Intronic
1144783534 17:17819624-17819646 GCACACCCAGGTCCAGAGTGTGG - Exonic
1145681379 17:26597394-26597416 TTACAACGAAGGCCACAGAGTGG - Intergenic
1147214511 17:38891319-38891341 GTTCCACCCGGGCCACAGAGGGG + Intronic
1148805556 17:50262129-50262151 GGGCAACCAGGACCCCAGTGGGG - Intergenic
1151746010 17:76012156-76012178 GTGCCTCCAGGGCCACAGTCAGG + Intronic
1152687166 17:81700418-81700440 GTTCAGCCAGGGCAACAGGGAGG - Intronic
1152852929 17:82648268-82648290 CTTCAACCAGGACCACGGTGAGG - Exonic
1153715044 18:7839176-7839198 GTACCACCTCGGGCACAGTGGGG - Intronic
1154230654 18:12553231-12553253 GTACCAGCTTGGCCACAGTGGGG + Intronic
1158468607 18:57713940-57713962 CTACCACCTTGGCCACAGTGGGG + Intronic
1159092020 18:63860493-63860515 GTACCAACTTGGCCACAGTGGGG - Intergenic
1163371075 19:16901606-16901628 GTGCAACCATGTCCAGAGTGGGG - Intronic
1168198303 19:54792138-54792160 GCAAATCCACGGCCACAGTGGGG - Intronic
925469391 2:4142711-4142733 GAACAACCAGGGATTCAGTGAGG - Intergenic
929616522 2:43313834-43313856 GCACAACCAGGGCCAGAGTCAGG - Intronic
929971076 2:46577429-46577451 CTCCAACCTGGGCCACAGAGTGG - Intronic
931749417 2:65317590-65317612 TCACAACCAGGGCCACAGATGGG - Intronic
932773311 2:74513591-74513613 ATCCAACCAAGGCCTCAGTGAGG + Intronic
932921142 2:75916623-75916645 GTACCAGCTTGGCCACAGTGGGG - Intergenic
935437859 2:103056089-103056111 GTGCCACCTTGGCCACAGTGGGG - Intergenic
937512510 2:122611913-122611935 GTACAAGCTCAGCCACAGTGGGG + Intergenic
937922171 2:127138261-127138283 GTGCCCCCAGGGCCACTGTGGGG - Intergenic
938473653 2:131589140-131589162 CAACACCCAGGTCCACAGTGTGG - Intergenic
941078200 2:161030439-161030461 GTAGACCCATGGCTACAGTGTGG + Intergenic
941672572 2:168310603-168310625 GTACCAGCACAGCCACAGTGGGG - Intergenic
943031731 2:182693676-182693698 CTCCAACCTGGGCAACAGTGTGG - Intergenic
943067610 2:183105427-183105449 GTACCAGCATGGCCACAGTTGGG - Intergenic
943731745 2:191309384-191309406 GTTGAAGCAGGGACACAGTGAGG - Intronic
947439739 2:230108986-230109008 GTACCAGCTTGGCCACAGTGGGG - Intergenic
948381378 2:237552083-237552105 GGATTTCCAGGGCCACAGTGAGG + Intronic
1168917225 20:1500093-1500115 GTACCAGCACAGCCACAGTGGGG - Intergenic
1171386356 20:24771808-24771830 GGACACCCAGGGCTACAGTGAGG + Intergenic
1174406258 20:50305244-50305266 CTAGAACCAGGGCCAAAGTCTGG - Intergenic
1175831436 20:61967119-61967141 GGACCACCAGGGCTCCAGTGTGG + Intronic
1176182059 20:63754255-63754277 GGAGAGCCAGGGGCACAGTGTGG - Intronic
1177577957 21:22982909-22982931 GTCCCAGCATGGCCACAGTGGGG + Intergenic
1177639914 21:23833276-23833298 GGAGAACCAGGGCCACCGAGTGG - Intergenic
1179395926 21:41039994-41040016 GTACCAGCAAGGCCACAGTTGGG + Intergenic
1179824642 21:43957288-43957310 GTGCAAGAATGGCCACAGTGGGG + Intronic
1180023392 21:45143594-45143616 GGACCTCCTGGGCCACAGTGAGG - Intronic
1180247334 21:46557029-46557051 GCAAAACCAAGGCCACAGTAGGG - Exonic
1180473969 22:15687115-15687137 CAACACCCAGGTCCACAGTGTGG - Intergenic
1182288121 22:29259957-29259979 GTCTAAAGAGGGCCACAGTGGGG - Exonic
1182776695 22:32836730-32836752 GGACACCCAGGGCCATAGTTTGG - Intronic
1183387094 22:37521002-37521024 GGGCAACCAAGGCCACAGAGAGG - Intergenic
1183530533 22:38351137-38351159 GGACAACCAGGGCCACACTCAGG - Intronic
1183545679 22:38453969-38453991 GCCAAGCCAGGGCCACAGTGAGG + Intronic
1184325301 22:43778481-43778503 GTTAAATCAGGGCCACAGGGTGG + Intronic
1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG + Intronic
950345746 3:12290253-12290275 GTAAAACCATGGCATCAGTGAGG + Intronic
950889065 3:16387207-16387229 GTCCACCCAGGGCCACAAGGAGG + Intronic
951279537 3:20731539-20731561 GTACCATCTTGGCCACAGTGGGG - Intergenic
952906683 3:38143716-38143738 GCACCGCCAGGGCCACACTGTGG - Intergenic
956222982 3:66923702-66923724 GTACCAGCTTGGCCACAGTGAGG + Intergenic
956625846 3:71265984-71266006 GACCAACCAGGCACACAGTGCGG + Intronic
959623755 3:108426681-108426703 GTACCACCACTGCCATAGTGGGG - Intronic
960281995 3:115790813-115790835 GTACAACCGGTGACACAATGTGG - Intergenic
960957628 3:123045331-123045353 GGACACCAATGGCCACAGTGAGG + Intergenic
960987414 3:123289994-123290016 GGACACCGAGGGCCACAGGGAGG + Intronic
963330550 3:143910286-143910308 GTACCAACTAGGCCACAGTGGGG + Intergenic
963448057 3:145440155-145440177 GTACCAACAGTGCCACAGGGAGG + Intergenic
964179409 3:153865482-153865504 GTACAAGCTTGGCCACAGTGGGG + Intergenic
964686776 3:159404289-159404311 GTACTAGCTAGGCCACAGTGGGG + Intronic
964758906 3:160115063-160115085 GTACCAGCACAGCCACAGTGAGG + Intergenic
965099576 3:164278629-164278651 GTACTAGCTGGGCCACAGTGAGG + Intergenic
966151679 3:176873625-176873647 GTACCAGCTGGGTCACAGTGGGG + Intergenic
972902363 4:43700566-43700588 GTACCAACATGGCCACAGTGGGG - Intergenic
975592780 4:76017063-76017085 GTACCAGCTCGGCCACAGTGAGG - Intronic
976180488 4:82394276-82394298 GACCAACCTGGGCCACAGAGTGG - Intergenic
976254196 4:83083480-83083502 GTACCAGCACAGCCACAGTGGGG - Intergenic
976525645 4:86084197-86084219 GTACCAGCTTGGCCACAGTGTGG + Intronic
977744997 4:100535948-100535970 GTACCAGCATGGCCACAGAGGGG + Intronic
979213280 4:118132555-118132577 GTACCAGCTTGGCCACAGTGGGG - Intronic
979413473 4:120406931-120406953 GTACCAACACTGCCACAGTGGGG + Intergenic
979594992 4:122525182-122525204 GTACCAACACTGCCACAGTGGGG - Intergenic
979990368 4:127367833-127367855 GTCCAACAAGGGGCACAGAGAGG - Intergenic
980172393 4:129305734-129305756 GTACCAGCTTGGCCACAGTGGGG - Intergenic
980960558 4:139470526-139470548 GTACCAGCATGGCCACAGGGGGG - Intronic
981518351 4:145634552-145634574 GTACTAGCCTGGCCACAGTGGGG - Intronic
984130086 4:175864196-175864218 TTACAACCTGGGCCACAGTCAGG - Intronic
985144842 4:186885890-186885912 GTACACACAGAGACACAGTGTGG - Intergenic
987457906 5:18169788-18169810 GTACCAGCTTGGCCACAGTGGGG + Intergenic
987676001 5:21073219-21073241 GTGCAACCTGGGCGACAGAGCGG + Intergenic
989038753 5:37204330-37204352 GTAAAACCAGGGCAACTGTGAGG - Intronic
989434171 5:41391705-41391727 GTGCCAGCAGAGCCACAGTGGGG + Intronic
993197247 5:84764651-84764673 GTACCAGTATGGCCACAGTGGGG - Intergenic
993582305 5:89677747-89677769 GTACCACCATGGCCACAGAAAGG + Intergenic
993616679 5:90121493-90121515 GAACAACCTGGGACACAGTCAGG + Intergenic
993976400 5:94487919-94487941 CTCCAACCTGGGCCACAGAGTGG + Intronic
994329702 5:98490592-98490614 GTACAGCCAGGACTACAGAGGGG + Intergenic
996666571 5:126066739-126066761 GTACCAGCTTGGCCACAGTGGGG + Intergenic
997104709 5:131005702-131005724 GTACCAGCTTGGCCACAGTGAGG + Intergenic
997441180 5:133909620-133909642 GGACAACTGGGGCCACACTGAGG + Intergenic
998115181 5:139531762-139531784 GAACAGCCTGGGCAACAGTGTGG + Intronic
998695934 5:144639598-144639620 GTACAACTAGGGGCATGGTGGGG - Intergenic
999185980 5:149709317-149709339 GTACAGCCAGGGCCAGAATGAGG + Intergenic
999196326 5:149784036-149784058 CTACAAGCAGGGGAACAGTGCGG - Intronic
1000270235 5:159677187-159677209 GTACCAGCATGGCCACAGTCGGG + Intergenic
1001093281 5:168757189-168757211 GTAAAACCAGGGCCACCCAGGGG + Intronic
1002780433 6:361031-361053 AAACAAGCAAGGCCACAGTGAGG - Intergenic
1004555477 6:16693131-16693153 CTACTAACAGGGCCACTGTGAGG + Intronic
1006459875 6:34152135-34152157 GTAGAACCAAGGCTAGAGTGTGG - Intronic
1006844361 6:37052063-37052085 GTAAAACATGGGCCACAGTGGGG + Intergenic
1007349070 6:41255576-41255598 GCAGAACCAGGGCTTCAGTGAGG + Intergenic
1008250346 6:49232058-49232080 TTACAAGCATGGTCACAGTGGGG - Intergenic
1008312170 6:49989874-49989896 GTACCAGCATGCCCACAGTGGGG + Intergenic
1008880761 6:56378228-56378250 GTACTAGCTTGGCCACAGTGGGG + Intronic
1009046846 6:58244390-58244412 TTACAAACAGTGTCACAGTGGGG - Intergenic
1010325063 6:74554889-74554911 ATACCAGCATGGCCACAGTGGGG + Intergenic
1010838820 6:80623423-80623445 GTACCAGCTTGGCCACAGTGGGG + Intergenic
1012224502 6:96688798-96688820 GTACCAGCTTGGCCACAGTGGGG + Intergenic
1012620615 6:101339702-101339724 GTACCAGCATGGCCACAGGGAGG - Intergenic
1012714286 6:102649025-102649047 GTACCAGCATGGCCATAGTGGGG + Intergenic
1014255018 6:119152303-119152325 GAAGTACCAGGGCCACAGAGAGG - Intergenic
1014378815 6:120713650-120713672 GTACCAGCTGGACCACAGTGAGG + Intergenic
1015671902 6:135700070-135700092 GAACAACCAGGGCAACATTTTGG + Intergenic
1017924813 6:158901613-158901635 GTACCACCTAGGCCACAGTGAGG - Intronic
1018218058 6:161550177-161550199 GTACAACAAGGGGGGCAGTGGGG + Intronic
1018321304 6:162612265-162612287 ATAGAACCAGGACCAAAGTGTGG + Intronic
1021026311 7:15671578-15671600 TTACAAGCCAGGCCACAGTGTGG + Intronic
1022366976 7:29730691-29730713 GTACCAGCTTGGCCACAGTGGGG - Intergenic
1022541967 7:31146013-31146035 GTACCAGCTTGGCCACAGTGGGG - Intergenic
1026119584 7:67525096-67525118 TAACTACCAGGCCCACAGTGTGG - Intergenic
1027674718 7:81143337-81143359 GTACCAGCATGGCCACAGTGGGG + Intergenic
1028002770 7:85521584-85521606 GTACTACCAGGGCCAGACAGAGG + Intergenic
1029185894 7:98738185-98738207 GTCCAGCCTGGGCCACAGAGCGG + Intergenic
1029433239 7:100545991-100546013 GTACAACCAGAGCCACAGTCTGG - Intronic
1030088887 7:105840125-105840147 GGCCCACAAGGGCCACAGTGAGG + Intronic
1030213233 7:107017149-107017171 ATACAACCTGGACCACAGTCAGG - Intergenic
1030881250 7:114882616-114882638 GTACTAGCTAGGCCACAGTGAGG - Intergenic
1035139099 7:156738981-156739003 GTACTAGCTTGGCCACAGTGGGG + Intronic
1035657733 8:1323479-1323501 GTACAGCAGGAGCCACAGTGTGG - Intergenic
1036684949 8:10903401-10903423 GGACAACCAGGTGCACAGTTGGG - Intronic
1036936243 8:13004821-13004843 GTACCAGCTCGGCCACAGTGGGG + Intronic
1038425423 8:27461291-27461313 GGTCAACCAGGGGGACAGTGGGG - Exonic
1039401173 8:37270632-37270654 GTCCAGCCAGGGTGACAGTGGGG - Intergenic
1040299713 8:46181535-46181557 GCAAAAACAAGGCCACAGTGTGG - Intergenic
1040303986 8:46202642-46202664 GCAAAAACGGGGCCACAGTGTGG + Intergenic
1040305821 8:46211256-46211278 GTGAAAACGGGGCCACAGTGTGG + Intergenic
1040307481 8:46219682-46219704 GCAAAAACGGGGCCACAGTGTGG - Intergenic
1040312727 8:46245083-46245105 GTGAAAACAGGGCCACAGGGTGG + Intergenic
1040315280 8:46257713-46257735 GCAAAACCCGGGCCACGGTGTGG + Intergenic
1040316467 8:46263506-46263528 GCAGAAACAGGGCCACAGGGTGG + Intergenic
1040325294 8:46338559-46338581 GGAAAAACGGGGCCACAGTGTGG + Intergenic
1040325899 8:46341352-46341374 GCGAAAACAGGGCCACAGTGAGG + Intergenic
1040326254 8:46343085-46343107 GTGAAAACGGGGCCACAGTGTGG + Intergenic
1040408885 8:47134804-47134826 GAACACCCAGGTCCACAGTGTGG + Intergenic
1044336072 8:90985546-90985568 GCACAAGCAGGGCCACGGTCTGG - Intergenic
1045041310 8:98227242-98227264 GTACCAGCTTGGCCACAGTGGGG - Intronic
1046007962 8:108508653-108508675 GTACTACCAAGCCCACAGTCTGG - Intergenic
1046114146 8:109765221-109765243 GTACCAGCTTGGCCACAGTGGGG - Intergenic
1046463296 8:114570412-114570434 GTACCAGCTAGGCCACAGTGGGG - Intergenic
1046557300 8:115790750-115790772 GTACCACCTCAGCCACAGTGGGG + Intronic
1048006313 8:130422165-130422187 GACCAACCTGAGCCACAGTGTGG + Intronic
1048065390 8:130962397-130962419 GGCCACCCAGGGCCACAGTCTGG - Intronic
1048333475 8:133486557-133486579 AGAGAAACAGGGCCACAGTGAGG + Intronic
1048773350 8:137919191-137919213 CTACAACCGGGGCAACAGAGTGG + Intergenic
1051044326 9:12855327-12855349 GTACAAAATGGGGCACAGTGGGG - Intergenic
1051780158 9:20681292-20681314 GACCATCCAGGGCAACAGTGAGG - Intronic
1053204444 9:36174215-36174237 GTACCAGCTTGGCCACAGTGGGG + Intergenic
1053469966 9:38339439-38339461 GTCCACATAGGGCCACAGTGTGG - Intergenic
1056252371 9:84762911-84762933 TTACCACCAAGGCCACACTGTGG - Intronic
1058226518 9:102371299-102371321 GTACCAGCATGGCCACAGTGGGG - Intergenic
1058700961 9:107599845-107599867 GGACAGGAAGGGCCACAGTGGGG - Intergenic
1058810703 9:108636122-108636144 TTAATACCAGAGCCACAGTGTGG - Intergenic
1059041742 9:110822461-110822483 GTACCAGCTGGACCACAGTGGGG + Intergenic
1059562521 9:115348776-115348798 GAACAATAAGGGCCACACTGAGG - Intronic
1059693006 9:116703909-116703931 TTACAAGCAGGGCAACAGTGAGG + Intronic
1060304499 9:122398557-122398579 GTACTAGCTCGGCCACAGTGGGG + Intergenic
1061915586 9:133751510-133751532 GTACCAGCACGGCCACAGTGGGG - Intergenic
1187882726 X:23861692-23861714 GTGCACCCAGGGCCAGTGTGAGG - Intronic
1190530390 X:51368810-51368832 GTACCAGCACAGCCACAGTGGGG + Intergenic
1190808344 X:53860849-53860871 GTACCAACTTGGCCACAGTGGGG - Intergenic
1192135060 X:68589322-68589344 GTACTAACTCGGCCACAGTGGGG + Intergenic
1192890926 X:75389866-75389888 GTACCAGCTTGGCCACAGTGAGG + Intronic
1192908541 X:75578792-75578814 GTACCAGCATGGCCACAGTGGGG - Intergenic
1193524506 X:82572740-82572762 GTACCAGCATGGCCACAGTGGGG - Intergenic
1193880135 X:86911321-86911343 GTACAACTAAGGCCACAGTGGGG - Intergenic
1194023554 X:88723722-88723744 GTACCAGCAAGGCCACAGAGGGG + Intergenic
1194136645 X:90152055-90152077 GTACCAACATGGCCACAGTGGGG + Intergenic
1194291060 X:92072282-92072304 GTACCAGCTTGGCCACAGTGGGG - Intronic
1194415493 X:93606552-93606574 GTACCACCTCGGGCACAGTGAGG + Intergenic
1194568440 X:95522599-95522621 GTACAAGCATGGCCACAGAAGGG + Intergenic
1194795883 X:98210733-98210755 GTACCAGCTTGGCCACAGTGAGG + Intergenic
1195807839 X:108795632-108795654 GTACCAGCATGGCCACAGAGAGG - Intergenic
1196485586 X:116203354-116203376 GTACCAGCTGAGCCACAGTGGGG - Intergenic
1196495362 X:116318196-116318218 GTACGAGCTTGGCCACAGTGAGG + Intergenic
1197015993 X:121626895-121626917 GTACCAGCTTGGCCACAGTGGGG + Intergenic
1197072933 X:122322177-122322199 GTACCAACTTGGCCACAGTGGGG + Intergenic
1197380819 X:125736698-125736720 GTACCAGCTGGGCCACACTGAGG - Intergenic
1198340869 X:135712450-135712472 GAAAAATGAGGGCCACAGTGTGG - Intergenic
1199050589 X:143232426-143232448 CTACAAATAGGGCCACAGGGAGG + Intergenic
1199080678 X:143573179-143573201 GTACAACCGAGGCCACATTGGGG - Intergenic
1199258553 X:145744777-145744799 GTATCAGCATGGCCACAGTGAGG + Intergenic
1199308676 X:146297480-146297502 GTACCAGCATGGCCACAGAGGGG - Intergenic
1199457381 X:148044223-148044245 GTACCAGCTTGGCCACAGTGGGG - Intergenic