ID: 906794087

View in Genome Browser
Species Human (GRCh38)
Location 1:48682868-48682890
Sequence CCTCATTTAATGGAGCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906794079_906794087 22 Left 906794079 1:48682823-48682845 CCTCAGTTTTATCACATAGGATA 0: 1
1: 0
2: 1
3: 14
4: 257
Right 906794087 1:48682868-48682890 CCTCATTTAATGGAGCTGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906794087 Original CRISPR CCTCATTTAATGGAGCTGGT GGG Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
906444556 1:45884031-45884053 CCTCAATGAATGGAGTTGCTGGG + Intronic
906794087 1:48682868-48682890 CCTCATTTAATGGAGCTGGTGGG + Intronic
908034309 1:60035351-60035373 ACCCATTTACTGCAGCTGGTAGG + Intronic
909591872 1:77359601-77359623 CCTCATTTATTTCAGCTGGCTGG - Intronic
910765174 1:90775046-90775068 CATAAGTTAATGGACCTGGTTGG + Intergenic
912347877 1:108981728-108981750 CAACATTTCATGGAACTGGTAGG - Exonic
913329874 1:117658607-117658629 CCTCCTTTCATTGACCTGGTTGG - Intergenic
913378563 1:118184366-118184388 CCTCATTTACTGAAGCTGGGTGG + Intronic
914865357 1:151423327-151423349 ACTCATTGAATGGCGCTGGGGGG - Intronic
916567834 1:165997101-165997123 TCTCATGTACTGGAGCTGATGGG + Intergenic
917434424 1:175005155-175005177 CCTCAGTTAATTGTGGTGGTTGG - Intronic
918267016 1:182852790-182852812 CCTCAATTAATGTCGCTGCTAGG - Intronic
919345540 1:196371411-196371433 AATCATTTAATGGTGATGGTTGG + Intronic
921116602 1:212098107-212098129 CCTGCTCTAATGGAGGTGGTAGG + Intronic
1065425160 10:25594852-25594874 CCTCATTTCATGGTGCTGCCTGG - Intronic
1066810397 10:39325038-39325060 TATCTTTTAATTGAGCTGGTTGG - Intergenic
1074206573 10:111287960-111287982 CCTCCTTTAATGGAGCTTCCTGG + Intergenic
1075741532 10:124699124-124699146 CCTCATTTAATGAACATGGCAGG + Intronic
1077103989 11:833953-833975 CATCATGGAATGGAGCTGGAGGG - Intronic
1079075171 11:17381008-17381030 CCTCACTTAATGGAGTTGATAGG - Intergenic
1082655577 11:55852642-55852664 CCTCATCTAATTTAGCTGGCTGG + Intergenic
1091399649 12:174292-174314 CCTGATTTCATGGACCTGCTGGG - Intronic
1092137078 12:6157299-6157321 CCTGATTCAGTAGAGCTGGTGGG + Intergenic
1095065648 12:37769391-37769413 TCTCTTTTGATGGAGCAGGTTGG + Intergenic
1095078223 12:37960719-37960741 TTTCTTTTGATGGAGCTGGTTGG + Intergenic
1095078231 12:37960889-37960911 TTTCTTTTGATGGAGCTGGTTGG + Intergenic
1098821922 12:75243074-75243096 CCTAATCTCATGGAGCTTGTTGG + Intergenic
1101637548 12:106557942-106557964 ACACTTATAATGGAGCTGGTAGG + Intronic
1102733530 12:115136513-115136535 CCTCATGTTATGGAGCAGTTGGG - Intergenic
1103895768 12:124272248-124272270 CCCCCTTTTGTGGAGCTGGTGGG - Intronic
1105776905 13:23670791-23670813 CCTCATTTAGTGCTGCTGGGAGG - Intronic
1106371988 13:29143625-29143647 CCTCATAGAATGGAGTTGATGGG + Intronic
1106652632 13:31708161-31708183 CCCCATTTAATGGAGCAGTGAGG - Intergenic
1108143506 13:47451682-47451704 GCTCTTTTAATGGAGATGTTAGG + Intergenic
1109558845 13:64020285-64020307 CCTCATTTAATGAAGCCAGCTGG + Intergenic
1110694451 13:78471858-78471880 CCTCATTTAAAGGAGTGTGTGGG - Intergenic
1111533962 13:89577232-89577254 ACTCATTTACTGCAGCAGGTGGG - Intergenic
1111690887 13:91561437-91561459 CCTCATTTAATTAACCTGTTTGG + Intronic
1113132522 13:107053916-107053938 CCTCATTTCTAGGAGATGGTAGG + Intergenic
1113381153 13:109807424-109807446 CCTCCTTTCATGGGGCTGGGGGG + Intergenic
1116257105 14:42570895-42570917 ACACATTCCATGGAGCTGGTGGG + Intergenic
1116341438 14:43727988-43728010 CTTCATTTATTTTAGCTGGTAGG - Intergenic
1118031994 14:61826975-61826997 TCTAATTTAATGGAACTGGTGGG - Intergenic
1120980131 14:90281909-90281931 CATCATTTACAAGAGCTGGTGGG - Intronic
1126343064 15:47664974-47664996 CCTGCTTTAATGGAGGTGGGGGG + Intronic
1126355842 15:47795221-47795243 ACTCATCTAATGAGGCTGGTTGG + Intergenic
1132813385 16:1813103-1813125 CCCCAATTAATGGAGGTGTTTGG + Intronic
1133111826 16:3552380-3552402 CTACATTTATTGGAGCAGGTGGG + Intronic
1135765897 16:25177857-25177879 CCTCATTTTATGTAGCAGGAGGG + Intronic
1136952698 16:34741364-34741386 CCTCATTGAATGGAATTGATTGG - Intergenic
1138372269 16:56536555-56536577 CCTTAGTTAATGGAGCAGGAAGG + Intergenic
1139919684 16:70451421-70451443 CCTGCTTTAATGGAGCAGGATGG + Intergenic
1140276475 16:73513317-73513339 CATCATATAATGGATATGGTAGG + Intergenic
1142883200 17:2896787-2896809 CCTCATCTAATGCACCTGGAGGG + Intronic
1142970051 17:3605206-3605228 CCTCATTTAATCTAGAAGGTGGG - Intergenic
1148217039 17:45838983-45839005 CATCATTTTAAGGAGCTGGGGGG - Intergenic
1148438207 17:47698246-47698268 CCCCATTTTATGGATCAGGTGGG + Intronic
1149532994 17:57410344-57410366 CTTCATTTAATCCAGCTGCTGGG + Intronic
1152322670 17:79616908-79616930 CTTCATTTAAGTTAGCTGGTTGG - Intergenic
1152715437 17:81897995-81898017 CCTCATTTAATCAAACGGGTAGG + Intronic
1153509961 18:5840641-5840663 CCTCAGTTAAATGTGCTGGTTGG - Intergenic
1154134109 18:11761064-11761086 CCTCAGTTGCTGGGGCTGGTTGG + Intronic
1159788360 18:72743232-72743254 GATCATCTAATTGAGCTGGTTGG - Intronic
1163129970 19:15266204-15266226 CCTCACTTTTTGCAGCTGGTTGG - Intronic
932697687 2:73970436-73970458 ACTCAGTAAATGGAACTGGTAGG + Intergenic
935507781 2:103928193-103928215 CCTTATTTAATGGATCAGTTTGG + Intergenic
936049470 2:109212242-109212264 CCTCATTTCATGGAGTTGGAGGG - Intronic
936075954 2:109402045-109402067 CCTGATTTAATCGAGCTGCCGGG + Intronic
941659745 2:168183652-168183674 CCTCATTTGCTAGAGCTGTTTGG + Intronic
943306496 2:186269019-186269041 ACTGAGTTAATGGAGCTGCTGGG + Intergenic
947175622 2:227364387-227364409 GCTCATTTAATGGGGGTGGCGGG - Intronic
1169204255 20:3731414-3731436 CCTCATTTGATGGGGCTGTGGGG + Intergenic
1169523322 20:6396778-6396800 TCTGATTTAATAGAGCTGGGTGG + Intergenic
1171465036 20:25321399-25321421 CCTCCTTTCAGGAAGCTGGTGGG + Intronic
1172949270 20:38712112-38712134 CCATATTTATTGGAGTTGGTCGG + Intergenic
1175758217 20:61543849-61543871 CCTGATGGAATGGAGCTGGCAGG + Intronic
1179312736 21:40210946-40210968 CCTCATTTGATGGTGGTGGTGGG - Intronic
1180120647 21:45745339-45745361 CCTTATTAAATAAAGCTGGTGGG - Intronic
1203329596 22_KI270738v1_random:67640-67662 CATCATTGAATGGAACTGATTGG + Intergenic
949101297 3:148945-148967 ACTCTTTAAATGGAGCTGTTTGG - Intergenic
951513954 3:23537062-23537084 CCTCACTTAATGTGGCTGATAGG - Intronic
952221070 3:31324972-31324994 GCTCATTAAATGGAGCTGAATGG + Intergenic
952507766 3:34023278-34023300 CCTAATTTAATGGTGGTGCTAGG + Intergenic
953330582 3:42049962-42049984 CCTCATTTGAGGGAGCTGGCTGG + Intronic
956961977 3:74413788-74413810 CCTCATTAAATTGAGCAAGTTGG - Intronic
957322914 3:78655274-78655296 TCTCATATAATAGAGCTGTTGGG + Intronic
958013862 3:87914949-87914971 CCTGTTTTAGTGGAGGTGGTAGG - Intergenic
960047047 3:113209065-113209087 CCTGACTAAATGGTGCTGGTAGG + Intergenic
960852013 3:122065608-122065630 CCTCATTTATATGAGCTGCTTGG + Intronic
965377678 3:167946138-167946160 AGTAATTTAATGGAGGTGGTGGG + Intergenic
965846840 3:172972689-172972711 CCTCATTTAGAGTAGCTGCTTGG - Intronic
970267402 4:14304086-14304108 CCAGACTTAATGGAGCTGGTGGG + Intergenic
977535135 4:98248799-98248821 CCTGCTTTAGTGGAGATGGTGGG - Intergenic
977926620 4:102707085-102707107 CCTTATTGAATGGATCTGTTTGG - Intronic
978030086 4:103930683-103930705 CCTCAGTTAATAGAGCTGCATGG - Intergenic
979222163 4:118240052-118240074 CTTCATTTAAAAGAGCTGATAGG + Intronic
982835225 4:160114380-160114402 CCTCATTTAATGTTGCAGCTTGG + Intergenic
983752833 4:171298382-171298404 CCTCATTTCCTGGGGCTGGCAGG - Intergenic
985868578 5:2536166-2536188 CCTCATTTATTTCGGCTGGTTGG + Intergenic
986312664 5:6565493-6565515 TCAAATTTAATTGAGCTGGTGGG - Intergenic
986579708 5:9252645-9252667 CCTTATGTACTGGAGATGGTAGG + Intronic
988478720 5:31611338-31611360 CCTCATATAATGTAGTTGCTAGG + Intergenic
989842403 5:46095523-46095545 CCTCTTTTAATGGAGGAGTTTGG + Intergenic
989854974 5:46273442-46273464 TATCTTTTAATGGAGCTGTTTGG - Intergenic
991667293 5:69011952-69011974 CCTTATTTAATTGATCTGATGGG + Intergenic
992104490 5:73438171-73438193 CCTTATTTTAGGGAGTTGGTGGG - Intergenic
992500622 5:77339208-77339230 CCTCACTTACTAGAACTGGTTGG + Intronic
994084851 5:95747043-95747065 CCTCAGTTATTGGGGCTTGTTGG + Intronic
995045969 5:107647903-107647925 CCTCATTTATTGGAGTTGCCTGG - Intronic
999175771 5:149630685-149630707 CCCCATTGACTGGAGCTGGGCGG - Intronic
1001867317 5:175116839-175116861 CCTCATTTGAGGGAGGAGGTAGG + Intergenic
1004235551 6:13872174-13872196 CCTCATTTCCTGGGGCTGGCAGG + Intergenic
1005457266 6:26033074-26033096 GCTCATTTAATGGAAGTCGTAGG + Intergenic
1006972587 6:38062083-38062105 TCTCATTTAATTGATCTGGAGGG + Intronic
1011839309 6:91476688-91476710 CCTCATTTTATAGATCTGTTGGG - Intergenic
1012274369 6:97253876-97253898 GCTTATTTTATGGAGCTGATAGG + Intronic
1012813507 6:103990889-103990911 CCTCATTGAAAGGAACTGGAAGG + Intergenic
1019536680 7:1533124-1533146 CCTCATCTACAGCAGCTGGTCGG - Intronic
1025317178 7:58046252-58046274 CCTCATTGAATGGAATTGATTGG + Intergenic
1025317224 7:58046777-58046799 CCTCATTGAATGGAATTGATTGG + Intergenic
1025322469 7:58111151-58111173 CCTCATCTAATGGAATTGATAGG - Intergenic
1025574053 7:62612584-62612606 ACTCTTTTGATGGAGCTGTTTGG - Intergenic
1028461359 7:91096679-91096701 CCTCTTTTAATGGAAGTGCTGGG + Intronic
1028509246 7:91604693-91604715 CCTTATTTAAGGGAGGAGGTAGG + Intergenic
1032286243 7:130540191-130540213 TCTTATTTAACTGAGCTGGTGGG + Intronic
1035043498 7:155948376-155948398 CTTCATTTAAGGGAGCTGCAGGG + Intergenic
1035817817 8:2560547-2560569 CCTTATTTATTCCAGCTGGTTGG + Intergenic
1039839922 8:41286000-41286022 CCTCATTCTATGGAACTGGGCGG + Intronic
1043018540 8:74970855-74970877 CATCATTAGATGTAGCTGGTAGG + Intergenic
1043919695 8:85966881-85966903 CATCTTTTAAAGGAGCAGGTGGG + Intergenic
1044298736 8:90558584-90558606 CATCATTAAATTGAGCAGGTTGG - Intergenic
1044815456 8:96108049-96108071 CCACATTTAATGGGGCAGGTGGG + Intergenic
1044995936 8:97838298-97838320 CCTCACTGGATGGAACTGGTGGG - Intronic
1046790748 8:118319207-118319229 CCTCCATTAATGGGGGTGGTGGG + Intronic
1048956710 8:139543507-139543529 CCTAATTAAATGGTCCTGGTGGG + Intergenic
1050180435 9:2916960-2916982 GCTCAATTTATGGAGCAGGTTGG + Intergenic
1052626770 9:30985352-30985374 CCACTTTTAATGGGGTTGGTTGG - Intergenic
1055144167 9:72912742-72912764 GCTCATTTAATGAAGCAGGATGG - Intronic
1060961184 9:127681863-127681885 CATCATTGAATGGGGCAGGTGGG - Intronic
1061166170 9:128923376-128923398 CCTCCTTTATTGAAGCTGGCAGG - Intronic
1061330892 9:129891728-129891750 CATCATTTAAAGGAGGAGGTAGG + Intronic
1196883844 X:120224172-120224194 GCACATTCCATGGAGCTGGTGGG - Intergenic
1197801715 X:130356542-130356564 TCTCATTTAGTGGGGCTGTTTGG + Intronic
1199597254 X:149515970-149515992 CTTCCTTTCATGGAGATGGTAGG + Intronic