ID: 906794890

View in Genome Browser
Species Human (GRCh38)
Location 1:48689008-48689030
Sequence ATGGATCTTCTTTCTGAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 241}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906794890_906794898 21 Left 906794890 1:48689008-48689030 CCCCATTCAGAAAGAAGATCCAT 0: 1
1: 0
2: 4
3: 23
4: 241
Right 906794898 1:48689052-48689074 CTAAAAATACAAAACTTAGCTGG 0: 1425
1: 87933
2: 73848
3: 45237
4: 45647
906794890_906794900 28 Left 906794890 1:48689008-48689030 CCCCATTCAGAAAGAAGATCCAT 0: 1
1: 0
2: 4
3: 23
4: 241
Right 906794900 1:48689059-48689081 TACAAAACTTAGCTGGGCTGTGG 0: 2
1: 11
2: 139
3: 894
4: 1847
906794890_906794899 22 Left 906794890 1:48689008-48689030 CCCCATTCAGAAAGAAGATCCAT 0: 1
1: 0
2: 4
3: 23
4: 241
Right 906794899 1:48689053-48689075 TAAAAATACAAAACTTAGCTGGG 0: 1001
1: 62119
2: 132923
3: 100617
4: 63037

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906794890 Original CRISPR ATGGATCTTCTTTCTGAATG GGG (reversed) Intronic
903254011 1:22079724-22079746 ATGAATCTTGTTTCAGAGTGAGG + Intronic
906012492 1:42542033-42542055 ATGGTTCCACTTTCTGATTGAGG - Intronic
906794890 1:48689008-48689030 ATGGATCTTCTTTCTGAATGGGG - Intronic
907581863 1:55579323-55579345 ATTTATAATCTTTCTGAATGTGG + Intergenic
907824464 1:58001705-58001727 ATGGATCCAGTTTCTGACTGTGG + Intronic
908007068 1:59738080-59738102 AAGGTTCTTCTTTTTGAATAGGG - Intronic
908991853 1:70101102-70101124 ATTAATCTTCTTTCATAATGTGG - Intronic
909089791 1:71211182-71211204 ATCTATCTTTGTTCTGAATGAGG + Intergenic
910781623 1:90942668-90942690 ATGGAACTTGTGTTTGAATGGGG - Intronic
911715360 1:101126599-101126621 GTCGATCTTCTTTCTCAATGTGG - Intergenic
912275701 1:108256439-108256461 AGAGACCTTCTTTCTTAATGTGG + Intergenic
912292522 1:108437910-108437932 AGAGACCTTCTTTCTTAATGTGG - Intronic
912427238 1:109605283-109605305 AAGCATCTGCTTTCTGAATTTGG - Exonic
913165520 1:116181250-116181272 ATGAATCTTCTTTTGGAATGCGG - Intergenic
914216132 1:145630743-145630765 ATGGCTCTTCTTTCTGGATTTGG + Exonic
914375149 1:147066394-147066416 ATGGACTTTCTTTATGAATCTGG - Intergenic
914468702 1:147953401-147953423 ATGGCTCTTCTTTCTGGATTTGG + Exonic
916276457 1:162999262-162999284 ATTGTGCTTCATTCTGAATGTGG + Intergenic
916577353 1:166079556-166079578 ATGGAACATCTTTTTCAATGTGG + Intronic
916840187 1:168592482-168592504 ATGGAACTTCTTTGTAGATGGGG + Intergenic
917331048 1:173880877-173880899 ATGCATTTACTTTCTGCATGTGG + Intronic
918870741 1:189970580-189970602 ATGGCTTTTCTTTCTGTTTGTGG + Intergenic
919988290 1:202691119-202691141 CAGGAGCTTCTTTCTGAAAGGGG + Intronic
922649498 1:227325233-227325255 CTGAATCTTATTGCTGAATGAGG - Intergenic
923149081 1:231217871-231217893 AGGGAACTTTTTTCTGAAAGAGG - Intronic
924177899 1:241411543-241411565 ATTGTTCTCCTTTCTGAATAGGG - Intergenic
924532527 1:244905326-244905348 AAGGATCTTCCTTCAGACTGAGG + Intergenic
924637845 1:245805749-245805771 ATGCATCATCAGTCTGAATGGGG - Intronic
1063280111 10:4619730-4619752 ATGGCTTTTCTATCTGAATATGG - Intergenic
1063477003 10:6337648-6337670 ATGAATCTTATTTCTCAAGGCGG - Intergenic
1064242595 10:13644768-13644790 ATGTATAATGTTTCTGAATGGGG + Exonic
1066219660 10:33322885-33322907 ATGGATGTGCTTTTTGAATGAGG - Intronic
1066453942 10:35556628-35556650 ATGGAGCTTCCTTCTGATAGGGG + Intronic
1066592414 10:37009889-37009911 ATGCCTTTTCTTTATGAATGAGG - Intergenic
1067409574 10:46052767-46052789 TTGTATTTTCTTTCTGGATGTGG + Intergenic
1067767641 10:49099004-49099026 ATGGATCCTGTCTCTGAAGGCGG + Intronic
1067816930 10:49486088-49486110 ATGGTTCTTTTTTCTTATTGTGG - Intronic
1067947226 10:50697207-50697229 TTGGGTGTTCTTTCTGAATGGGG - Intergenic
1070106942 10:73442748-73442770 ATAAATTTTCATTCTGAATGAGG - Intronic
1071244580 10:83749341-83749363 TTGGTTCTTCTTTGTGAAGGAGG - Intergenic
1071719511 10:88129358-88129380 ATGGTTTATCTTTCTGAAGGCGG + Intergenic
1074031769 10:109696339-109696361 TTGGTTCTTCTTTCTGAAAAGGG - Intergenic
1075921479 10:126216835-126216857 ATGGATCATCTTTCAAAATCTGG - Intronic
1075960725 10:126565959-126565981 AATGATCTTCTTTGTGAATATGG - Intronic
1076086691 10:127638046-127638068 TTGGCTCTTCTTTGTGAAGGAGG + Intergenic
1077962093 11:7086580-7086602 ATGGATATTGTGTCTGACTGGGG - Intergenic
1078409419 11:11100006-11100028 TTGCATCTTATTTCAGAATGTGG + Intergenic
1079124739 11:17710273-17710295 TAGCGTCTTCTTTCTGAATGGGG + Intergenic
1079528552 11:21420651-21420673 ATGTAGCTTCTGTCTGAAAGGGG - Intronic
1080317761 11:30969927-30969949 TTGGTTCTTCTTTGTGAAGGAGG - Intronic
1080788164 11:35494703-35494725 ATGGGTCTTCTTTCTCATTCGGG - Intronic
1081402751 11:42661851-42661873 ATGGATCTGTCTTCTAAATGTGG + Intergenic
1085645468 11:78219558-78219580 CTGGCTTCTCTTTCTGAATGTGG + Intronic
1086213138 11:84345180-84345202 ATAGATCATCTTTCCAAATGTGG + Intronic
1090446192 11:126766750-126766772 AATGATCATCTTTCTGACTGGGG + Intronic
1090536047 11:127642934-127642956 ATAGATATTCTTTCTGAACAAGG + Intergenic
1094080830 12:26533557-26533579 AAAGATCTTATTTCTGAATATGG - Intronic
1095473034 12:42556585-42556607 CTGGATCCTATTTCTGAATAAGG - Intronic
1096617949 12:52844883-52844905 ATGGCTCTCATTTTTGAATGAGG - Intronic
1097276990 12:57820468-57820490 GGGGATTTTCTTTCTAAATGAGG + Exonic
1099335638 12:81353188-81353210 ATGGATCTTCTCTCTCCAAGTGG - Exonic
1099428053 12:82548838-82548860 ATGGATTTGCTTTATGAATCTGG + Intergenic
1100788499 12:98104759-98104781 ATAGATCTGATTTCTGAATTTGG + Intergenic
1101386299 12:104260945-104260967 AAGGATTTACTCTCTGAATGTGG + Intronic
1104614691 12:130257880-130257902 ATAGATTTTCTTACTAAATGCGG - Intergenic
1105062045 12:133161815-133161837 TTGGTTCCTCTTTGTGAATGAGG - Intronic
1105438566 13:20397624-20397646 CTGGAGCTTCTTACTGAAGGAGG - Intergenic
1106345105 13:28869111-28869133 ATGGTTCTTCTTTGTGAATGGGG - Intronic
1106949331 13:34865305-34865327 ATTTTTCTTCTTTCTGGATGGGG + Intergenic
1107335635 13:39352132-39352154 ATGCATCTTCTTTAAGGATGTGG + Intronic
1109550808 13:63896708-63896730 ATCAATCTTCTTACTGAAAGAGG + Intergenic
1111877997 13:93920531-93920553 ACTGCTCTTCTTTCTGAATTTGG + Intronic
1113989196 13:114346268-114346290 GCGGATCTTCTTTTTGCATGTGG - Intergenic
1114871955 14:26669317-26669339 ATGGATCTAGGTTCTGAATTAGG - Intergenic
1116139480 14:40972396-40972418 ATTTTTCTTCTTTCTGAATGTGG - Intergenic
1117568990 14:57026568-57026590 ATGGATCTTTTTTGTGTATGTGG + Intergenic
1202829475 14_GL000009v2_random:11160-11182 ATTCAGCTTCTCTCTGAATGTGG + Intergenic
1202891740 14_KI270722v1_random:165595-165617 AAGGATCTTCTTTCTCAGAGAGG + Intergenic
1126209443 15:46083844-46083866 GGGAATCTTCTTTCTGAAAGCGG - Intergenic
1126462618 15:48929366-48929388 ATGGTTGTCCTATCTGAATGGGG - Intronic
1127273693 15:57423798-57423820 ATAGATCCTCATTCTGAATGTGG + Intronic
1128028955 15:64462175-64462197 AAGGCTCTTCTTTTTGAGTGAGG + Intronic
1128034815 15:64515547-64515569 ATGGATCTTCTTTTTAAAGGGGG + Intronic
1128831401 15:70772530-70772552 ATGGTGCTGCTTACTGAATGGGG + Intergenic
1130736093 15:86551156-86551178 ATTTTTCTTGTTTCTGAATGTGG - Intronic
1130867326 15:87943968-87943990 ATGGAACTTTTTCCAGAATGTGG + Intronic
1131435357 15:92417436-92417458 AGGGATGTTGTGTCTGAATGCGG + Intronic
1131683528 15:94748251-94748273 TGGGCTCTTGTTTCTGAATGAGG - Intergenic
1131823990 15:96302287-96302309 ATAGATTTTCTTTCTCAATTTGG - Intergenic
1132908910 16:2298561-2298583 CAGGATCTTCATGCTGAATGTGG - Intronic
1133432283 16:5748529-5748551 AAGGACTTTCTTTATGAATGTGG + Intergenic
1133967483 16:10541972-10541994 ATGGATATTGTTACTGAGTGTGG + Intronic
1135780182 16:25293262-25293284 ATGGAACTTCATTCTCATTGGGG + Intergenic
1135917829 16:26621901-26621923 ATGACTCTTCATTCTGAATGTGG - Intergenic
1136675208 16:31898012-31898034 ATTGATCTTCTTTCTGTTTTTGG + Intronic
1138326956 16:56181947-56181969 ATGGATTACCTTTCTTAATGTGG + Intergenic
1142749000 17:1976429-1976451 AAGGATCTTCTCTCTGCATGAGG + Intronic
1147439596 17:40439815-40439837 GTGGATCTTCTTTCTTTTTGTGG + Intergenic
1148139475 17:45317881-45317903 ACAGTGCTTCTTTCTGAATGGGG + Intergenic
1149219604 17:54401301-54401323 AGGGGTCTTCTTGCTCAATGAGG + Intergenic
1151661917 17:75523725-75523747 AGGGTTATTCTTTCGGAATGTGG - Exonic
1153391006 18:4559484-4559506 GTGGTTCTGCTGTCTGAATGTGG - Intergenic
1155516169 18:26625721-26625743 TGGGATCTTATTTATGAATGGGG - Intronic
1156860814 18:41834453-41834475 ATGGATCTTTTATCTTGATGAGG - Intergenic
1156904283 18:42335746-42335768 AGGGGTCTTCTTTCTGATCGTGG + Intergenic
1157128246 18:44978034-44978056 ATGGATCTGTTTTCGGAATATGG - Intronic
1157734421 18:50034012-50034034 CTGGATTTTCTTTCTTGATGTGG - Intronic
1159840050 18:73388806-73388828 ATGCATATTTTTTCTGTATGAGG - Intergenic
1161574036 19:5046000-5046022 AAGTATTTTCTTTCTGACTGGGG + Intronic
1164450099 19:28354046-28354068 ATGTATCTTCTTTCTTCAAGTGG - Intergenic
1202643218 1_KI270706v1_random:116621-116643 ATTCAGCTTCTCTCTGAATGTGG - Intergenic
925162161 2:1693264-1693286 ATGAATCTTCTTTTTCACTGAGG + Intronic
925334304 2:3082291-3082313 AAGGAACTTCTTTATTAATGAGG + Intergenic
925453633 2:3994022-3994044 ATTTATCTTCTTTTTCAATGTGG + Intergenic
928886187 2:36151239-36151261 ATGGAGCTTTTTTCTGGGTGGGG + Intergenic
928957206 2:36881493-36881515 ATGAACATTCTTTCTGAAAGTGG + Intronic
930741215 2:54834691-54834713 ATGCAGGTTCTTTCTGGATGCGG - Intronic
931075809 2:58710285-58710307 AAGAATCTACATTCTGAATGGGG - Intergenic
932282392 2:70505258-70505280 ATGGATCTTTATTCTGAAAAAGG + Intronic
933054418 2:77643650-77643672 TTGGTTCTTCTTTGTGAAGGAGG + Intergenic
933077931 2:77953628-77953650 GTTGATTTTCTGTCTGAATGAGG - Intergenic
934836588 2:97594787-97594809 ATGGGGCTTCGTTCTGAATTGGG + Intergenic
935221862 2:101022096-101022118 CAGGATCTACTTTCTGAAGGGGG - Intronic
936600175 2:113888377-113888399 ATGGATCTTCTTTCAATTTGTGG + Intergenic
936753427 2:115675411-115675433 ATGGTTCTTCTTTGTGGAGGAGG - Intronic
939970266 2:148650559-148650581 ATGGATCTTCTTTAAAAATAAGG - Intronic
940608540 2:155960336-155960358 ATAGAACTTCTTTCAAAATGGGG - Intergenic
942082051 2:172409626-172409648 CTGGATCTTCTGCCTTAATGGGG - Intergenic
943259244 2:185637317-185637339 ATGAAACTTCTTTCTCATTGTGG + Intergenic
945442192 2:209893725-209893747 TTGGTTCTTATTTCTGAATGAGG + Intronic
945968222 2:216210627-216210649 TTTGTTCTTATTTCTGAATGGGG - Intergenic
945973317 2:216251581-216251603 AAGCATCTACCTTCTGAATGTGG - Intergenic
948113167 2:235473301-235473323 ATGGCTCTTTTTTATGGATGAGG - Intergenic
1168798092 20:625368-625390 ATGTATCTGCTCTCTGAATCTGG + Intergenic
1173478437 20:43380251-43380273 TTGGATATTCTGTCTGAGTGAGG - Intergenic
1173658263 20:44715778-44715800 ATGTATCCTCATTATGAATGGGG + Intronic
1173757159 20:45526632-45526654 ATTGATCTTCTTTCATACTGTGG + Intergenic
1176608660 21:8856002-8856024 ATTCAGCTTCTCTCTGAATGTGG + Intergenic
1179119126 21:38526675-38526697 ATAGATGTTATTTCTGAGTGAGG + Intronic
1181017001 22:20076445-20076467 GTGGCTCTTCATTCTGAATGGGG - Intergenic
1181372400 22:22428848-22428870 TTGGAGCTTCTTGCTGAATCAGG + Intergenic
1184113045 22:42406338-42406360 ATGGACCCTCTGTCTGAGTGAGG - Intronic
949110023 3:248695-248717 ATGAATCTGCCTTCTGAATTTGG - Intronic
950002566 3:9668553-9668575 AGGGATCTTCTGACTGATTGTGG + Intronic
951141882 3:19171894-19171916 AAGGATCTTCATTCTGAATGAGG + Intronic
951659728 3:25049096-25049118 ATGGTTCATCTTTCTGTATCAGG - Intergenic
951851004 3:27139831-27139853 CTGGATGTTCTTGCTGAATGTGG - Intronic
951985951 3:28621072-28621094 AAGGACCTGCTTTATGAATGTGG - Intergenic
952403268 3:32982754-32982776 AATCATCTTCTTTCTGACTGAGG + Intergenic
953039705 3:39244909-39244931 GTGGATATTCTTTCAGAATTGGG + Intergenic
955732780 3:62004875-62004897 ATGTGTCTTCTTTGTGAAGGGGG - Intronic
955977576 3:64492960-64492982 ATAGAGCTTCCTTTTGAATGGGG - Intergenic
957079605 3:75625033-75625055 GTGGATCTTCTTTTTGCATGTGG + Intergenic
957877269 3:86163779-86163801 AGGAATCTTCTATCTGAAGGAGG - Intergenic
958645486 3:96866451-96866473 CAGGATTTTCTTCCTGAATGTGG + Intronic
959594770 3:108117822-108117844 ATCGATCTTCCTTCTGCATCAGG - Intergenic
960920360 3:122740586-122740608 ATGCCTCCTCTTTCTGAAGGCGG + Exonic
961004983 3:123398871-123398893 AAGGATCATCTTTCTGCCTGTGG + Intronic
962821851 3:139055821-139055843 TTGTTTCTTCTTTCTGAAGGGGG + Intronic
963646658 3:147923484-147923506 GGGCATCTTCTTTGTGAATGGGG - Intergenic
963925503 3:150946658-150946680 ATGGCTATTGTTTCTGAATCTGG + Intronic
964031641 3:152145685-152145707 ATGGATATTCTGTATGACTGGGG - Intergenic
965376730 3:167933810-167933832 AAAGAACTTCTTTCTGAATGTGG - Intergenic
967197103 3:187037927-187037949 ATGTATTTTTTTTCTGAATTTGG + Intronic
967415344 3:189211365-189211387 ATTGAACTTCTTTCTGATTATGG - Intronic
967867547 3:194202978-194203000 GTGGATCTTGTGTGTGAATGTGG - Intergenic
968057774 3:195705775-195705797 ATGCATCTTCTTTAAGAGTGCGG - Intergenic
970186279 4:13457135-13457157 AGTGATCTTCTTCCTAAATGTGG - Intronic
972983530 4:44735214-44735236 ATGGCTGTTCTTTCGAAATGAGG + Intergenic
974974418 4:68872139-68872161 ATGGGTATTCTATCTGAATGGGG + Intergenic
975448516 4:74497063-74497085 ATCTATCTTCTTTTTAAATGTGG + Intergenic
977678540 4:99774014-99774036 ATGGATCTCCTGTCTCACTGGGG - Intergenic
978244980 4:106561749-106561771 AAGGATTTGCTTTATGAATGTGG + Intergenic
978957787 4:114635682-114635704 ATGGATCTTTTTTATGAGGGGGG - Intronic
980430962 4:132694616-132694638 ATGAGTCTTCCTTCTGTATGTGG - Intergenic
980618375 4:135264177-135264199 AGGGATTTTCTTTTTTAATGTGG - Intergenic
985185546 4:187311229-187311251 ATGGCTCTTCTTTCAGTAGGAGG + Intergenic
1202770590 4_GL000008v2_random:202531-202553 ATTCAGCTTCTCTCTGAATGTGG - Intergenic
991535382 5:67664489-67664511 AAGGACTTTCTTTATGAATGTGG + Intergenic
992348238 5:75902278-75902300 CTGGGTCTTCTTTCTTAATAAGG + Intergenic
993953575 5:94204803-94204825 ATGGAAGTTATTCCTGAATGGGG - Intronic
994276370 5:97843271-97843293 GTGGATTTTCTTTCTTTATGTGG - Intergenic
995453305 5:112326292-112326314 ATGGAATTTCCTTCTGGATGCGG - Intronic
995461018 5:112403103-112403125 ACAGATTTTCTTTGTGAATGGGG - Intronic
995709725 5:115022586-115022608 ATGATTCTTCTTTCAGAAAGGGG + Intergenic
996699137 5:126431899-126431921 ATGGCTCTTCTTCCCTAATGGGG + Intronic
997260184 5:132459761-132459783 ATGCATCTTCTTTCTCAAGTTGG - Intronic
998285942 5:140861067-140861089 ATGGAGCTTCTTTCTGATCTAGG - Intronic
998302889 5:141042200-141042222 ATGGGTCTTTTTTCTGAGAGTGG - Intergenic
999073041 5:148767948-148767970 ATGGATCATCTTAGAGAATGTGG - Intergenic
999681105 5:154060925-154060947 GTGGCTCTTCTATCTGAATGAGG - Intronic
1000803832 5:165763044-165763066 ATGTAGCTTCTTTTTTAATGTGG + Intergenic
1001768528 5:174274364-174274386 ATGGATAAACTTTTTGAATGAGG - Intergenic
1003889910 6:10555098-10555120 AAGGACATTCTTTCTGCATGGGG + Intronic
1003891913 6:10571242-10571264 AGAGATCTTCTTTCCGTATGGGG - Intronic
1004153921 6:13149939-13149961 ATGGAACTTCTATCTAAATCAGG - Intronic
1004718458 6:18242402-18242424 ATGGTTTCTCTTTCTGCATGTGG + Intronic
1004929104 6:20444674-20444696 AAGGATCTTGCTTCTGAGTGAGG - Intronic
1010050570 6:71499129-71499151 TTGGATCTTCCTTTTGGATGAGG - Intergenic
1010322077 6:74523198-74523220 ATGTATCTTCTGTCTGAATTTGG + Intergenic
1011980005 6:93362791-93362813 ATGTATCTTCTTCCTGAATGAGG + Intronic
1013082582 6:106825260-106825282 AGGGAACTGCTTTCTGAGTGGGG + Intergenic
1013265499 6:108493493-108493515 ATGGAGGGTCTTTCTGAGTGGGG + Intronic
1013645342 6:112133210-112133232 ATGGTTCTTCTTTCTGGTGGTGG + Intronic
1013996421 6:116313909-116313931 ATGAATTTTCTTTCTGATTCAGG - Intronic
1014919501 6:127196892-127196914 ATGTGTTTTCTTTCTCAATGAGG + Exonic
1015838132 6:137444511-137444533 TTGGTTCTTCTTTGTGAAAGAGG + Intergenic
1015915694 6:138214039-138214061 ATCCCTCTTCTCTCTGAATGAGG + Intronic
1016099330 6:140078195-140078217 ATTGATCTTTTGTCTGCATGTGG - Intergenic
1016478757 6:144458388-144458410 AAGGGTCTTCTTTCTGAAGTCGG + Intronic
1016551710 6:145287950-145287972 ATGGTTCTTCTTTCTGAATCTGG - Intergenic
1017258215 6:152358324-152358346 AGGAATCTTCATTCTGAATATGG - Intronic
1017893101 6:158655532-158655554 ATGGATCTTTATTGTAAATGAGG + Intronic
1018703110 6:166443246-166443268 ATGGATCGTCTGTCTGAAAAGGG + Intronic
1019371956 7:666678-666700 AGGGATCTTCCTGCTGACTGTGG + Intronic
1019872501 7:3778200-3778222 ATGAAACTTCTTTCTTAATAAGG - Intronic
1020744501 7:12064983-12065005 ATGTATCTTCTCACTGAATCAGG + Intergenic
1021075523 7:16299459-16299481 ATGTATATTCTGACTGAATGAGG + Intronic
1021186627 7:17572379-17572401 ATGTATTTTGTTTCTGCATGTGG - Intergenic
1021971656 7:25971008-25971030 CTGGAGCCTCTTTCTGCATGTGG - Intergenic
1022321430 7:29291487-29291509 ATGTATTTTCTTTTTAAATGTGG + Intronic
1022568631 7:31428775-31428797 TTGCATCTTCTTTCTAAATGCGG - Intergenic
1023205346 7:37742881-37742903 ATGGATTTTCTTTCCAAATTCGG + Intronic
1026587960 7:71672348-71672370 ATGAATCTGATCTCTGAATGAGG + Intronic
1026624753 7:71982110-71982132 TTGGTTCTTCTTTGTGAAGGAGG + Intronic
1030373332 7:108725968-108725990 ATGGTTCTTCTTTCTGCCTTTGG + Intergenic
1030461353 7:109840062-109840084 GGGGATTTTCTTTCTAAATGAGG - Intergenic
1030635983 7:111949483-111949505 ATTGATATTCTTTCTGAAACAGG - Intronic
1030661889 7:112228425-112228447 ATGCATGTTCTTTCTGGAAGAGG + Intronic
1032766723 7:135001077-135001099 ATGGATTTTATATCTGATTGGGG - Intronic
1033783871 7:144706373-144706395 ATGGATCTAGTTTCTGATTCAGG - Intronic
1036114839 8:5947658-5947680 ATGTTTCTTCTTTCAGACTGAGG + Intergenic
1037765911 8:21772147-21772169 CCAGATCTTCTGTCTGAATGAGG - Intronic
1038085829 8:24195167-24195189 ATGGATATTCATTCTGGATTTGG + Intergenic
1038273200 8:26094068-26094090 GAATATCTTCTTTCTGAATGAGG + Intergenic
1038865745 8:31437067-31437089 ATGGATATTATGTCTGACTGCGG + Intergenic
1040710527 8:50183271-50183293 ATTAATCTTCTGTGTGAATGCGG - Intronic
1045437335 8:102177003-102177025 ATGCTTTTTCTTTCTGCATGAGG - Intergenic
1045688029 8:104731803-104731825 ATGCATCTTTTTTCAGAAAGTGG + Intronic
1047825388 8:128568207-128568229 ATGAATCTTCTATCTGAAATGGG + Intergenic
1048469403 8:134694108-134694130 ATGTCTCTTCACTCTGAATGTGG - Intronic
1048731454 8:137445813-137445835 ATGGATTTTCAGTATGAATGTGG + Intergenic
1049948122 9:617882-617904 ATGGAATTTCTTACTGAAAGAGG + Intronic
1051201615 9:14633145-14633167 TTGGTTCTTCTTTGTGAAGGAGG - Intronic
1051564047 9:18476203-18476225 ATGTATTTTGTGTCTGAATGTGG + Intronic
1051602277 9:18887305-18887327 ATGGATCTTTTTTCTGCATAAGG - Intronic
1052536076 9:29749222-29749244 ATGGCTTTTCTTTCTCAACGTGG + Intergenic
1054358558 9:64089370-64089392 ATTCAGCTTCTCTCTGAATGTGG + Intergenic
1056307322 9:85302905-85302927 GTGGATCTTTCTTCAGAATGGGG - Intergenic
1056878799 9:90368096-90368118 ATTGATCTTTTTTCTGAAGAGGG + Intergenic
1059790270 9:117635143-117635165 CTGTCTCTTCTTTCAGAATGTGG + Intergenic
1060459667 9:123838785-123838807 AGTGATTTTCTTTCAGAATGAGG - Intronic
1060573063 9:124661274-124661296 ATGGATATTCTAAGTGAATGAGG + Intronic
1062368504 9:136223993-136224015 ATGGAGCTACTCACTGAATGGGG + Exonic
1203704059 Un_KI270742v1:21216-21238 ATTCAGCTTCTCTCTGAATGTGG + Intergenic
1188158529 X:26772410-26772432 ATGGATTTTCATTCTAAAGGTGG + Intergenic
1188504019 X:30861588-30861610 ATTTAACTTTTTTCTGAATGGGG + Intronic
1190373820 X:49768907-49768929 ATTTATCTTCTTTTTAAATGAGG - Intergenic
1192074670 X:67980858-67980880 ATGGGTGTTCTTCCTGAAAGAGG - Intergenic
1192949544 X:76002722-76002744 AAGGATTTTCTTTATGAATCTGG + Intergenic
1194284660 X:91995380-91995402 ATGTTTCTTCTTTTTGAATATGG + Intronic
1195242197 X:102963233-102963255 ATGGAGATTCTGGCTGAATGGGG + Intergenic
1195459367 X:105106608-105106630 AAAGATTTGCTTTCTGAATGGGG - Intronic
1196780292 X:119377439-119377461 ATGGACATTCTTTCTGAATATGG + Intergenic
1196968997 X:121088144-121088166 ATGGATCACCTTGGTGAATGAGG + Intergenic
1197866219 X:131020903-131020925 ATGGATTTTCTTTGTTAATATGG + Intergenic
1200535968 Y:4398130-4398152 ATGAATCTTCCTTCAGAAAGAGG + Intergenic
1202330569 Y:23748305-23748327 CTGAATCCTCTTTCTGAAAGAGG - Intergenic
1202540200 Y:25921756-25921778 CTGAATCCTCTTTCTGAAAGAGG + Intergenic