ID: 906794891

View in Genome Browser
Species Human (GRCh38)
Location 1:48689009-48689031
Sequence AATGGATCTTCTTTCTGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 332}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906794891_906794898 20 Left 906794891 1:48689009-48689031 CCCATTCAGAAAGAAGATCCATT 0: 1
1: 0
2: 2
3: 24
4: 332
Right 906794898 1:48689052-48689074 CTAAAAATACAAAACTTAGCTGG 0: 1425
1: 87933
2: 73848
3: 45237
4: 45647
906794891_906794901 30 Left 906794891 1:48689009-48689031 CCCATTCAGAAAGAAGATCCATT 0: 1
1: 0
2: 2
3: 24
4: 332
Right 906794901 1:48689062-48689084 AAAACTTAGCTGGGCTGTGGTGG 0: 2
1: 15
2: 130
3: 490
4: 1252
906794891_906794900 27 Left 906794891 1:48689009-48689031 CCCATTCAGAAAGAAGATCCATT 0: 1
1: 0
2: 2
3: 24
4: 332
Right 906794900 1:48689059-48689081 TACAAAACTTAGCTGGGCTGTGG 0: 2
1: 11
2: 139
3: 894
4: 1847
906794891_906794899 21 Left 906794891 1:48689009-48689031 CCCATTCAGAAAGAAGATCCATT 0: 1
1: 0
2: 2
3: 24
4: 332
Right 906794899 1:48689053-48689075 TAAAAATACAAAACTTAGCTGGG 0: 1001
1: 62119
2: 132923
3: 100617
4: 63037

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906794891 Original CRISPR AATGGATCTTCTTTCTGAAT GGG (reversed) Intronic
900214425 1:1473804-1473826 AAATGATCTTCTTTCTAAAAAGG - Intronic
900888858 1:5434722-5434744 AATGCTTCTTGTTTCTGAAAAGG - Intergenic
902850505 1:19152144-19152166 AATGGATATTCTTACTCACTTGG - Intronic
905142837 1:35862049-35862071 AATGGTTCGTTTTTCAGAATGGG + Intergenic
905645245 1:39620737-39620759 AATGGAGCTTCCTGCTGACTTGG + Intergenic
906794891 1:48689009-48689031 AATGGATCTTCTTTCTGAATGGG - Intronic
906913281 1:49979910-49979932 GATGAATCATCTTTCTGAAATGG - Intronic
907366852 1:53968699-53968721 AATAGAACTTCTTTCAAAATTGG + Intergenic
908007069 1:59738081-59738103 GAAGGTTCTTCTTTTTGAATAGG - Intronic
909154841 1:72060848-72060870 AATTGATTTACTTTCTGGATAGG + Intronic
909341912 1:74541786-74541808 AATGTATCTTCTTTGTTTATAGG - Intronic
910022707 1:82611621-82611643 GATCCATCTTCTTTCTGAGTAGG - Intergenic
912024450 1:105149935-105149957 AATAGAACTTCTTTCAAAATTGG - Intergenic
912873837 1:113335475-113335497 AATGGAACTTCTTTCGCAATTGG + Intergenic
912873915 1:113336194-113336216 AATGGAAAATCTTTCTGAAAAGG - Intergenic
913109592 1:115645842-115645864 AATAGATCTACTTACTGCATAGG + Intronic
913278779 1:117165002-117165024 AATAGAATTTCTTTCTGTATTGG + Intronic
913401518 1:118439639-118439661 CATGGAGCTTCATTCTAAATGGG - Intergenic
916259884 1:162831121-162831143 TGTGGATTTTCTTTATGAATAGG + Intronic
916973000 1:170044219-170044241 AATGGATATTGTATCTGACTAGG + Intronic
916990183 1:170235132-170235154 ATTAGATATTTTTTCTGAATGGG + Intergenic
917669579 1:177260462-177260484 AATAGAACTTCTTTCAAAATTGG - Intronic
917736655 1:177927254-177927276 AATGAATATACTTTCTGAAGAGG - Intronic
919199976 1:194343511-194343533 AATAGAACTTCTTTCAAAATTGG + Intergenic
919415399 1:197302017-197302039 AATAGAACTTCTTTCAAAATTGG - Intronic
920887646 1:209947064-209947086 AAGGCATCTTTTTTCTGAGTAGG - Intronic
921233262 1:213096046-213096068 AGTAGAACTTCTTTCAGAATTGG + Intronic
922389428 1:225124365-225124387 AATGGAAATTCTTTCAAAATTGG + Intronic
922487962 1:225990630-225990652 AATGTTTGTTCTTTCTGAAATGG - Intronic
922959055 1:229629793-229629815 AGTAGAACTTCTTTCTAAATTGG + Intronic
923931044 1:238697376-238697398 AATGGATCTTTTTTGTCAAAAGG - Intergenic
923936032 1:238761413-238761435 AGTAGATCTTCTTTCAAAATGGG + Intergenic
924177900 1:241411544-241411566 CATTGTTCTCCTTTCTGAATAGG - Intergenic
924629766 1:245725594-245725616 AAAGGATCTTCTTTCTCCTTTGG - Intergenic
924637846 1:245805750-245805772 AATGCATCATCAGTCTGAATGGG - Intronic
1064242594 10:13644767-13644789 AATGTATAATGTTTCTGAATGGG + Exonic
1064698706 10:17995116-17995138 GGTGGATCTACTTTCTTAATGGG + Intronic
1065746161 10:28844471-28844493 AAGGGATATTCTTGATGAATTGG + Intergenic
1067855769 10:49791610-49791632 AATGGATCTGTTTTGTAAATTGG - Intergenic
1067906068 10:50292657-50292679 AATGGATCTGCCTTTTTAATTGG - Intergenic
1067947227 10:50697208-50697230 CTTGGGTGTTCTTTCTGAATGGG - Intergenic
1068248224 10:54401499-54401521 AATGGATACTCATTCTTAATAGG + Intronic
1071056491 10:81516848-81516870 AATGGATTTTGTTTCTGGGTGGG + Intergenic
1071226051 10:83529062-83529084 AATAGAAATTCTTTCAGAATTGG + Intergenic
1071961927 10:90815440-90815462 AATGGATCTTGTATCTGACTGGG + Intronic
1073194912 10:101682598-101682620 AATGGATATATTTCCTGAATTGG + Intronic
1073706965 10:105995183-105995205 TATGTATTTTCTTTCTGAAAAGG - Intergenic
1074031770 10:109696340-109696362 TTTGGTTCTTCTTTCTGAAAAGG - Intergenic
1075010236 10:118862241-118862263 AATAGAACTTCTTTCAAAATCGG - Intergenic
1075339496 10:121634512-121634534 AATGGAAGTTATTTCTGAATAGG + Intergenic
1075354680 10:121760751-121760773 AGTAGAACTTCTTTCAGAATTGG - Intronic
1075485612 10:122819813-122819835 AATGGATCGTCATTTAGAATCGG - Intergenic
1077309808 11:1883254-1883276 ACTGGACCTTCTTTCCCAATGGG + Intronic
1077962094 11:7086581-7086603 AATGGATATTGTGTCTGACTGGG - Intergenic
1078750021 11:14152877-14152899 AAGGGATATTCTTTCTCAAATGG + Intronic
1078836699 11:15036981-15037003 CATGGAGCTTCCTCCTGAATTGG - Intronic
1080546366 11:33322886-33322908 AAGGCATTTTCTTCCTGAATAGG + Intronic
1080788165 11:35494704-35494726 CATGGGTCTTCTTTCTCATTCGG - Intronic
1081573031 11:44303236-44303258 AGTGGATTTTCATTCTGAACTGG - Intronic
1082069210 11:47925074-47925096 AATCGATTTTATTTTTGAATAGG + Intergenic
1085983195 11:81749548-81749570 AAGTTATCTTCCTTCTGAATGGG + Intergenic
1086081840 11:82911297-82911319 AGTAGAACTTCTTTCAGAATTGG + Intronic
1086495067 11:87394974-87394996 AATACAACTTCTTTCAGAATTGG - Intergenic
1086515591 11:87608952-87608974 AATTTAGCTTCTTTCTGATTTGG - Intergenic
1086798607 11:91142127-91142149 AATGTAACTTCTTTCAAAATTGG + Intergenic
1087665556 11:101043128-101043150 AATAGAACTTCTTTCATAATTGG + Intronic
1088953071 11:114589859-114589881 AATGAATCTCCATTCTGCATTGG - Intronic
1090218093 11:124988639-124988661 AGTAGAACTTCTTTCAGAATTGG + Intronic
1092152227 12:6257558-6257580 AATAGAACTTCTTTCAAAATTGG + Intergenic
1093305082 12:17506986-17507008 ATTATATCTTCTTTCTGAAGTGG - Intergenic
1095760389 12:45826801-45826823 AATGGTGTTTATTTCTGAATGGG - Intronic
1096870018 12:54587360-54587382 AATTGATATTCTTTAGGAATGGG + Intronic
1097439263 12:59589598-59589620 AATAGACCTTCTTTCAAAATTGG - Intergenic
1097442717 12:59631177-59631199 GATTTATTTTCTTTCTGAATTGG + Intronic
1097689470 12:62721078-62721100 AATGGATCTTCTTTCTTTTCTGG + Intronic
1099218492 12:79882658-79882680 AGTAGAACTTCTTTCAGAATTGG - Intronic
1099432882 12:82609202-82609224 TCTGGATCTTATTTCTGTATTGG - Intergenic
1100016728 12:90020156-90020178 ATGGGATCATCTTTGTGAATCGG + Intergenic
1100029763 12:90171895-90171917 AATCTGACTTCTTTCTGAATGGG + Intergenic
1105288459 13:19028620-19028642 AGTGGAACTTCTTTCCAAATCGG + Intergenic
1106345106 13:28869112-28869134 AATGGTTCTTCTTTGTGAATGGG - Intronic
1107143866 13:37035957-37035979 AGTAGAACTTCTTTCAGAATTGG - Intronic
1107341227 13:39408752-39408774 ACTGGATCTGCTTTCTGTTTTGG - Intronic
1107359176 13:39601330-39601352 AATGGATCTTCAGTCTTACTGGG + Exonic
1108128822 13:47274589-47274611 AATGAATCTTCTCTCTGCACAGG + Intergenic
1108938716 13:55921052-55921074 AATGGAACTTCTTTCAAAATTGG - Intergenic
1109224107 13:59671623-59671645 ATTGCATTTTCTTACTGAATTGG - Intronic
1109459429 13:62636504-62636526 AATTGGTCTTCCTTCTTAATAGG + Intergenic
1113876356 13:113597183-113597205 AATGGAAATTCTTTCTAAAAGGG + Intronic
1115308351 14:31955031-31955053 AATAGAACTTCTTTCAAAATTGG - Intergenic
1116299911 14:43165434-43165456 AATAGAACTTCTTTCAAAATTGG - Intergenic
1117669964 14:58096605-58096627 AATGGATTTTCTTTGTTTATGGG - Intronic
1117867627 14:60165762-60165784 AGGGGATGTTCTTTCTGAATAGG - Intronic
1118176530 14:63445947-63445969 AATGGAACTTCTTTTCAAATTGG + Intronic
1119624819 14:76163957-76163979 ACTGGATCTTCTTTCTGCCCCGG + Intronic
1119925660 14:78491044-78491066 AATGCAACTCTTTTCTGAATAGG - Intronic
1120541790 14:85760188-85760210 AATTGTTTTGCTTTCTGAATTGG - Intergenic
1120660450 14:87242693-87242715 AATGCATCTTCTTTCTTATTTGG - Intergenic
1120997460 14:90427481-90427503 ATTGCATCTCCTTTCTGAACAGG - Intergenic
1124036664 15:26059584-26059606 AATGGAACTTCTCTCAAAATTGG - Intergenic
1124917347 15:33988787-33988809 AATGGTCCTTCTTGCTGCATGGG - Intronic
1126615244 15:50571907-50571929 AGTGGAACTTCTTTCAAAATTGG - Intronic
1127446884 15:59072324-59072346 CATAGAACTTCTTTCAGAATTGG + Intronic
1128034814 15:64515546-64515568 AATGGATCTTCTTTTTAAAGGGG + Intronic
1128629130 15:69245624-69245646 AATAGAACTTCTTTCAAAATTGG + Intronic
1129354150 15:74977844-74977866 AATGGATCTTGAGTCAGAATGGG + Intronic
1130640376 15:85667919-85667941 AATGGACTGTCTTTCTGAAGTGG + Intronic
1130952034 15:88599573-88599595 AAAAGAACTTCTTTCTGAACTGG + Intergenic
1131516584 15:93081844-93081866 ATTTGTTCTTCTTTCTGGATTGG - Intronic
1132773308 16:1577242-1577264 GATGAATCATCTTTCTGAAATGG - Intronic
1134426361 16:14150762-14150784 AATGAATCATCTGTCTGAAATGG + Intronic
1134821368 16:17250109-17250131 CATGGAGCTTCTACCTGAATAGG - Intronic
1135613692 16:23890772-23890794 AAAGGTTGTTGTTTCTGAATGGG - Intronic
1137931272 16:52589605-52589627 ACTGGATCTTCATTGTGACTAGG - Intergenic
1139061731 16:63261670-63261692 AAAGGATCTTCTTTCTCCTTTGG + Intergenic
1143705863 17:8697337-8697359 AATGGAGATTGTTTGTGAATTGG + Intergenic
1144449409 17:15363777-15363799 AATGTGTCTTCTTCATGAATAGG - Intergenic
1145806575 17:27738044-27738066 AGTAGAGCTTCTTTCAGAATTGG - Intergenic
1146359996 17:32166530-32166552 AGTGGAACTTCTTTCAGAATTGG + Intronic
1148139474 17:45317880-45317902 AACAGTGCTTCTTTCTGAATGGG + Intergenic
1150513265 17:65778497-65778519 AATGTGTCTTCTTTCTGAATAGG + Intronic
1153979506 18:10297166-10297188 AAGGGATCCTCTTTCTCATTGGG - Intergenic
1154093864 18:11392023-11392045 AATGGATCTTTATTCTTCATAGG - Intergenic
1154096466 18:11420750-11420772 AGTGGAACTTCTTTCAAAATCGG + Intergenic
1154309516 18:13256308-13256330 AATGGCTCTTCTTTTAAAATAGG + Intronic
1154471264 18:14703974-14703996 AGTGGAACTTCTTTCCAAATCGG - Intergenic
1155528431 18:26741368-26741390 TATGTATCTCCTTTCTGAAAGGG - Intergenic
1155718883 18:28985465-28985487 AATTGATGTTCTTTGGGAATTGG + Intergenic
1156156957 18:34314592-34314614 TTTGGATCATCTTTATGAATAGG + Intergenic
1156208463 18:34911926-34911948 AATGGTTATTCTATCTGAAATGG + Intergenic
1156850500 18:41720216-41720238 AATGGATCTACTCACTGGATGGG - Intergenic
1156973711 18:43190392-43190414 AATGGTTCTTTTGTCTGAATTGG + Intergenic
1157133173 18:45027784-45027806 AATGCATCATCTTTCAGTATTGG + Intronic
1157960233 18:52145340-52145362 AATAGAACTTCTTTCAAAATTGG + Intergenic
1159198757 18:65154906-65154928 TATGGATTTTATTTCTGAATGGG - Intergenic
1160656494 19:274452-274474 AATAGAACTTCTTTCAAAATTGG - Intergenic
1161359459 19:3839134-3839156 AATGTTTCTTCTTTATGGATAGG - Intronic
1161901221 19:7120974-7120996 AATGTAGCTTCTTTGTGATTTGG - Intronic
1162264952 19:9564745-9564767 AGTGGAACTTCTTTTAGAATTGG - Intronic
1165402073 19:35607716-35607738 AATGGATTTTCTTGTTGAACAGG + Intergenic
1165541603 19:36496622-36496644 AATGGAGCTTTTTTCTTTATCGG - Intergenic
1165800097 19:38544012-38544034 AATCCATCCTCTTTCTGGATTGG + Intronic
1168533797 19:57152108-57152130 AATAGAACTTCTTTCAAAATTGG - Intergenic
926964194 2:18392068-18392090 AATGATTCTTCTTTGTGAAGTGG + Intergenic
927440090 2:23108865-23108887 GTTGGCTCTTCTTTCTTAATAGG - Intergenic
928701190 2:33900786-33900808 AATGCATTCTCTGTCTGAATAGG + Intergenic
928940518 2:36722569-36722591 AAAGGATCTGCTTTATAAATTGG + Intronic
928968859 2:37005540-37005562 GATGGATTTTTTTTCTGTATTGG - Intronic
930345413 2:50174077-50174099 AATAGAGCTTCTCTCTAAATTGG + Intronic
930804656 2:55478419-55478441 AATTGATCATTTTTCAGAATGGG + Intergenic
931075810 2:58710286-58710308 AAAGAATCTACATTCTGAATGGG - Intergenic
931246257 2:60495109-60495131 ATTGGATTTTATTTCTCAATGGG - Intronic
931804990 2:65795784-65795806 CATGGATGATCTTTCTAAATAGG - Intergenic
932023344 2:68110702-68110724 AGTGGCTGTTCTTTCTGCATGGG + Intronic
932816888 2:74868969-74868991 AATGGATTTTTTTTCTCAATTGG - Intronic
932912013 2:75816647-75816669 AATGTATTTTCTTTCAGTATAGG + Intergenic
933568835 2:83983021-83983043 GATGAATCCTCTTTCTGAAAAGG + Intergenic
933755673 2:85636435-85636457 ACTACATGTTCTTTCTGAATAGG + Intronic
933912333 2:86952996-86953018 TCTGGGTCTTCTTTATGAATTGG + Exonic
934010662 2:87816901-87816923 TCTGGGTCTTCTTTATGAATTGG - Exonic
934636822 2:95996779-95996801 AATGGGGCTTTGTTCTGAATTGG + Intergenic
934796832 2:97108645-97108667 AATGGGGCTTTGTTCTGAATTGG - Intergenic
934836587 2:97594786-97594808 AATGGGGCTTCGTTCTGAATTGG + Intergenic
935036825 2:99384984-99385006 AATAGAGCTTCTTTCAAAATTGG - Intronic
935774237 2:106457602-106457624 TCTGGGTCTTCTTTATGAATTGG - Exonic
935905832 2:107838311-107838333 TCTGGGTCTTCTTTATGAATTGG + Exonic
935992312 2:108730828-108730850 TCTGGGTCTTCTTTATGAATTGG + Exonic
936127634 2:109803486-109803508 TCTGGGTCTTCTTTATGAATTGG + Exonic
936217063 2:110567999-110568021 TCTGGGTCTTCTTTATGAATTGG - Exonic
936426203 2:112422583-112422605 TCTGGGTCTTCTTTATGAATTGG - Exonic
936726415 2:115323116-115323138 AATAGACCTTCTTTCAAAATGGG + Intronic
937219849 2:120336420-120336442 ATTAGATCTTTTTCCTGAATAGG + Intergenic
938606445 2:132898064-132898086 AGTGGAACTTCTTCCAGAATTGG + Intronic
938947037 2:136222561-136222583 AATAGAACTTCTTTCAAAATTGG - Intergenic
940608541 2:155960337-155960359 AATAGAACTTCTTTCAAAATGGG - Intergenic
941473217 2:165916281-165916303 AATGGAAATTCTTTGTGATTTGG + Intronic
944610523 2:201400680-201400702 AATGATACTGCTTTCTGAATGGG + Intronic
944921275 2:204415392-204415414 AATAGATCTGCTTGCTGAATAGG + Intergenic
945756938 2:213858189-213858211 AGTGGAACTTCTTTCAAAATTGG - Intronic
946423714 2:219580477-219580499 AAAGGATCTTATTTCTGGCTGGG - Intergenic
946644788 2:221821369-221821391 GCTGGAGCATCTTTCTGAATGGG + Intergenic
948653560 2:239463670-239463692 AATAGATCATCTTTCTAAATAGG + Intergenic
948955207 2:241284617-241284639 AATAGAACTACTTTCAGAATTGG - Intronic
1168813284 20:720140-720162 ACTGGACCTTCCTCCTGAATGGG + Intergenic
1169697444 20:8406658-8406680 AATGAATTTTCTTTATGAAAAGG - Intronic
1170138128 20:13098223-13098245 AATGTGTCTTCTTTAAGAATAGG - Intronic
1172929330 20:38573375-38573397 AATGAATTTTCTTTCTATATAGG - Intronic
1173212225 20:41043905-41043927 AATGCATCTTCTTTCCCAAGAGG - Intronic
1173658262 20:44715777-44715799 AATGTATCCTCATTATGAATGGG + Intronic
1174650776 20:52123315-52123337 AATAGAACTTCTTTCAAAATTGG - Intronic
1175078012 20:56392216-56392238 AAAGGTTCTTCTTTTTAAATAGG + Intronic
1178714980 21:34956266-34956288 AATGTATCTTCTTTCTGCTTGGG - Intronic
1180954939 22:19737403-19737425 GAGGGATGTACTTTCTGAATGGG - Intergenic
1181017002 22:20076446-20076468 TGTGGCTCTTCATTCTGAATGGG - Intergenic
1182033245 22:27176628-27176650 AAGGGTTCTTATTGCTGAATTGG - Intergenic
1182838967 22:33369112-33369134 AATAGAACTTCTTTCAAAATTGG + Intronic
1182981252 22:34673579-34673601 CATGAATCTGCTTTCTAAATGGG + Intergenic
1183146876 22:36001097-36001119 CTTGGATCTTCTTTCTGAGAAGG - Intronic
951506801 3:23455958-23455980 AATGTAACTTCTTTCAAAATTGG + Intronic
951608725 3:24467000-24467022 AGTGGAACTCCTTTCAGAATTGG + Intronic
952206246 3:31183827-31183849 AAAGCCTCTTCTATCTGAATAGG - Intergenic
952443308 3:33355358-33355380 AATGGATCATGTTTCTGGATTGG + Intronic
953039704 3:39244908-39244930 TGTGGATATTCTTTCAGAATTGG + Intergenic
953230108 3:41057313-41057335 AATGAATTTTCCTTATGAATAGG + Intergenic
953469766 3:43156720-43156742 AATATACCTTCTTTCTGAAATGG + Intergenic
956185332 3:66557028-66557050 AAAGGAACTTCTTACTGAAAAGG + Intergenic
957303939 3:78431693-78431715 ATTGGGGGTTCTTTCTGAATTGG + Intergenic
957470826 3:80655357-80655379 AAGGGATCTTGTTTGGGAATAGG + Intergenic
957477593 3:80746475-80746497 AATGCATCGACTTTCTGAAGAGG + Intergenic
960181290 3:114582966-114582988 AATGGATGATCTTTGTGCATTGG - Intronic
962558761 3:136583831-136583853 AATTGATCTTCTGTCTAATTAGG - Intronic
963501257 3:146130166-146130188 AAAGGCTCTTCTCTTTGAATGGG - Intronic
963646659 3:147923485-147923507 AGGGCATCTTCTTTGTGAATGGG - Intergenic
965438806 3:168687310-168687332 AGTAGATCTTCTTTCAAAATTGG - Intergenic
966368166 3:179213642-179213664 AATAGAACTTCTTTCAGATTTGG + Intronic
966750695 3:183319081-183319103 AATAGAACTTCTTTCAAAATTGG + Intronic
967496943 3:190152623-190152645 AATCAATTTTCTTTCTGTATGGG - Intergenic
968766626 4:2474615-2474637 AGTGGAACTTCTTTCAAAATTGG - Intronic
969167184 4:5326428-5326450 GATGGATCTTTCTTCTGACTAGG + Intronic
970578946 4:17455993-17456015 AGTTGAACTTCTTTCAGAATTGG - Intergenic
971765858 4:30830719-30830741 AAATGATTTTCTTTCTGAAATGG - Intronic
971977761 4:33712322-33712344 AATAGAACTTCTTTCAAAATTGG + Intergenic
972837496 4:42890838-42890860 AGTAGATCTTCTTTCCAAATTGG - Intergenic
973061374 4:45730019-45730041 GATGAATCATCTTTCTGAAATGG - Intergenic
974172683 4:58287561-58287583 AACAAATTTTCTTTCTGAATTGG - Intergenic
974974417 4:68872138-68872160 AATGGGTATTCTATCTGAATGGG + Intergenic
976256246 4:83103548-83103570 AATAGAACTTCTTTCAAAATTGG - Intronic
976885245 4:89975088-89975110 AAGGGAACTTCTTTCAAAATTGG + Intergenic
978662451 4:111144169-111144191 CATGTGTCTTTTTTCTGAATAGG - Intergenic
978957788 4:114635683-114635705 AATGGATCTTTTTTATGAGGGGG - Intronic
978974789 4:114856601-114856623 AATGGATCTTCTATTTTAATTGG - Intronic
979238297 4:118425693-118425715 CATGGATCTTGACTCTGAATTGG + Intergenic
979474339 4:121137199-121137221 AAGATATTTTCTTTCTGAATTGG - Intronic
979812832 4:125061113-125061135 AATGGACTTACTTTCTAAATAGG - Intergenic
980221422 4:129921231-129921253 AGTAGAACTTCTTTCAGAATTGG - Intergenic
981459246 4:144992798-144992820 AATAGAACTTCTTTCAAAATTGG - Intronic
981523337 4:145687661-145687683 AATGATTTTCCTTTCTGAATTGG + Intronic
981658809 4:147142551-147142573 AATAGAACTTCTTTCAAAATTGG - Intergenic
981995516 4:150969899-150969921 AGTAGAACTTCTTTCAGAATTGG - Intronic
982780426 4:159484730-159484752 AATGAATCATCTTTAGGAATAGG + Intergenic
983333027 4:166355839-166355861 AGTAGAACTTCTTTCAGAATTGG + Intergenic
983564489 4:169134981-169135003 AATGCATTCACTTTCTGAATGGG - Intronic
984392664 4:179156801-179156823 AATGCATCGTCCTTTTGAATGGG + Intergenic
984504194 4:180596017-180596039 ATTGGATCTTCTGTCAAAATAGG + Intergenic
984704180 4:182835643-182835665 AATGGATGGCCCTTCTGAATGGG - Intergenic
987602325 5:20087404-20087426 AGTGAAACTTCTTTCTAAATTGG - Intronic
987732114 5:21787157-21787179 AATGGAACTCCTTTCAAAATTGG - Intronic
988274567 5:29064395-29064417 AGTGGAACTTCTTTCAAAATTGG - Intergenic
988777812 5:34492776-34492798 AATGGATTTCTTTTCTGAAAGGG + Intergenic
989444939 5:41516526-41516548 AGTGGAGCTTCATTCTGATTTGG + Intergenic
990005036 5:50935895-50935917 TATGGATTTTCTTTCTGAGTTGG + Intergenic
990222520 5:53608454-53608476 AGTGGAACTTCTTTCAAAATTGG + Intronic
990284997 5:54292272-54292294 ACTGGCCCTTCTTTATGAATGGG + Intronic
990412039 5:55551072-55551094 AGAGGATCTTCTTTCTGAAGAGG - Intergenic
990790934 5:59478517-59478539 ATTGTATCTTCTTTTTAAATTGG + Intronic
993596119 5:89858336-89858358 AGTAGATCTTCTTTCAAAATTGG + Intergenic
993893351 5:93501797-93501819 AATAGAACTTCTTTCAAAATTGG - Intergenic
994450658 5:99937835-99937857 AATCCATCTTCTTTCTGAACAGG - Intergenic
994889226 5:105607976-105607998 ATTATATCTTCTTGCTGAATTGG - Intergenic
995709724 5:115022585-115022607 AATGATTCTTCTTTCAGAAAGGG + Intergenic
996686240 5:126284091-126284113 TATTGATCTTCTGTCTGACTGGG + Intergenic
998719292 5:144925943-144925965 AATAGAACTTCTTTCAAAATTGG - Intergenic
998839117 5:146234477-146234499 TATGGATCTCCTTTCTGATAAGG + Intronic
1001894342 5:175365633-175365655 AATGGAAGTTCTTACTGATTGGG - Intergenic
1002376875 5:178795242-178795264 CATGGAGCTGCTTTCTGAACAGG + Intergenic
1002377571 5:178799164-178799186 AAAAGAGCTTCTTTCTGACTCGG - Intergenic
1003889909 6:10555097-10555119 AAAGGACATTCTTTCTGCATGGG + Intronic
1005192361 6:23239952-23239974 AATTGAATTTCTTTGTGAATTGG - Intergenic
1005562846 6:27059067-27059089 GATCCATCTCCTTTCTGAATAGG - Intergenic
1006917569 6:37604556-37604578 AATGGATCATTTTTCTAAATTGG + Intergenic
1006959416 6:37913252-37913274 AGTAGAACTTCTTTCAGAATTGG + Intronic
1006970103 6:38034674-38034696 AATGGATCTTCTCCCCAAATAGG + Intronic
1008805445 6:55421589-55421611 AATAGAACTTCTTTCAAAATTGG + Intergenic
1008805517 6:55422565-55422587 AATAGAACTTCTTTCAAAATTGG + Intergenic
1010213138 6:73378541-73378563 TATAGATTTTCTTTCTGAGTTGG - Intronic
1011019903 6:82801366-82801388 AGTGGAACTTCTTTCAAAATTGG - Intergenic
1011523571 6:88238401-88238423 AATGTAACTTCTTCCTGAAATGG - Intergenic
1011829251 6:91351086-91351108 AGTGGAACTTCTTTCAAAATTGG - Intergenic
1012231321 6:96763633-96763655 AAAGGATTTGCTTTCTTAATAGG - Intergenic
1012716410 6:102678299-102678321 AGTGGATGTACTTTATGAATAGG - Intergenic
1013028628 6:106307246-106307268 AATGGACTTGCTCTCTGAATCGG - Intronic
1013875522 6:114821743-114821765 AATGGATCTCCTTTTTAAAAAGG - Intergenic
1013922670 6:115427338-115427360 AGTAGAACTTCTTTCAGAATTGG + Intergenic
1014523062 6:122468890-122468912 AATTGATTTTTTTTTTGAATGGG - Intronic
1014577025 6:123086243-123086265 TATGCATTTTCTTTCTAAATGGG - Intergenic
1016257325 6:142123473-142123495 AATAGAACTTCTTTCAAAATTGG - Intergenic
1016666003 6:146641134-146641156 AATGGATTGCCTTTCTGATTTGG - Intronic
1016786318 6:148014697-148014719 AATGGTTTTTCTTCCTAAATGGG + Intergenic
1017525647 6:155239599-155239621 CATGGTGCTTCTGTCTGAATAGG + Intronic
1018079904 6:160250218-160250240 ACTGATTCTTCTTTATGAATAGG + Intronic
1018703109 6:166443245-166443267 GATGGATCGTCTGTCTGAAAAGG + Intronic
1022548792 7:31216244-31216266 AGTAGATCTTCTTTCAAAATTGG + Intergenic
1023377347 7:39570410-39570432 AATTCATCTGCTTTCTAAATTGG + Intronic
1023724576 7:43129147-43129169 AATAGAACTTCTTTCAAAATTGG - Intronic
1024549470 7:50550033-50550055 AGTAGAACTTCTTTCAGAATTGG - Intronic
1026382693 7:69815195-69815217 AATGGATATATTTTCTGAAAGGG + Intronic
1026819675 7:73538419-73538441 AATGGAACTTGTTTCTCCATGGG - Intronic
1029338286 7:99920788-99920810 AATGGATTTTCTTTGCAAATTGG + Intergenic
1030433867 7:109489850-109489872 GATAGATGTTCTTTCTTAATGGG + Intergenic
1030790903 7:113727329-113727351 AATGGATATATGTTCTGAATAGG - Intergenic
1030813778 7:114008648-114008670 AATCGTTTTTCTTTCTTAATGGG - Intronic
1031838677 7:126710377-126710399 AATAGAACTTCTTTCAAAATTGG + Intronic
1032374801 7:131402097-131402119 AATAGAACTTCTTTCAAAATTGG + Intronic
1033107388 7:138540327-138540349 AATAGAACTTCTTTCAGAATTGG + Intronic
1033168316 7:139060815-139060837 AATGAATTTTCTTTCTGAAAGGG - Intronic
1033312577 7:140272400-140272422 ATTCGATTTTCTTTCTGGATGGG + Intergenic
1036214836 8:6870554-6870576 AATGAATCTTGTGTCTCAATTGG - Exonic
1037445272 8:18959239-18959261 AAGGGATCGTCTTTCAGAAAGGG - Intronic
1038770011 8:30469278-30469300 AATGGCTTTACTTACTGAATCGG + Intronic
1040425539 8:47281410-47281432 AATAGAACTTCTTTCAAAATTGG + Intronic
1040935032 8:52773537-52773559 AAAGGATGTTCTTTTTCAATGGG - Intergenic
1041009352 8:53526362-53526384 AATAGAACTTCTTTCAAAATTGG - Intergenic
1041055614 8:53982900-53982922 AGTAGATGTTCTTTCAGAATTGG - Intronic
1041099776 8:54384166-54384188 AATGGATCTTCTGTCTCTAGAGG + Intergenic
1042092554 8:65174675-65174697 AATGGATTCTTTTTCTGAAATGG + Intergenic
1042361512 8:67888760-67888782 TATGGATGTTTTCTCTGAATTGG - Intergenic
1042409718 8:68449950-68449972 AGTAGAACTTCTTTCAGAATTGG + Intronic
1042427632 8:68666917-68666939 AATGCATCTTTTTTATGAAATGG + Intronic
1042635870 8:70873798-70873820 AATAGAACTTCTTTCAAAATTGG - Intergenic
1046130427 8:109961195-109961217 AGTAGATCTTCTTTCAAAATTGG - Intergenic
1047825387 8:128568206-128568228 GATGAATCTTCTATCTGAAATGG + Intergenic
1051019473 9:12524705-12524727 AATAGAACTTCTTTCAAAATTGG - Intergenic
1052377803 9:27737515-27737537 AATGGATTGCCTTTCTGATTTGG + Intergenic
1052423946 9:28279307-28279329 AATAGAATTTCTTTCAGAATTGG - Intronic
1052605638 9:30695879-30695901 AGTGGAACTTCATTCTAAATGGG + Intergenic
1052690622 9:31812269-31812291 AATAGAACTTCTTTCAAAATTGG + Intergenic
1053794145 9:41709585-41709607 CAAGGATCTGCTTTCTGAAGGGG + Intergenic
1054182553 9:61921624-61921646 CAAGGATCTGCTTTCTGAAGGGG + Intergenic
1054470807 9:65536354-65536376 CAAGGATCTGCTTTCTGAAGGGG - Intergenic
1054655955 9:67666855-67666877 CAAGGATCTGCTTTCTGAAGGGG - Intergenic
1055547328 9:77393033-77393055 AATAGAACTTCTTTCAAAATTGG + Intronic
1055886242 9:81066762-81066784 CATTTATCTTCTTGCTGAATTGG + Intergenic
1056878798 9:90368095-90368117 TATTGATCTTTTTTCTGAAGAGG + Intergenic
1057083933 9:92191598-92191620 AATGAATCTTCTTTTTGAGATGG - Intergenic
1060232169 9:121833512-121833534 AATGGATGTTCTTTGTAAACTGG - Intronic
1060681123 9:125565920-125565942 AATGGGTTTTCTTTCTGTCTAGG + Intronic
1061859184 9:133459519-133459541 ATTGGATTTTCTTCCTGGATAGG - Intergenic
1186953406 X:14653710-14653732 AGTGGAACTTCTTTCAAAATTGG - Intronic
1187026783 X:15444066-15444088 AGTGGAACTTCTTTCAAAATTGG - Intronic
1187128743 X:16480585-16480607 ATTGGATCTTGTTTCTGGAATGG - Intergenic
1187284663 X:17893433-17893455 AATGGATTTCCTTCCTGAAATGG + Intergenic
1187433618 X:19247358-19247380 AATGTAGCTTCTGTTTGAATAGG - Intergenic
1188504018 X:30861587-30861609 AATTTAACTTTTTTCTGAATGGG + Intronic
1188726950 X:33597300-33597322 AATGGATGTTCTCTCTCAAATGG - Intergenic
1188862873 X:35278086-35278108 AATGAATCATCTTTATGAACTGG + Intergenic
1191012572 X:55776046-55776068 AATGGCTCTTCTAAATGAATAGG - Intergenic
1193825095 X:86215482-86215504 AATTGAGGTTCTTTTTGAATAGG + Intronic
1194131832 X:90090976-90090998 AATGGGTATTGTTTCTGACTAGG + Intergenic
1194625483 X:96221779-96221801 AACTGAACTTCTTCCTGAATAGG - Intergenic
1194780529 X:98020294-98020316 ATTAAATCTTCTTGCTGAATTGG + Intergenic
1195348876 X:103978379-103978401 AATGGATCTGGTTTCTCAAAAGG - Intergenic
1195358567 X:104060460-104060482 AATGGATCTGGTTTCTCAAAAGG + Intergenic
1195493676 X:105504342-105504364 AATGAAGCTTCTTTCAAAATTGG + Intronic
1197561486 X:128027742-128027764 AATAGAACTTCTTTCAAAATTGG + Intergenic
1197987538 X:132282750-132282772 AGTGGAACTTCTTTCAAAATTGG - Intergenic
1199236565 X:145500512-145500534 AATGTGTCTTCTTCCAGAATAGG + Intergenic
1200389036 X:155924837-155924859 AATAGAACTTCTTTCAAAATTGG + Intronic
1202386071 Y:24327485-24327507 CATGGATCTTGACTCTGAATTGG + Intergenic
1202484715 Y:25342643-25342665 CATGGATCTTGACTCTGAATTGG - Intergenic