ID: 906794892

View in Genome Browser
Species Human (GRCh38)
Location 1:48689010-48689032
Sequence CAATGGATCTTCTTTCTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 189}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906794892_906794900 26 Left 906794892 1:48689010-48689032 CCATTCAGAAAGAAGATCCATTG 0: 1
1: 0
2: 1
3: 19
4: 189
Right 906794900 1:48689059-48689081 TACAAAACTTAGCTGGGCTGTGG 0: 2
1: 11
2: 139
3: 894
4: 1847
906794892_906794898 19 Left 906794892 1:48689010-48689032 CCATTCAGAAAGAAGATCCATTG 0: 1
1: 0
2: 1
3: 19
4: 189
Right 906794898 1:48689052-48689074 CTAAAAATACAAAACTTAGCTGG 0: 1425
1: 87933
2: 73848
3: 45237
4: 45647
906794892_906794899 20 Left 906794892 1:48689010-48689032 CCATTCAGAAAGAAGATCCATTG 0: 1
1: 0
2: 1
3: 19
4: 189
Right 906794899 1:48689053-48689075 TAAAAATACAAAACTTAGCTGGG 0: 1001
1: 62119
2: 132923
3: 100617
4: 63037
906794892_906794901 29 Left 906794892 1:48689010-48689032 CCATTCAGAAAGAAGATCCATTG 0: 1
1: 0
2: 1
3: 19
4: 189
Right 906794901 1:48689062-48689084 AAAACTTAGCTGGGCTGTGGTGG 0: 2
1: 15
2: 130
3: 490
4: 1252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906794892 Original CRISPR CAATGGATCTTCTTTCTGAA TGG (reversed) Intronic
901756153 1:11442770-11442792 CAATGGTGCTTCTTTGTGCAAGG - Intergenic
906194028 1:43918483-43918505 AAATGGATCTTCTTCCCAAATGG + Intronic
906794892 1:48689010-48689032 CAATGGATCTTCTTTCTGAATGG - Intronic
907723115 1:56992391-56992413 CCATGGTGCTTCTTTCTGACAGG - Intergenic
909641615 1:77874039-77874061 CACTGGATTTTATATCTGAAAGG - Intronic
910709290 1:90162492-90162514 CAACTATTCTTCTTTCTGAAAGG + Intergenic
911457279 1:98141454-98141476 CAATGGATCTGCCTTTTGTAAGG + Intergenic
911636438 1:100240966-100240988 CAATGGTTCTACTTTTAGAATGG - Intronic
911672650 1:100624285-100624307 TTATGGATCTTCTTTCTGTGGGG + Intergenic
911823882 1:102455934-102455956 CATAGGCTCTTCTTTCTGACTGG - Intergenic
914399528 1:147304904-147304926 CAATGCCTCTTCTCTTTGAAAGG + Intergenic
915813276 1:158938679-158938701 TAATTGATCATCTTTCTGCAAGG + Intronic
918706318 1:187667181-187667203 AAATGGATCACCTCTCTGAAAGG - Intergenic
922931592 1:229394280-229394302 CCAGGCAACTTCTTTCTGAATGG - Intergenic
923936031 1:238761412-238761434 CAGTAGATCTTCTTTCAAAATGG + Intergenic
924637847 1:245805751-245805773 CAATGCATCATCAGTCTGAATGG - Intronic
1064242593 10:13644766-13644788 CAATGTATAATGTTTCTGAATGG + Exonic
1064938234 10:20704180-20704202 CAATTGATCTCCCTTCTGCAAGG + Intergenic
1065307544 10:24383337-24383359 TAATGGATCTTTTGTCTTAAAGG + Intronic
1065398375 10:25266474-25266496 CACTGGATTTTCTTTCTAATGGG + Intronic
1065438966 10:25729636-25729658 AAATGGCTCTTCTTTCTGGAAGG + Intergenic
1067947228 10:50697209-50697231 CCTTGGGTGTTCTTTCTGAATGG - Intergenic
1069251546 10:66273043-66273065 GAATGAATCTTCTATCTGTAGGG - Intronic
1071755251 10:88530287-88530309 CAATAGATCTTGTTTCTAAATGG + Intronic
1071961926 10:90815439-90815461 AAATGGATCTTGTATCTGACTGG + Intronic
1075227563 10:120643476-120643498 CAAAGGAGCTTCTTTCTTTAGGG + Intergenic
1077268726 11:1665313-1665335 CATGAGATCTACTTTCTGAATGG - Intergenic
1077272049 11:1685990-1686012 CATGAGATCTACTTTCTGAATGG + Intergenic
1077309807 11:1883253-1883275 CACTGGACCTTCTTTCCCAATGG + Intronic
1079068885 11:17325394-17325416 CATTCTATCTTCTTGCTGAATGG + Intronic
1081075011 11:38661267-38661289 GACTGCAACTTCTTTCTGAATGG - Intergenic
1081217101 11:40414807-40414829 GAAGGGATCTTCTCTCCGAAGGG + Intronic
1083129410 11:60610230-60610252 CAATGAATCTTCTTTAAGTAAGG + Intergenic
1083552015 11:63597222-63597244 CAATTAAACCTCTTTCTGAAGGG + Intronic
1086020815 11:82227359-82227381 CACTGGATCTTCATTGTGGAAGG + Intergenic
1088101764 11:106163742-106163764 CTTTGCATCTTCATTCTGAAGGG + Intergenic
1088783153 11:113155654-113155676 AACTGAATCTTCTTTCTGCAAGG + Intronic
1089551809 11:119285202-119285224 CAATGGTTTGTCTTTATGAAGGG - Exonic
1091628448 12:2140261-2140283 CAATGGATCCTCTTGCTGGAGGG - Intronic
1092181477 12:6449943-6449965 CCATGAATCTTCCTTCTGAAAGG + Intronic
1092741975 12:11638914-11638936 CAGTGGATCTTCTGTATCAAAGG + Intergenic
1099073637 12:78078120-78078142 TGATGGATGTTCTTACTGAAAGG - Intronic
1099695781 12:86016722-86016744 CAGTGCATATTCTTTCTCAAAGG + Intronic
1101061104 12:100972905-100972927 CAAAGGATTTTGTATCTGAAGGG + Intronic
1102858197 12:116313158-116313180 AATTGGGTCTTCTTCCTGAAAGG - Intergenic
1105451508 13:20503952-20503974 AAGTGAATCATCTTTCTGAATGG - Intronic
1106345107 13:28869113-28869135 AAATGGTTCTTCTTTGTGAATGG - Intronic
1106760583 13:32863623-32863645 CACTGGATCATATTTCTGAGAGG + Intergenic
1107271149 13:38618188-38618210 CAATGTTTCTTCTTTAAGAAAGG - Intergenic
1107402686 13:40084750-40084772 CAATGGATTTTCTATCAGGAAGG + Intergenic
1108225810 13:48287482-48287504 GAAAGGATCTTCTTTCTAATGGG + Intergenic
1108515048 13:51193324-51193346 CCATAAACCTTCTTTCTGAAGGG + Intergenic
1108810224 13:54213952-54213974 CTATGATGCTTCTTTCTGAATGG + Intergenic
1109217067 13:59601863-59601885 CAGTGGCTTTTCTTTCTTAATGG - Intergenic
1109668292 13:65568145-65568167 CAATGGTTCTGCTTTAAGAAGGG - Intergenic
1110682780 13:78336047-78336069 CAATGAATCCACTTTTTGAAAGG - Intergenic
1112586727 13:100725079-100725101 CAATCTATATTGTTTCTGAATGG + Intergenic
1113128019 13:107001528-107001550 CAATGGATGATCTTTTTCAAAGG - Intergenic
1113876355 13:113597182-113597204 AAATGGAAATTCTTTCTAAAAGG + Intronic
1114676934 14:24447892-24447914 CAATGGATCATCCTTTTTAATGG + Intergenic
1114831287 14:26144919-26144941 CACTGGATTTTTTTTCTGATAGG - Intergenic
1115489461 14:33945143-33945165 CTCTGGATCATCTTTCTGTAAGG - Intronic
1117708987 14:58503771-58503793 CATTGCATATTCTGTCTGAAAGG - Intronic
1118034063 14:61847999-61848021 TATTGGATTTTCTGTCTGAAAGG + Intergenic
1124917348 15:33988788-33988810 CAATGGTCCTTCTTGCTGCATGG - Intronic
1125116826 15:36103753-36103775 AAGTGGATCTTCTTTCTCTACGG - Intergenic
1128034813 15:64515545-64515567 AAATGGATCTTCTTTTTAAAGGG + Intronic
1130767152 15:86882038-86882060 AAGTAGATCTTCTTACTGAAAGG - Intronic
1134234758 16:12456762-12456784 CAATGCATCCTCTCCCTGAAAGG - Intronic
1138470458 16:57230749-57230771 CAAATGATCTTCTTTTTAAATGG + Exonic
1138721558 16:59087995-59088017 CATTGGAACATCTTTCTGGAGGG + Intergenic
1141321704 16:83016631-83016653 CAATGGATCTCCTTCCTAAAGGG - Intronic
1144211643 17:13020794-13020816 CAATGTATGTGTTTTCTGAAGGG + Intergenic
1144875945 17:18397316-18397338 CACTGGGTCTTCTGTTTGAAAGG - Intergenic
1145156283 17:20547104-20547126 CACTGGGTCTTCTGTTTGAAAGG + Intergenic
1146883264 17:36455266-36455288 CACTGGGTCTTCTGTTTGAAGGG + Intergenic
1148139473 17:45317879-45317901 CAACAGTGCTTCTTTCTGAATGG + Intergenic
1150986558 17:70204559-70204581 CCATGCATCTTCTTTAGGAATGG + Intergenic
1152273651 17:79340915-79340937 CAATGCTTCTCCATTCTGAAAGG - Intronic
1153578295 18:6545101-6545123 CAATGTATTTGTTTTCTGAAAGG - Intronic
1155528432 18:26741369-26741391 ATATGTATCTCCTTTCTGAAAGG - Intergenic
1155729764 18:29140253-29140275 CAAGAGATCTTTTTTCGGAATGG - Intergenic
1157374758 18:47152167-47152189 AAATGGATCTACTTGATGAAAGG + Intronic
1157894998 18:51457400-51457422 CAAAGGCTTTTCTTTTTGAATGG + Intergenic
1158003242 18:52643572-52643594 CAGTGGACATTCTTTCTGTAGGG - Intronic
1159198758 18:65154907-65154929 CTATGGATTTTATTTCTGAATGG - Intergenic
1161442913 19:4302552-4302574 CAATGCATTTTCTATCTGAAAGG + Intergenic
1166935209 19:46328129-46328151 CAATGGTGGTTCTTTCTGCATGG + Intronic
1166968868 19:46548660-46548682 CAATGGTGCTTCTTTGTGATGGG - Intronic
925715179 2:6778127-6778149 GAATGGAGCTTGTTTCTGACAGG + Intergenic
925793714 2:7520406-7520428 CAAAGGATGTTCTGTCTGACAGG + Intergenic
926387451 2:12351066-12351088 CAATGGTTCTTCCTGCTGACAGG - Intergenic
927100054 2:19781200-19781222 CATGGGCTCTTCTTTCTGATGGG + Intergenic
928903696 2:36348835-36348857 CAATGTGTCTTATTTCTCAAGGG + Intergenic
932023343 2:68110701-68110723 CAGTGGCTGTTCTTTCTGCATGG + Intronic
932886528 2:75554122-75554144 CAGGGGATCTTGTTTCTGCAAGG - Intronic
932934631 2:76088136-76088158 TAATCTATTTTCTTTCTGAATGG - Intergenic
933837545 2:86258029-86258051 CAAGGGAACCTCTTTGTGAACGG + Intronic
935221864 2:101022098-101022120 CTCAGGATCTACTTTCTGAAGGG - Intronic
935375621 2:102393811-102393833 CGATGGACATGCTTTCTGAAAGG - Intronic
936726414 2:115323115-115323137 CAATAGACCTTCTTTCAAAATGG + Intronic
937172821 2:119893692-119893714 GAAAGGCTCTCCTTTCTGAATGG - Intronic
940608542 2:155960338-155960360 CAATAGAACTTCTTTCAAAATGG - Intergenic
941725601 2:168857089-168857111 CAAAGGATCTGCATTCAGAAAGG + Intronic
942216098 2:173720308-173720330 TATTGGATAATCTTTCTGAAAGG + Intergenic
943742463 2:191425218-191425240 CAATGTATCATCTCTCAGAAAGG + Exonic
944066353 2:195623207-195623229 CAATGGATCTTTTTACTAAATGG - Intronic
944335771 2:198532138-198532160 CAAAGAATCTTTTTACTGAACGG + Intronic
945739265 2:213641149-213641171 CAATGGAGTTACGTTCTGAAGGG + Intronic
1170386303 20:15820966-15820988 CAATGGAGCACCTTTCTGAGAGG + Intronic
1173392927 20:42651073-42651095 AAATGGCTCTTATATCTGAATGG + Intronic
1176192930 20:63821899-63821921 CAAAGGTTTTTATTTCTGAAGGG - Intronic
1177671104 21:24228903-24228925 CTATCGTTCCTCTTTCTGAATGG - Intergenic
1178582280 21:33847142-33847164 CAATGGAACTTTCTTCAGAAGGG - Intronic
1178714981 21:34956267-34956289 AAATGTATCTTCTTTCTGCTTGG - Intronic
950802765 3:15567892-15567914 CAATGGATCATCTGTGTGGAAGG - Exonic
950896502 3:16456421-16456443 GAATGGTTTATCTTTCTGAATGG + Intronic
952799631 3:37276863-37276885 CAATATTTCTTCTTTCTTAAAGG + Intronic
956312957 3:67902344-67902366 AAAGGGATCTTCATGCTGAATGG + Intergenic
956470250 3:69559098-69559120 CAATGGTTCTTCTTTCTCTTTGG + Intergenic
957258197 3:77866030-77866052 CCCAGGATCTTCTTTCTGCAAGG + Intergenic
962618511 3:137152453-137152475 AAGTGGATCTTCTTTCTCTAGGG - Intergenic
962697361 3:137963339-137963361 CACTGGGTCTTCTTTCTGTATGG - Intergenic
964604290 3:158542627-158542649 CAATTAATCTTCTTTCTCTATGG - Intronic
964762077 3:160144034-160144056 CAATGCCTCTTCTTCCTCAAAGG + Intergenic
967269773 3:187723772-187723794 CCTTGGATCTCCCTTCTGAATGG + Intronic
969117356 4:4879060-4879082 CCTTGGATCTGCCTTCTGAATGG + Intergenic
971248519 4:24951783-24951805 GAATTGCACTTCTTTCTGAAAGG - Intronic
971514076 4:27464972-27464994 CCATGGATCTTCCTGATGAAAGG + Intergenic
972529192 4:39946611-39946633 CAATGGGTTTTATTTCTGTAAGG - Intronic
972961718 4:44461185-44461207 CATTTCATCTTCTTTCTCAAAGG + Intergenic
974794501 4:66731323-66731345 CAATGAAACTTCTATCTGAGGGG - Intergenic
974974416 4:68872137-68872159 AAATGGGTATTCTATCTGAATGG + Intergenic
975783531 4:77864122-77864144 AAATGTATATTATTTCTGAAAGG + Intronic
976176373 4:82357358-82357380 CACTGGTTCTTCTTCCTTAAAGG + Exonic
977857498 4:101911495-101911517 CAATGGGGCTTCTTCCTAAAGGG - Intronic
978857729 4:113412295-113412317 TGATGGATTTTCTTCCTGAATGG - Intergenic
978957789 4:114635684-114635706 AAATGGATCTTTTTTATGAGGGG - Intronic
982009299 4:151091492-151091514 GAAAGGATCTTGTTTCTGGAGGG - Intergenic
982110396 4:152048049-152048071 CAATAATTCGTCTTTCTGAAAGG - Intergenic
982387362 4:154824651-154824673 CAGTGGATTCTCTTTGTGAATGG + Intronic
983024734 4:162721021-162721043 CAACATATCTTCTTTGTGAATGG - Intergenic
983634032 4:169880012-169880034 AAATGCACCTTCTCTCTGAACGG - Intergenic
986547157 5:8910429-8910451 CATGGGATCTTCTTCCTAAAGGG - Intergenic
988449602 5:31327823-31327845 CAATGTATTTTCTTTCTAAGAGG - Exonic
988777811 5:34492775-34492797 TAATGGATTTCTTTTCTGAAAGG + Intergenic
990085743 5:51974199-51974221 CAATGGGTCTTGTTTCCAAAGGG + Intergenic
990190191 5:53250895-53250917 CAATGTATCCCCTTTGTGAAGGG - Intergenic
990284996 5:54292271-54292293 CACTGGCCCTTCTTTATGAATGG + Intronic
991527473 5:67577327-67577349 CAATGGAGCTTGGTTCTTAAAGG + Intergenic
992017296 5:72588552-72588574 CAAGGCATCTGCTTTCTAAAAGG - Intergenic
993411020 5:87573229-87573251 CACTGACTCTGCTTTCTGAAAGG + Intergenic
993588095 5:89757725-89757747 CAAGGGATCTTCTTGATAAAAGG + Intergenic
994469183 5:100180735-100180757 CAATCTACCTTCTTTCTGTATGG + Intergenic
995709723 5:115022584-115022606 TAATGATTCTTCTTTCAGAAAGG + Intergenic
996020592 5:118586932-118586954 AATTTGACCTTCTTTCTGAATGG + Intergenic
996525703 5:124477126-124477148 CAATGGATCCTCTATGGGAAAGG - Intergenic
996803704 5:127431096-127431118 CAGTGGATCTTCTTGCTATAGGG + Intronic
997859940 5:137407251-137407273 CAATTGATCTTTTTTCTCTAGGG + Intronic
1000152130 5:158513572-158513594 CAATGGATTTTTTTTCTGTGCGG + Intergenic
1001767460 5:174262138-174262160 CAGTGGATTCCCTTTCTGAATGG + Intergenic
1006782129 6:36639206-36639228 CCAGAGATCTTCATTCTGAACGG + Intergenic
1008299521 6:49818084-49818106 CAGTGCATCATCATTCTGAAGGG + Intergenic
1008929486 6:56923640-56923662 CATTGGATCTTCCTGCTCAATGG - Intronic
1011903084 6:92325289-92325311 CAATGGATGATCTGTTTGAAGGG - Intergenic
1012035368 6:94130893-94130915 AAATGGATTTTCTTTCTGAAGGG + Intergenic
1012716417 6:102678357-102678379 TACTGGGTCTTCTTTCTGCATGG + Intergenic
1013263548 6:108471132-108471154 CAATTGATCATCTTCCTAAAAGG + Intronic
1015415904 6:132948385-132948407 CACTAAATCTTCTTTCTAAATGG + Intergenic
1016096412 6:140043276-140043298 CAATGGGTTTTATTTCTGCATGG - Intergenic
1018204577 6:161425429-161425451 CAATGGAGACTCTTTCTGAAGGG - Intronic
1021349850 7:19578579-19578601 CACTGGCTCTTCGTTTTGAATGG - Intergenic
1022649786 7:32264048-32264070 CAATGGATATTCTATCTAAGGGG - Intronic
1026382692 7:69815194-69815216 AAATGGATATATTTTCTGAAAGG + Intronic
1030703279 7:112664666-112664688 CAATGTATTCTCTTTCTTAAAGG + Intergenic
1033036352 7:137879535-137879557 CAAAGGAACTTCTTTTTCAATGG + Exonic
1033168317 7:139060816-139060838 AAATGAATTTTCTTTCTGAAAGG - Intronic
1035719363 8:1780080-1780102 CATTGGGACTTCATTCTGAAAGG - Intronic
1037445273 8:18959240-18959262 AAAGGGATCGTCTTTCAGAAAGG - Intronic
1039615120 8:38949402-38949424 CAATGTATTTTCTATCTAAAAGG + Intronic
1041054347 8:53967817-53967839 CAATATTTCTTCTTTCTTAAAGG - Exonic
1041860613 8:62508725-62508747 TTATGGATTTTCTTTCAGAATGG + Intronic
1042811345 8:72828605-72828627 CTATGGATCTGTTTTTTGAAAGG + Intronic
1042899405 8:73707253-73707275 CAATGGATCTGCAGTATGAAAGG + Intronic
1043631008 8:82333692-82333714 AAATTGATCTTCTTCATGAAAGG + Intergenic
1048797045 8:138160186-138160208 CTATGGATCTCCTTTTTGACTGG + Intronic
1051266504 9:15314370-15314392 CAGTGGAACTTCTTTCAAAATGG - Intergenic
1052356615 9:27511495-27511517 CCATGGAGCTTCTTTCTCACAGG - Intronic
1053794144 9:41709584-41709606 CCAAGGATCTGCTTTCTGAAGGG + Intergenic
1054151023 9:61605243-61605265 CCAAAGATCTGCTTTCTGAAGGG - Intergenic
1054182552 9:61921623-61921645 CCAAGGATCTGCTTTCTGAAGGG + Intergenic
1054470808 9:65536355-65536377 CCAAGGATCTGCTTTCTGAAGGG - Intergenic
1054655956 9:67666856-67666878 CCAAGGATCTGCTTTCTGAAGGG - Intergenic
1054992582 9:71346594-71346616 CAATGGAACCTCTTTCCCAAAGG - Intronic
1055040791 9:71869342-71869364 CAAAGGATTTTTTTTGTGAATGG - Intronic
1056306027 9:85291243-85291265 CAAAGGATCTTCTGTCTTCAAGG + Intergenic
1058399590 9:104599137-104599159 AAATGGTCTTTCTTTCTGAAAGG + Exonic
1058400054 9:104605351-104605373 AAATGGTCTTTCTTTCTGAAAGG + Exonic
1058400885 9:104617928-104617950 AAATGGTCTTTCTTTCTGAAAGG + Exonic
1059181609 9:112219092-112219114 CACTGGTTCTTCTTTCAGAAAGG + Exonic
1185970068 X:4652816-4652838 CAATAAATATTCTTTCTGGAAGG - Intergenic
1186421877 X:9433078-9433100 GGATGGATCTTCTTTCAGATGGG - Intergenic
1187587980 X:20684996-20685018 CACTGGCTCTACTTACTGAATGG + Intergenic
1188220951 X:27541147-27541169 CTTTGGGTCTTCATTCTGAAAGG - Intergenic
1189503499 X:41586648-41586670 CAAGGGATTTTCTTTCTTATGGG - Intronic
1189806811 X:44743483-44743505 AAATGGACCTTATTTCTCAAGGG - Intergenic
1192862463 X:75090902-75090924 CAATGTATCTTCTATAGGAAGGG - Intronic
1193201902 X:78701371-78701393 CAATGGATGTTCTACCTAAAAGG + Intergenic
1196314032 X:114202009-114202031 CTTTGGATCTTCATTCTGAAGGG - Intergenic
1200842193 Y:7793871-7793893 GAATGGTTTATCTTTCTGAATGG + Intergenic