ID: 906794894

View in Genome Browser
Species Human (GRCh38)
Location 1:48689027-48689049
Sequence GAGACGGGGTTTCACCACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214438
Summary {0: 5, 1: 735, 2: 8309, 3: 59678, 4: 145711}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906794894_906794900 9 Left 906794894 1:48689027-48689049 CCATTGTGGTGAAACCCCGTCTC 0: 5
1: 735
2: 8309
3: 59678
4: 145711
Right 906794900 1:48689059-48689081 TACAAAACTTAGCTGGGCTGTGG 0: 2
1: 11
2: 139
3: 894
4: 1847
906794894_906794899 3 Left 906794894 1:48689027-48689049 CCATTGTGGTGAAACCCCGTCTC 0: 5
1: 735
2: 8309
3: 59678
4: 145711
Right 906794899 1:48689053-48689075 TAAAAATACAAAACTTAGCTGGG 0: 1001
1: 62119
2: 132923
3: 100617
4: 63037
906794894_906794901 12 Left 906794894 1:48689027-48689049 CCATTGTGGTGAAACCCCGTCTC 0: 5
1: 735
2: 8309
3: 59678
4: 145711
Right 906794901 1:48689062-48689084 AAAACTTAGCTGGGCTGTGGTGG 0: 2
1: 15
2: 130
3: 490
4: 1252
906794894_906794898 2 Left 906794894 1:48689027-48689049 CCATTGTGGTGAAACCCCGTCTC 0: 5
1: 735
2: 8309
3: 59678
4: 145711
Right 906794898 1:48689052-48689074 CTAAAAATACAAAACTTAGCTGG 0: 1425
1: 87933
2: 73848
3: 45237
4: 45647

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906794894 Original CRISPR GAGACGGGGTTTCACCACAA TGG (reversed) Intronic
Too many off-targets to display for this crispr