ID: 906794895

View in Genome Browser
Species Human (GRCh38)
Location 1:48689041-48689063
Sequence TTGTATTTTTAGTAGAGACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 609819
Summary {0: 98173, 1: 216399, 2: 153384, 3: 81062, 4: 60801}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906794895_906794900 -5 Left 906794895 1:48689041-48689063 CCCCGTCTCTACTAAAAATACAA 0: 98173
1: 216399
2: 153384
3: 81062
4: 60801
Right 906794900 1:48689059-48689081 TACAAAACTTAGCTGGGCTGTGG 0: 2
1: 11
2: 139
3: 894
4: 1847
906794895_906794902 30 Left 906794895 1:48689041-48689063 CCCCGTCTCTACTAAAAATACAA 0: 98173
1: 216399
2: 153384
3: 81062
4: 60801
Right 906794902 1:48689094-48689116 GCCTGCAATCCCAGCCACTCAGG 0: 45
1: 2605
2: 82030
3: 216545
4: 249053
906794895_906794901 -2 Left 906794895 1:48689041-48689063 CCCCGTCTCTACTAAAAATACAA 0: 98173
1: 216399
2: 153384
3: 81062
4: 60801
Right 906794901 1:48689062-48689084 AAAACTTAGCTGGGCTGTGGTGG 0: 2
1: 15
2: 130
3: 490
4: 1252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906794895 Original CRISPR TTGTATTTTTAGTAGAGACG GGG (reversed) Intronic
Too many off-targets to display for this crispr