ID: 906794896

View in Genome Browser
Species Human (GRCh38)
Location 1:48689042-48689064
Sequence TTTGTATTTTTAGTAGAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 628644
Summary {0: 164005, 1: 210050, 2: 126715, 3: 67031, 4: 60843}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906794896_906794900 -6 Left 906794896 1:48689042-48689064 CCCGTCTCTACTAAAAATACAAA 0: 164005
1: 210050
2: 126715
3: 67031
4: 60843
Right 906794900 1:48689059-48689081 TACAAAACTTAGCTGGGCTGTGG 0: 2
1: 11
2: 139
3: 894
4: 1847
906794896_906794901 -3 Left 906794896 1:48689042-48689064 CCCGTCTCTACTAAAAATACAAA 0: 164005
1: 210050
2: 126715
3: 67031
4: 60843
Right 906794901 1:48689062-48689084 AAAACTTAGCTGGGCTGTGGTGG 0: 2
1: 15
2: 130
3: 490
4: 1252
906794896_906794902 29 Left 906794896 1:48689042-48689064 CCCGTCTCTACTAAAAATACAAA 0: 164005
1: 210050
2: 126715
3: 67031
4: 60843
Right 906794902 1:48689094-48689116 GCCTGCAATCCCAGCCACTCAGG 0: 45
1: 2605
2: 82030
3: 216545
4: 249053

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906794896 Original CRISPR TTTGTATTTTTAGTAGAGAC GGG (reversed) Intronic
Too many off-targets to display for this crispr