ID: 906794897

View in Genome Browser
Species Human (GRCh38)
Location 1:48689043-48689065
Sequence TTTTGTATTTTTAGTAGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489276
Summary {0: 194929, 1: 143151, 2: 66814, 3: 37831, 4: 46551}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906794897_906794900 -7 Left 906794897 1:48689043-48689065 CCGTCTCTACTAAAAATACAAAA 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
Right 906794900 1:48689059-48689081 TACAAAACTTAGCTGGGCTGTGG 0: 2
1: 11
2: 139
3: 894
4: 1847
906794897_906794901 -4 Left 906794897 1:48689043-48689065 CCGTCTCTACTAAAAATACAAAA 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
Right 906794901 1:48689062-48689084 AAAACTTAGCTGGGCTGTGGTGG 0: 2
1: 15
2: 130
3: 490
4: 1252
906794897_906794902 28 Left 906794897 1:48689043-48689065 CCGTCTCTACTAAAAATACAAAA 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
Right 906794902 1:48689094-48689116 GCCTGCAATCCCAGCCACTCAGG 0: 45
1: 2605
2: 82030
3: 216545
4: 249053

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906794897 Original CRISPR TTTTGTATTTTTAGTAGAGA CGG (reversed) Intronic
Too many off-targets to display for this crispr