ID: 906794900

View in Genome Browser
Species Human (GRCh38)
Location 1:48689059-48689081
Sequence TACAAAACTTAGCTGGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2893
Summary {0: 2, 1: 11, 2: 139, 3: 894, 4: 1847}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906794892_906794900 26 Left 906794892 1:48689010-48689032 CCATTCAGAAAGAAGATCCATTG 0: 1
1: 0
2: 1
3: 19
4: 189
Right 906794900 1:48689059-48689081 TACAAAACTTAGCTGGGCTGTGG 0: 2
1: 11
2: 139
3: 894
4: 1847
906794890_906794900 28 Left 906794890 1:48689008-48689030 CCCCATTCAGAAAGAAGATCCAT 0: 1
1: 0
2: 4
3: 23
4: 241
Right 906794900 1:48689059-48689081 TACAAAACTTAGCTGGGCTGTGG 0: 2
1: 11
2: 139
3: 894
4: 1847
906794894_906794900 9 Left 906794894 1:48689027-48689049 CCATTGTGGTGAAACCCCGTCTC 0: 5
1: 735
2: 8309
3: 59678
4: 145711
Right 906794900 1:48689059-48689081 TACAAAACTTAGCTGGGCTGTGG 0: 2
1: 11
2: 139
3: 894
4: 1847
906794896_906794900 -6 Left 906794896 1:48689042-48689064 CCCGTCTCTACTAAAAATACAAA 0: 164005
1: 210050
2: 126715
3: 67031
4: 60843
Right 906794900 1:48689059-48689081 TACAAAACTTAGCTGGGCTGTGG 0: 2
1: 11
2: 139
3: 894
4: 1847
906794895_906794900 -5 Left 906794895 1:48689041-48689063 CCCCGTCTCTACTAAAAATACAA 0: 98173
1: 216399
2: 153384
3: 81062
4: 60801
Right 906794900 1:48689059-48689081 TACAAAACTTAGCTGGGCTGTGG 0: 2
1: 11
2: 139
3: 894
4: 1847
906794891_906794900 27 Left 906794891 1:48689009-48689031 CCCATTCAGAAAGAAGATCCATT 0: 1
1: 0
2: 2
3: 24
4: 332
Right 906794900 1:48689059-48689081 TACAAAACTTAGCTGGGCTGTGG 0: 2
1: 11
2: 139
3: 894
4: 1847
906794897_906794900 -7 Left 906794897 1:48689043-48689065 CCGTCTCTACTAAAAATACAAAA 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
Right 906794900 1:48689059-48689081 TACAAAACTTAGCTGGGCTGTGG 0: 2
1: 11
2: 139
3: 894
4: 1847

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906794900 Original CRISPR TACAAAACTTAGCTGGGCTG TGG Intronic
Too many off-targets to display for this crispr