ID: 906796356

View in Genome Browser
Species Human (GRCh38)
Location 1:48699161-48699183
Sequence GGGAGCTCTGCATAGGACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906796349_906796356 19 Left 906796349 1:48699119-48699141 CCAGCATGTGGGGCTCAGCTTTC 0: 1
1: 0
2: 1
3: 14
4: 174
Right 906796356 1:48699161-48699183 GGGAGCTCTGCATAGGACCCAGG 0: 1
1: 0
2: 0
3: 13
4: 135
906796348_906796356 20 Left 906796348 1:48699118-48699140 CCCAGCATGTGGGGCTCAGCTTT 0: 1
1: 0
2: 2
3: 17
4: 210
Right 906796356 1:48699161-48699183 GGGAGCTCTGCATAGGACCCAGG 0: 1
1: 0
2: 0
3: 13
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906796356 Original CRISPR GGGAGCTCTGCATAGGACCC AGG Intronic
902621780 1:17654989-17655011 GGGAGCTGTGCAGAGGACCTGGG + Intronic
903121139 1:21217763-21217785 GGTAGCTCTGCAGAGGAGACAGG - Intronic
904287432 1:29461459-29461481 GGGAGCCCAGCACAGGCCCCGGG - Intergenic
906702641 1:47871257-47871279 GGGTGAACTGCAAAGGACCCAGG + Intronic
906796356 1:48699161-48699183 GGGAGCTCTGCATAGGACCCAGG + Intronic
913170259 1:116225524-116225546 GGGAGCTTTGCTGGGGACCCAGG - Intergenic
913674707 1:121129982-121130004 GGGAGCTCTACAGAGGTCCATGG + Intergenic
914026548 1:143917612-143917634 GGGAGCTCTACAGAGGTCCATGG + Intergenic
914664928 1:149825043-149825065 GGGAGCTCTACAGAGGTCCATGG + Intergenic
914670837 1:149868777-149868799 GGGAGCTCTACAGAGGTCCATGG - Intronic
917981420 1:180271955-180271977 GAGAGCTCTGCAGAGGACTGTGG + Exonic
921080100 1:211732302-211732324 AGGAGCTCTGGATGGGCCCCAGG + Intergenic
921993806 1:221395912-221395934 GAGAGCTCTGAAGAGGCCCCGGG + Intergenic
922952965 1:229574511-229574533 AGGAGCTCTGCAGAAGGCCCAGG - Intergenic
1063434293 10:6018135-6018157 GGGAGTTCAGCAAAGGGCCCTGG + Intronic
1064544507 10:16437130-16437152 TGGAGCTCTGCAGCGAACCCTGG - Intronic
1065258974 10:23905229-23905251 GGAAGATCTGCCCAGGACCCTGG + Intronic
1069786330 10:70990498-70990520 GGGCACTGTGAATAGGACCCAGG + Intergenic
1069904724 10:71725493-71725515 CGGAGCTCCGCATGGGGCCCAGG - Intronic
1070318469 10:75336488-75336510 GGGAGCTCTGGAAAGGAGCATGG + Intergenic
1070402709 10:76067558-76067580 TGTAGCTCTGCACAGAACCCCGG - Intronic
1071707240 10:88012371-88012393 AGGAGTTCTGCATAGGAACTTGG + Intergenic
1073121545 10:101125163-101125185 GGCAGCTGAGCCTAGGACCCAGG - Intronic
1075992895 10:126853121-126853143 GTGAGTTCTGGATAGGAGCCTGG - Intergenic
1077121827 11:912425-912447 GGGAGCTCTGCAGAGGGGCCTGG - Intronic
1083144723 11:60749701-60749723 GGCAGCTCAGCCTAGGACTCTGG + Intergenic
1083235593 11:61348875-61348897 GGGAGCTGGTCATGGGACCCAGG + Exonic
1083602944 11:63960274-63960296 GGCAGCACTGCATAATACCCTGG - Intergenic
1087119664 11:94560311-94560333 GGGACTACTGCAAAGGACCCAGG + Intronic
1087144792 11:94800572-94800594 GGGAGCTCTGCCTAGTGGCCTGG + Intronic
1088598526 11:111456831-111456853 GGGAGCACAGCACAGGACGCAGG + Intronic
1091907024 12:4197225-4197247 GAGACCTCTGCACAGGGCCCGGG - Intergenic
1096053158 12:48628764-48628786 GGGGGCTCTGCATAGGCTCAGGG + Intergenic
1097980057 12:65729214-65729236 GGGAGCGGTGCAGAGGACCGGGG - Intergenic
1103149494 12:118624547-118624569 GGCAGCTCTGCAGGAGACCCAGG - Intergenic
1104617953 12:130286002-130286024 GCGATGTCTGCCTAGGACCCAGG + Intergenic
1105285434 13:18999628-18999650 GGGACTACTGCATAGGAGCCAGG + Intergenic
1105413342 13:20189952-20189974 GGAAGCTCTGCAGAGGATGCAGG - Intronic
1105542290 13:21326233-21326255 GGGAGGTCTGCCCAGGATCCCGG + Intergenic
1105969986 13:25419854-25419876 GAGTGCTCTGCAAAGAACCCTGG + Intronic
1108486629 13:50933317-50933339 GTGAGCTCGCCATAGCACCCTGG - Intronic
1108889518 13:55236457-55236479 GGGGGCTATGCTTATGACCCAGG + Intergenic
1111556872 13:89892359-89892381 GGAAGCTCTGCATGGGACTAAGG - Intergenic
1113892200 13:113742379-113742401 GGGAGCCCTGAAGAGGTCCCCGG + Intergenic
1114264000 14:21060490-21060512 GAGAGCTCAGAACAGGACCCTGG - Intronic
1114528371 14:23380098-23380120 GGGAGCTCTGCACACGCCCCAGG - Intergenic
1116949943 14:50870379-50870401 GGAAGCTCTGGATGGGACTCTGG - Intronic
1118283663 14:64451599-64451621 GGGTGCTATGCATTGGAGCCTGG - Intronic
1121839350 14:97119749-97119771 GGGAGCTCTGCATCTCTCCCTGG - Intergenic
1122299937 14:100725745-100725767 GGGAGCTCTGCAGAGGAAGAGGG + Intronic
1123156636 14:106233604-106233626 AGGAGGTCTGCACAGGATCCAGG - Intergenic
1127579546 15:60324909-60324931 GCGAGCTCAGCAAAGGACACTGG + Intergenic
1132652927 16:1029592-1029614 GGGGGCTCAGCACAGCACCCTGG - Intergenic
1133258926 16:4536046-4536068 GAGAGCTCTGCAGAGGACCTTGG - Intronic
1138343677 16:56307138-56307160 GGGCGCTCTGCATAAGAACCAGG - Intronic
1139504584 16:67392608-67392630 GGGATCTCCGCATAGTACCTGGG - Intronic
1142005778 16:87689040-87689062 GGGAGGTCACCACAGGACCCAGG - Intronic
1147428435 17:40357173-40357195 GGCAGCTCTGCCGAGGAGCCAGG - Intronic
1147466681 17:40616200-40616222 GGGAGCGCTACACAGGACCAAGG + Intergenic
1148019938 17:44547120-44547142 GGGGGGTCTGCCTAGAACCCAGG + Intergenic
1150225486 17:63522682-63522704 AGGAGCTCTGCATGGGACCTAGG + Intergenic
1152077815 17:78169588-78169610 GGGAGCTCTCCATAGGGCTCTGG - Intronic
1154165764 18:12013262-12013284 GGGAGCTCTTCACAGGCCTCAGG + Intronic
1157815698 18:50728211-50728233 GGGTGCTCTACCTAGAACCCTGG - Intronic
1158281240 18:55830777-55830799 TGGAGCTCTGCACAGCACCTAGG - Intergenic
1160027386 18:75229554-75229576 GGGAGCTCTGACTATGAGCCAGG - Intronic
1161296324 19:3522379-3522401 GTGGGCTCTGCATGGGCCCCTGG + Intronic
1166041244 19:40204394-40204416 GGCAGCCCTGCATGGGACCAAGG + Intronic
926291538 2:11535081-11535103 GGGAGATCTGCATGTGGCCCTGG + Intronic
927113106 2:19878292-19878314 GGGAGCTCTACATGGGACACTGG + Intergenic
927207178 2:20618085-20618107 GGGAGCCCTGCCCAGGCCCCAGG + Exonic
927209097 2:20627802-20627824 GGCCGCTCAGGATAGGACCCTGG - Intronic
927657098 2:24958408-24958430 GGAAGCTCTGCCTAGCACCCTGG - Intronic
927839475 2:26430222-26430244 GGGAGTGCTGCATAGGATTCAGG + Intronic
929757335 2:44778582-44778604 GTGACCTCTGCACAGGCCCCTGG - Intergenic
930973830 2:57430336-57430358 GGGAGCTATGTTTAGGACCTGGG - Intergenic
937292166 2:120788294-120788316 GTGAGCTCTGTCTAGGACTCTGG + Intronic
937333698 2:121047564-121047586 TGGAGCTCTGCCCAGGACCGGGG + Intergenic
938673527 2:133607325-133607347 GGGAGCTCCCCACTGGACCCAGG + Intergenic
942695498 2:178638510-178638532 GTGAGATGTGCATAGGCCCCGGG - Intronic
943786181 2:191881119-191881141 TTGAGCTCTGGATAGGTCCCTGG + Intergenic
948945347 2:241216480-241216502 GGGAGCTCTGCAACGGCCGCGGG - Intronic
1168805905 20:672216-672238 GGGAGCTCTGCAGAGAGACCTGG + Intronic
1171126223 20:22604003-22604025 AGGAGCTCTGCATAGGGACCAGG + Intergenic
1172134978 20:32680820-32680842 GAGAGCTCTGCAAAGGCCCCAGG + Intergenic
1174253000 20:49233451-49233473 GGGGGCCATGCAGAGGACCCTGG + Intronic
1174611223 20:51800589-51800611 GGGAGGTCAGCGTAGGACCAGGG + Intronic
1175912308 20:62410768-62410790 GGCAGCCCTGCACAGAACCCTGG - Exonic
1176525074 21:7859851-7859873 GGGAGCTTTGCCTAGGAGTCTGG + Intergenic
1178659094 21:34489864-34489886 GGGAGCTTTGCCTAGGAGTCTGG + Intergenic
1178929358 21:36804212-36804234 GGGAGCGTTGCATTGAACCCAGG - Intronic
1179904982 21:44418177-44418199 GGCAGCTCTGCCCAGAACCCTGG + Intronic
1181267037 22:21636416-21636438 AGGGGCTCTGCATAGCAGCCGGG - Exonic
1182341348 22:29623786-29623808 TGGAGCTCTGCCTAGAAGCCTGG - Intronic
1182918454 22:34057448-34057470 GGGAGCTGTGGATAGAACTCGGG - Intergenic
1184099976 22:42336850-42336872 GAGACCTCTCCAGAGGACCCTGG + Intronic
949353558 3:3152372-3152394 GGCAACTCTGCTTAGGACTCTGG + Intronic
952556876 3:34541675-34541697 GAGAACTCTCCATAGGAGCCTGG - Intergenic
954583513 3:51716287-51716309 GGGAGGGCTGAATAGGACCTAGG + Intronic
961675088 3:128559948-128559970 GGGAGCCCTGCACGGGATCCTGG + Intergenic
968966532 4:3771714-3771736 GGGAGCTCTGCCCAGGAAACCGG - Intergenic
969363967 4:6683140-6683162 GGGAGCTCTGCAAAGGCCAAGGG - Intergenic
969652716 4:8477480-8477502 GGGAGCTCTGCTGAGGCCTCTGG + Intronic
970529625 4:16968571-16968593 GGCAGCTCTTTTTAGGACCCTGG - Intergenic
972737886 4:41863646-41863668 GGGTACTCAGCATGGGACCCGGG - Intergenic
974828190 4:67155826-67155848 GGCAGCTCTGAATATGGCCCTGG + Intergenic
977885228 4:102245445-102245467 GGAAGCTCTGCCCACGACCCTGG + Intergenic
978081124 4:104592946-104592968 GGGAACTCTAAAAAGGACCCAGG + Intergenic
981637741 4:146899653-146899675 GGGAGCTCTGCGTGGGGCTCTGG + Intronic
983506104 4:168555507-168555529 GGCTGCTCTGGATAGAACCCAGG - Intronic
986025564 5:3847294-3847316 GGGAGCTTTACATATGAACCTGG + Intergenic
993528643 5:88998738-88998760 GTGAGCTCGGAAGAGGACCCTGG + Intergenic
993849657 5:92990923-92990945 GGGAGGTCAGGATAGGTCCCTGG + Intergenic
994359961 5:98839577-98839599 GGGAGCACTGCAGACGCCCCCGG + Intergenic
1007599352 6:43072177-43072199 GGGAGCTCTGTATAGGCGCCAGG + Exonic
1008586381 6:52954223-52954245 GGGACCTCTGAAAAGGCCCCAGG + Intergenic
1017890117 6:158631004-158631026 GGGAGCTGAACATAGGCCCCAGG - Intronic
1018042079 6:159933750-159933772 GGGAGCAATGCACAGGGCCCAGG + Intergenic
1019174868 6:170154676-170154698 GGGACCCCTCCATAGAACCCAGG + Intergenic
1019174938 6:170154877-170154899 GGGACCCCTCCATAGAACCCAGG + Intergenic
1019681927 7:2355198-2355220 GGGGGCTCAGCATGCGACCCGGG - Exonic
1026103363 7:67400954-67400976 GGGAGCGGTGCACAGGGCCCAGG - Intergenic
1029117353 7:98244187-98244209 GGGAGCACAGCACTGGACCCAGG - Intronic
1034972781 7:155429540-155429562 GGCTGCTCTGCAGAGGTCCCTGG - Intergenic
1035078596 7:156198072-156198094 GGGAGCTCTGCACAAGCCGCAGG + Intergenic
1035644826 8:1210773-1210795 GGGAGCTGTGGAAGGGACCCAGG - Intergenic
1036129905 8:6099702-6099724 GGGAGCTCTTTATAACACCCTGG + Intergenic
1036702508 8:11022431-11022453 GGGCCCTCTGCCTTGGACCCAGG - Intronic
1037883631 8:22585233-22585255 AGGAGCTCTGCTTGGGAGCCCGG + Intronic
1038538816 8:28374160-28374182 GAGACCTTTGCATAGGAGCCGGG + Intronic
1045264738 8:100609426-100609448 GGCAACTCTGGATAGGCCCCTGG - Intronic
1045461274 8:102427728-102427750 CAGAGCTCTACATTGGACCCAGG + Intergenic
1046958614 8:120086600-120086622 TGGAGTTCTGGATAGGATCCTGG - Intronic
1047615143 8:126557443-126557465 GGGACCTGTGCAAATGACCCTGG - Exonic
1049292206 8:141810164-141810186 GGGAGCTCTGCTTCGGAACAAGG + Intergenic
1051297062 9:15608017-15608039 GGGAACTCTGCAGAGGTCCAAGG + Intronic
1053173106 9:35904918-35904940 GGGAGTTCTGCAGAGGAGACAGG + Intergenic
1055359946 9:75478775-75478797 GGCAGCTGTGCCTAAGACCCTGG - Intergenic
1057949534 9:99358948-99358970 GGGGGCTCGGCATTGGTCCCTGG - Intergenic
1058022127 9:100099851-100099873 GCGATCTCTGCTTAGTACCCAGG + Intronic
1059135815 9:111805198-111805220 GGGAACTCTGCAAAGTCCCCAGG + Intergenic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1061801119 9:133113922-133113944 GGGAGCCCAGCACAGCACCCAGG + Intronic
1186733648 X:12437919-12437941 GTGAGTTCTGCATAGGATCAAGG + Intronic
1190108236 X:47573888-47573910 GGGACCCCTGCATAGGACCTGGG + Intronic
1192499068 X:71636845-71636867 GGGAGCCATGCATAGTACACGGG + Intergenic
1192836199 X:74802116-74802138 GCGAGCTCCCCACAGGACCCAGG - Intronic
1198933243 X:141881295-141881317 GGGAACCCTGGAGAGGACCCTGG - Intronic
1200145262 X:153923085-153923107 GGGAGCTCTGCCCAGACCCCGGG - Intronic