ID: 906800422

View in Genome Browser
Species Human (GRCh38)
Location 1:48732413-48732435
Sequence CTTTATGAGCATCTTGTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906800422_906800424 -9 Left 906800422 1:48732413-48732435 CCCTGAACAAGATGCTCATAAAG 0: 1
1: 0
2: 0
3: 10
4: 161
Right 906800424 1:48732427-48732449 CTCATAAAGTTTAATTCTAATGG 0: 1
1: 0
2: 2
3: 20
4: 239
906800422_906800426 -2 Left 906800422 1:48732413-48732435 CCCTGAACAAGATGCTCATAAAG 0: 1
1: 0
2: 0
3: 10
4: 161
Right 906800426 1:48732434-48732456 AGTTTAATTCTAATGGAAGTGGG 0: 1
1: 0
2: 1
3: 18
4: 255
906800422_906800425 -3 Left 906800422 1:48732413-48732435 CCCTGAACAAGATGCTCATAAAG 0: 1
1: 0
2: 0
3: 10
4: 161
Right 906800425 1:48732433-48732455 AAGTTTAATTCTAATGGAAGTGG 0: 1
1: 0
2: 3
3: 23
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906800422 Original CRISPR CTTTATGAGCATCTTGTTCA GGG (reversed) Intronic
901941149 1:12662918-12662940 CTTTATGTGCTACCTGTTCAAGG - Intronic
905607468 1:39315487-39315509 CTTTATGTGTGTCTTGTTCCTGG + Intronic
906800422 1:48732413-48732435 CTTTATGAGCATCTTGTTCAGGG - Intronic
907329405 1:53661417-53661439 CTTTTTGAAAATCTTGTTCCAGG - Intronic
910363480 1:86438634-86438656 AATTATGAGCATCTTGTTGGAGG + Intronic
914988171 1:152477305-152477327 CTCTATCAGCATTTTGGTCAAGG + Intergenic
918782791 1:188724051-188724073 TTTTATGAACATTTTATTCATGG - Intergenic
919235495 1:194836922-194836944 CTTTATGAGCATCCTGAGAATGG + Intergenic
921414556 1:214871116-214871138 CTTTATGACCATCATGAACAGGG - Intergenic
1063351622 10:5362088-5362110 CAGCATGAGCATGTTGTTCAGGG - Intergenic
1063675336 10:8136348-8136370 CTTTATCTGCATCTTGATGATGG - Intergenic
1064076117 10:12270076-12270098 GTTCCTGAGCATCTTTTTCATGG + Intergenic
1064930887 10:20625298-20625320 CTTTATGAGCAGCTTGAAAATGG - Intergenic
1065419232 10:25523213-25523235 CTTCAGGAGCCTTTTGTTCAGGG - Intronic
1065909979 10:30294327-30294349 TTATATGATCATCTTGTTAAAGG - Intergenic
1067732113 10:48820067-48820089 CTTTATGAGCAGCTGGATCCTGG + Intronic
1068819493 10:61357423-61357445 CCTTCTTAGCTTCTTGTTCAAGG + Intergenic
1070393519 10:75991520-75991542 CTCAAGGAGCATCTTGTTTAGGG + Intronic
1073328188 10:102654645-102654667 CTTCATGAGCATCTTCTGCAGGG - Exonic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1079892359 11:26072408-26072430 TTGTATGAGCATTTAGTTCAAGG + Intergenic
1080527782 11:33144364-33144386 CTTTATGAATAGCTTGCTCAAGG + Intronic
1080988160 11:37496117-37496139 CTTTATGAGCATTATTATCATGG - Intergenic
1081855115 11:46298167-46298189 CTGTATGAGCATAAGGTTCAGGG - Intronic
1082855283 11:57800582-57800604 TTTTAAGACCATCTTGGTCATGG + Intronic
1083815719 11:65131323-65131345 CTTCATGACCATCATGATCAAGG - Exonic
1086233977 11:84605117-84605139 AATTATAAGCATTTTGTTCAAGG + Intronic
1090257827 11:125298235-125298257 CTTTAAGAGCATCCTATGCAAGG - Intronic
1090304595 11:125680272-125680294 CTTCATAAGCCTCTTCTTCATGG - Intronic
1092302609 12:7266561-7266583 CATTCTCAGCCTCTTGTTCAAGG + Intergenic
1093107678 12:15109122-15109144 TTTGGTGAGCATCTTGTTAATGG + Exonic
1099553504 12:84078431-84078453 GTTTATCAGCAACTTGTTAAGGG + Intergenic
1100981286 12:100164620-100164642 CTTAATCAGCATCATGTGCAAGG - Intergenic
1101031094 12:100661108-100661130 CTTGATGTGCATCTTATTCGTGG + Intergenic
1101983884 12:109430601-109430623 ATTTATGAGCATGTTCTTTAAGG - Intronic
1105450058 13:20491479-20491501 CTTTATAAGCCTCTAATTCAAGG - Intronic
1107301760 13:38973434-38973456 ATCTATGAGCATCTTGATCTTGG - Intronic
1107449206 13:40493216-40493238 CATTATCACCATCTTGTGCAGGG + Intergenic
1109451461 13:62520059-62520081 CTTTCTCAGCATTTTGTTTAGGG - Intergenic
1112815441 13:103267745-103267767 CATTATCAGCATTTTGGTCAAGG - Intergenic
1113242225 13:108350609-108350631 CTTTATGGTAATCTGGTTCACGG + Intergenic
1116419993 14:44721737-44721759 CATTATCAGCATTTTGGTCAAGG - Intergenic
1116893918 14:50296865-50296887 GTTTATTAGTATTTTGTTCAGGG - Intronic
1118667342 14:68085398-68085420 CCTTATGAGCAGCTTTTTCAAGG + Intronic
1119059586 14:71461372-71461394 CACTATGATCATTTTGTTCATGG + Intronic
1120274727 14:82357750-82357772 CTTTAGAAGCATCCCGTTCAAGG - Intergenic
1120794213 14:88614180-88614202 TTTTATGGGCAGGTTGTTCAGGG + Exonic
1121559911 14:94866792-94866814 CTGTCTCAGCATCTTCTTCAAGG + Intergenic
1131859040 15:96632399-96632421 CTTGATGAGCAATTTGATCAGGG + Intergenic
1132521446 16:391771-391793 CTTTTTGAGCACCTTCTACAAGG + Intergenic
1132638647 16:966756-966778 CTTGATGAGCAACTTGGCCAAGG + Intronic
1134669543 16:16044615-16044637 CCTCATGAGCTTCTTCTTCAAGG + Exonic
1138849933 16:60615538-60615560 CTTTAAAACCATCTTGATCAGGG + Intergenic
1140573410 16:76135529-76135551 GTTTATGAGCATCTATTACAGGG - Intergenic
1142424042 16:89991354-89991376 CTCCACGAGCATCTGGTTCAGGG - Intergenic
1144345713 17:14347180-14347202 CTGTATGAGCATCAGGCTCAAGG - Exonic
1144763160 17:17718692-17718714 TTTTATGAGCATGTTGATCCAGG - Intronic
1144936607 17:18904098-18904120 CTTTGTGAGAACCTTGGTCAAGG + Intronic
1146109571 17:30075854-30075876 CTTTAGGATCAAATTGTTCAAGG + Intronic
1148914745 17:50966472-50966494 AGTTTTGGGCATCTTGTTCATGG - Intronic
1150226033 17:63524855-63524877 CTGAATGAGCTTCTTGGTCAGGG - Intronic
1151036478 17:70805960-70805982 CCGTATGGCCATCTTGTTCATGG + Intergenic
1155505166 18:26526109-26526131 CTTTAAGAGCATTTTCTTCTGGG + Intronic
1155621092 18:27780967-27780989 CTTTCTTAGCATATTATTCAAGG - Intergenic
1157811315 18:50698311-50698333 ATTTATGAGCATGGAGTTCATGG - Intronic
1158012043 18:52740117-52740139 CTATATGTGCAACTTATTCATGG - Intronic
1159038863 18:63303904-63303926 CTTTAAGTTCATATTGTTCATGG + Intronic
1160946963 19:1648183-1648205 CTTTATACGCATCTGGTCCAGGG + Intronic
1162170870 19:8787834-8787856 CTGTATGAATATCTTGTTCTGGG + Intergenic
1168539217 19:57196585-57196607 CACTATGACCATTTTGTTCATGG + Intronic
929321761 2:40552141-40552163 TTTTATGTGCATCTACTTCAGGG + Intronic
929921898 2:46178602-46178624 CTATATGAGGATCTAGTTAATGG + Intronic
930508876 2:52319291-52319313 CTTTATCACCATCTTATTAAGGG - Intergenic
936733498 2:115411441-115411463 CTGTATTTGCATCTTGGTCAAGG + Intronic
937318555 2:120947323-120947345 CTTTATGCCCATCTTGTGGATGG - Intronic
937650082 2:124310068-124310090 TTTTATGAGCATTAAGTTCAGGG + Intronic
938966113 2:136389990-136390012 CCTTATTTGCATCTTGTGCAGGG + Intergenic
941307433 2:163888701-163888723 CTGTCTGAGCAGGTTGTTCATGG + Intergenic
941632423 2:167899229-167899251 CTTTGAGATCATCTAGTTCAAGG + Intergenic
944332794 2:198491651-198491673 CTTTATGAACATTTTATACAGGG - Intronic
944416079 2:199481144-199481166 CTGGATGAGCATCTCCTTCAGGG + Intergenic
947529504 2:230899739-230899761 CTGTATGCGCATCTTCTTAATGG - Intergenic
947710506 2:232311377-232311399 AATTATAAGCATCTAGTTCAAGG + Intronic
1170027193 20:11902000-11902022 CTTTATGCTCAAGTTGTTCAAGG - Intronic
1173396777 20:42687648-42687670 CTTCAGGAGCACCTTGTTCCAGG + Intronic
1174806882 20:53611832-53611854 CTTTATGAAAATCTTTTTCGTGG - Intergenic
1175515433 20:59567100-59567122 ATTCATTAGCATCTGGTTCATGG - Intergenic
1176588413 21:8613721-8613743 CTTTCTGAGCCTTTTGTTGAGGG - Intergenic
1177839609 21:26221093-26221115 CTTTATAAGCACATTGTTTATGG + Intergenic
1177884542 21:26732624-26732646 CTTTGTGAGCATGATGTTAACGG + Intergenic
1177904460 21:26958798-26958820 CATTATGAACAGATTGTTCAGGG + Intronic
1178800174 21:35787060-35787082 CTTTATGAGCATCGTGAAAATGG - Intronic
1179242593 21:39605266-39605288 CTTTCTCAGCATTTTGTACAGGG + Intronic
1180271245 22:10590717-10590739 CTTTCTGAGCCTTTTGTTGAGGG - Intergenic
1183125125 22:35770948-35770970 CTTTATAAGCATCTTTTCCCTGG + Intronic
951615670 3:24540833-24540855 CTTTATGAGCCTCTTCTATAAGG + Intergenic
953272322 3:41457706-41457728 CTTTGTGTGCATCTTGTACAGGG + Intronic
953358245 3:42272601-42272623 CTTGAGGACCCTCTTGTTCAAGG + Intergenic
957728448 3:84099994-84100016 CTTTATAATTATCTTGTTGATGG - Intergenic
957866701 3:86034480-86034502 CTCTGTGAGCACCTTGTTCTTGG + Intronic
957884555 3:86269273-86269295 CTTTATCAGCTTCTTCTTTATGG + Intergenic
959222494 3:103539354-103539376 GTTTTTCAGCTTCTTGTTCATGG + Intergenic
959852750 3:111109057-111109079 CTTGATGAGGATCTTCTTCCTGG + Intronic
962211170 3:133479688-133479710 ATTTATTAACATCATGTTCAAGG + Intergenic
963344108 3:144072941-144072963 ATTTATAAGCATATTTTTCATGG + Intergenic
963909408 3:150802733-150802755 CTTCATGAGCCTCTTGAACATGG - Intergenic
964996423 3:162887899-162887921 ATTTATCAGCATCTTGTTTTAGG + Intergenic
966195143 3:177305899-177305921 CTTTATGATGATCTTCTACAAGG - Intergenic
966559568 3:181304908-181304930 CACTATGAGCATCTTTTACAAGG - Intergenic
966976153 3:185085141-185085163 CTTCATGAGCATCTTTTTGCAGG + Intronic
970501885 4:16686181-16686203 CTTTGTGAGGATCTAGTTAAGGG - Intronic
972646985 4:40978034-40978056 CTATATGAGCACCTTGTTGTAGG - Intronic
973965546 4:56158546-56158568 CTTTATGAGTATTTTGTAGACGG + Intergenic
974077036 4:57176579-57176601 TTTTATGACCATATTATTCAGGG + Intergenic
974232525 4:59135564-59135586 CTTTCTGAGCCTCTGCTTCAGGG - Intergenic
976100881 4:81561873-81561895 CTTAATGAGTAGCTAGTTCAAGG - Intronic
976747351 4:88416984-88417006 TTTTATGAACATCTGGTACATGG - Intronic
979481574 4:121224500-121224522 CTTAATGTTCATGTTGTTCATGG + Intronic
980033534 4:127857487-127857509 CTTTATGAGGATTTTTTTCCTGG - Intergenic
980331068 4:131411860-131411882 CTTCAGGAGCCTTTTGTTCAAGG + Intergenic
980588060 4:134845888-134845910 CTTTATCACCCTCTTTTTCAGGG - Intergenic
984840773 4:184065362-184065384 CGGTATGAGCACCTTGTACAGGG + Intergenic
991190801 5:63871010-63871032 CTCTGTGTGCATCTTCTTCATGG - Intergenic
993004567 5:82416559-82416581 CATGCTGAGCATCTTGTTGAAGG + Intergenic
993474431 5:88346650-88346672 ATTTATGATCACCTTGTCCATGG - Intergenic
994288862 5:98003693-98003715 CTTTTTCAGCACCTTGTTCAGGG - Intergenic
994448079 5:99903320-99903342 CTTTATGAACTTCTTGTAGATGG + Intergenic
995861178 5:116642163-116642185 CTATTTGAGCTTCTTGGTCATGG + Intergenic
995867179 5:116703753-116703775 ATTTGTCAGCATCTTGTTCAAGG + Intergenic
996042521 5:118831801-118831823 CTTTATGGTCACTTTGTTCATGG - Intergenic
998800192 5:145861367-145861389 TTTCATCAGGATCTTGTTCATGG + Intronic
998827560 5:146119009-146119031 CTTTATGGGTATAATGTTCAAGG + Intronic
1001075913 5:168627920-168627942 CTTTAAGAGCAGCCTCTTCATGG + Intergenic
1011253520 6:85398159-85398181 TATTTTGAGCATCTTTTTCATGG - Intergenic
1013794067 6:113865355-113865377 CTTTATAAGCATTTTGTTTCAGG + Intergenic
1014249753 6:119103089-119103111 GTTTATGATCATGTGGTTCAGGG + Intronic
1016620477 6:146103697-146103719 CTTTGTGAGCTTCCTGTTCTAGG - Intronic
1016888010 6:148977449-148977471 CTTTAAAATCAGCTTGTTCAGGG + Intronic
1017386679 6:153893192-153893214 CTTTATTACCATATTGTGCAAGG - Intergenic
1021919163 7:25466370-25466392 CTTGATGAGGGTCTTTTTCAGGG - Intergenic
1027484667 7:78746389-78746411 CTTTCTGAGAATCTTATTCCGGG + Intronic
1027631483 7:80611181-80611203 CTTTATTATAATTTTGTTCAAGG - Intronic
1031221142 7:118967003-118967025 CTCTATGTGCTTCTTGTTCCTGG + Intergenic
1032314502 7:130822230-130822252 CTTTTTGTTCATCTTGCTCAGGG + Intergenic
1032709892 7:134452336-134452358 CTGTATGAGGATCTGCTTCAAGG + Intronic
1033354742 7:140590553-140590575 TTATATTAGCATCTTGTTCTTGG - Intronic
1034119514 7:148614498-148614520 CTTTCAGAGCATCTTGGTAAGGG - Intronic
1036651633 8:10647793-10647815 CTGTTTGTACATCTTGTTCATGG - Intronic
1037564352 8:20105001-20105023 CTTTCTGAGCATCTTATTGCAGG + Intergenic
1037951695 8:23022830-23022852 CTTTATCAGCATCGTGTACAAGG + Exonic
1038591128 8:28838962-28838984 CTTTATTAGCAGCATGTTCTGGG + Intronic
1039097916 8:33906844-33906866 CTTTATGTTTATCTTGTTCAAGG + Intergenic
1043060068 8:75488914-75488936 TTTTGTGAGCATTTTGTTCCTGG - Intronic
1043067507 8:75593972-75593994 CTTGATGAGCATCTTTCTGATGG + Intergenic
1043363909 8:79509483-79509505 CTGCATCAGCATTTTGTTCAGGG - Intergenic
1044630225 8:94271390-94271412 CTTCCTGACCATCTTGTACAGGG - Intergenic
1044877127 8:96680794-96680816 CATTATCAGCATTTTGGTCAAGG - Intronic
1055341999 9:75293704-75293726 CATTATCAGCATTTTGGTCAAGG + Intergenic
1058924126 9:109644891-109644913 CGTTATCAGCATTTTGGTCAAGG + Intronic
1203618423 Un_KI270749v1:92284-92306 CTTTCTGAGCCTTTTGTTGAGGG - Intergenic
1185866244 X:3626790-3626812 CTTTTTGGGCATCTTATTGAGGG + Intronic
1185996184 X:4952552-4952574 CTTTATCAGCATATTGTTGATGG - Intergenic
1186877577 X:13831398-13831420 CTCTATAAGCATCTTGTCCATGG - Intronic
1191883562 X:65865833-65865855 CTTTCAGACCATCTTTTTCAAGG + Intergenic
1193107388 X:77692345-77692367 CTTTCTGAGAATCTAGTTCATGG - Intronic
1195053470 X:101120580-101120602 CTTTAAGAGCATCTGCTTAATGG + Intronic
1195412932 X:104588309-104588331 CTTTCTGAGCAGCATGTACAAGG + Intronic
1197531512 X:127633751-127633773 CTTGATGAATATCTTTTTCATGG + Intergenic
1198137308 X:133766788-133766810 CATTATGTCCATCTTCTTCAAGG + Intronic
1198929873 X:141843572-141843594 CTTGAGGAGCATTCTGTTCATGG - Intronic
1199409765 X:147507815-147507837 CTGTATGTGTAGCTTGTTCATGG + Intergenic
1201293509 Y:12444884-12444906 CTTTAAGAGCATCTTGCTTCAGG - Intergenic