ID: 906802580

View in Genome Browser
Species Human (GRCh38)
Location 1:48750586-48750608
Sequence ACTTCTTTAAGGTGGCAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 128}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906802573_906802580 3 Left 906802573 1:48750560-48750582 CCCAACTGTCTGCTGTTGAGACT 0: 1
1: 0
2: 0
3: 13
4: 145
Right 906802580 1:48750586-48750608 ACTTCTTTAAGGTGGCAAGGGGG 0: 1
1: 0
2: 0
3: 10
4: 128
906802574_906802580 2 Left 906802574 1:48750561-48750583 CCAACTGTCTGCTGTTGAGACTG 0: 1
1: 0
2: 1
3: 15
4: 190
Right 906802580 1:48750586-48750608 ACTTCTTTAAGGTGGCAAGGGGG 0: 1
1: 0
2: 0
3: 10
4: 128
906802570_906802580 26 Left 906802570 1:48750537-48750559 CCAAAGTAAAGCTCACCCTGCAT 0: 1
1: 0
2: 0
3: 6
4: 135
Right 906802580 1:48750586-48750608 ACTTCTTTAAGGTGGCAAGGGGG 0: 1
1: 0
2: 0
3: 10
4: 128
906802571_906802580 11 Left 906802571 1:48750552-48750574 CCCTGCATCCCAACTGTCTGCTG 0: 1
1: 0
2: 1
3: 13
4: 238
Right 906802580 1:48750586-48750608 ACTTCTTTAAGGTGGCAAGGGGG 0: 1
1: 0
2: 0
3: 10
4: 128
906802572_906802580 10 Left 906802572 1:48750553-48750575 CCTGCATCCCAACTGTCTGCTGT 0: 2
1: 0
2: 0
3: 18
4: 213
Right 906802580 1:48750586-48750608 ACTTCTTTAAGGTGGCAAGGGGG 0: 1
1: 0
2: 0
3: 10
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906802580 Original CRISPR ACTTCTTTAAGGTGGCAAGG GGG Intronic
901370230 1:8790894-8790916 ACTTCTTTAGGGAGACAGGGTGG + Intronic
902076527 1:13791042-13791064 ACAACTCTAAGGTGGCAAGTTGG + Intronic
903414115 1:23169594-23169616 TCTTCTTTAAAATGGGAAGGGGG + Intronic
906418807 1:45645544-45645566 ACTTTTTTAAAGTGGGAAGATGG - Intronic
906802580 1:48750586-48750608 ACTTCTTTAAGGTGGCAAGGGGG + Intronic
907413518 1:54298606-54298628 ACTTCATTCAGATGGAAAGGAGG + Intronic
908313517 1:62909581-62909603 ACTTCTATTAGCTGGCAAGGAGG + Intergenic
909487900 1:76194048-76194070 ACTTCATTAGGGTGGTTAGGTGG - Intronic
912747799 1:112260121-112260143 ACTTGTCTAAGGTCACAAGGTGG + Intergenic
913007427 1:114648559-114648581 ACTTCTTTAAGGAAACTAGGTGG + Intronic
913077034 1:115349063-115349085 ACTTGATTAAAGTGACAAGGAGG + Intergenic
913508744 1:119543409-119543431 TCTTCTTTGAGGTGGACAGGAGG - Intergenic
913511860 1:119569380-119569402 ACTTCTTTGAGGTGGGCAGGAGG - Intergenic
913516087 1:119606692-119606714 ACTTCTTTGAGGTGGGCAGGAGG - Intergenic
917193695 1:172444678-172444700 ACTTCTTTTAGGAGGTAAAGAGG - Intronic
917518837 1:175731624-175731646 ATTTCATTAAGGAGGCACGGCGG + Intronic
921907284 1:220508609-220508631 AATTCTTTAGGGTGAAAAGGAGG + Intergenic
1065252859 10:23834628-23834650 TCTTCATTAAAATGGCAAGGGGG + Intronic
1066135138 10:32438332-32438354 ACTTCTTTCATGTGGCTATGTGG + Intergenic
1068765796 10:60762315-60762337 AATTCTTTAAGGTGGTGGGGGGG - Intergenic
1073924832 10:108503508-108503530 ACTACTTTTAGGTGGCATGAAGG - Intergenic
1079084629 11:17436439-17436461 AGTTCTATAAGGTTCCAAGGTGG + Intronic
1079197240 11:18340147-18340169 ATTTCATAGAGGTGGCAAGGAGG - Intronic
1079404943 11:20136611-20136633 GTTGCTTTATGGTGGCAAGGTGG - Intergenic
1079695395 11:23475978-23476000 ACTCCTGAAAGGTGGCAAAGTGG + Intergenic
1084437070 11:69149223-69149245 AGTTCTTGAAGGTGGCACGTGGG + Intergenic
1089419384 11:118319727-118319749 GCTTCTTTGATTTGGCAAGGAGG - Intergenic
1091834936 12:3579063-3579085 TCTTGTTTAGGATGGCAAGGAGG - Intronic
1094343890 12:29444688-29444710 AATGCTTTTAGGTGCCAAGGGGG + Intronic
1095332335 12:40981830-40981852 AATTCTTTAAGATGGAAAAGAGG + Intronic
1095670542 12:44854960-44854982 ACTTTTTTAAGGTGGCTACTAGG - Intronic
1095898320 12:47302796-47302818 CCTGCTTTTAGGTGGAAAGGAGG - Intergenic
1095939549 12:47717136-47717158 GCTTCTTGAAGGTGCCCAGGAGG - Intronic
1096815996 12:54202104-54202126 ACTTCTTTAAGGTAAAATGGTGG - Intergenic
1096824229 12:54262354-54262376 AGTTCTTAAGGGTGGAAAGGAGG - Intronic
1097614742 12:61870699-61870721 ACATATTTCAGGTGGCATGGTGG - Intronic
1099876236 12:88409443-88409465 ACTTCTGAAAGGTGGCAGAGCGG + Intergenic
1100162881 12:91881495-91881517 ACTTATTTAAGGTGAACAGGTGG - Intergenic
1100330860 12:93580712-93580734 AGTTCATCAAGATGGCAAGGGGG - Intronic
1100827833 12:98491342-98491364 AGTTCCTTAAGGTGGGGAGGAGG - Intronic
1100962548 12:99979197-99979219 ATTTCTTTAAGGATGAAAGGGGG + Intronic
1109660115 13:65446221-65446243 AGTTCTTTAAGATGGCAAAAAGG + Intergenic
1125641714 15:41236560-41236582 ACTTTTTTGCGGGGGCAAGGAGG + Intronic
1127650277 15:60999982-61000004 ACTACTTCAAGATTGCAAGGGGG + Intronic
1130208498 15:81900957-81900979 ACTACTTTTAGGTAGAAAGGGGG - Intergenic
1130402287 15:83568485-83568507 AATTCTTTAAAGTTACAAGGTGG - Intronic
1131172742 15:90190242-90190264 ACTGCTTTAGGGTGGCAAGTGGG + Intronic
1131451299 15:92542356-92542378 ACTTGTATAAGGAGGCATGGTGG - Intergenic
1134870046 16:17644453-17644475 ACATCTTTAAGATGGGATGGTGG - Intergenic
1135988851 16:27204675-27204697 TATTCTTTAAGGTGGCTGGGTGG - Intronic
1136529669 16:30859626-30859648 CCTTCTTAAAGGTGGGGAGGGGG - Intronic
1138740268 16:59300383-59300405 TCTTATTCAAGTTGGCAAGGAGG - Intergenic
1139318921 16:66097186-66097208 AATTTTTTAAGGGGACAAGGGGG + Intergenic
1139367622 16:66443298-66443320 ACTTCTTCAAGGAAGCAAGGAGG - Intronic
1139564720 16:67766911-67766933 TTGTCTTTAAGGTGGAAAGGAGG - Intronic
1139842252 16:69891034-69891056 TCTTCTCTAAGATGGCTAGGAGG + Intronic
1140476214 16:75240362-75240384 CCTTCATTACGGTGGCACGGCGG - Intronic
1140881191 16:79199620-79199642 ACATGTTCTAGGTGGCAAGGTGG - Intronic
1141703906 16:85654469-85654491 ACTTCGGTGAGGTGGCCAGGTGG + Intronic
1143999986 17:11044752-11044774 ACTTCTTGAAGGTGGAAGGTGGG - Intergenic
1144822652 17:18086353-18086375 ACTGCGTTAAGGTGGTATGGGGG + Intergenic
1149049920 17:52292147-52292169 ACTTTTTTAAAGTCTCAAGGGGG - Intergenic
1150283806 17:63944505-63944527 ACTTGTTCAAGGTGGCCTGGTGG + Intronic
1156891939 18:42200533-42200555 ACTTCTTCATGGTCTCAAGGTGG - Intergenic
1157092543 18:44653114-44653136 AGGTCTTGAAGGTAGCAAGGTGG - Intergenic
1157186715 18:45547268-45547290 ACTTGTTAAAGGTGGGAATGAGG - Intronic
1163844349 19:19629940-19629962 CCTTATTTAAGGTGCCAGGGTGG + Exonic
1163862451 19:19749367-19749389 TCTTGTGTGAGGTGGCAAGGGGG + Intergenic
1165015487 19:32877312-32877334 CCTTGTTTCAGGTGGGAAGGAGG - Intergenic
1165590509 19:36965489-36965511 CCTTCTATAAGGTGGCTAGCTGG - Intronic
1165995650 19:39841722-39841744 ACTTCTTTAAGCTTGGAAGCAGG - Intronic
926630858 2:15135210-15135232 GCTTCTTCAAGGTGGCCTGGGGG + Intergenic
936172012 2:110185094-110185116 TCTTCTTAAAGGTGTCATGGAGG - Intronic
937948040 2:127359384-127359406 ACTTTTTGAAGGTGAAAAGGAGG - Intronic
943388432 2:187231190-187231212 ACTTCTTTAAGAGGGAAAGTGGG - Intergenic
944079061 2:195765204-195765226 ACTTTTTTAATATGGCAAGATGG - Intronic
946845073 2:223851655-223851677 ACTTTTTTAGGGGGGCAGGGGGG + Intergenic
1168734473 20:118485-118507 ACTTCTGTAATGTCTCAAGGGGG + Intergenic
1171328894 20:24319946-24319968 TATTATTTAAGGTGGCAAGCTGG + Intergenic
1171959363 20:31482781-31482803 AATTCTGGCAGGTGGCAAGGAGG - Intronic
1178126745 21:29524304-29524326 ACCACTTTAAGATGGGAAGGGGG - Intronic
1179374266 21:40835637-40835659 ACTTGTTTAAGATGCCTAGGAGG + Intronic
1179816812 21:43911594-43911616 AGTTCATAAAGGTGGCAAGGAGG + Intronic
1181173341 22:21022555-21022577 GGTTGTTTAAGGTGGGAAGGGGG + Intronic
949638202 3:6007434-6007456 ACCTCATTAAGGTAGCAAGCAGG - Intergenic
949895811 3:8767050-8767072 TCTTCTGTAAGGTGGCAATAAGG - Intronic
951693199 3:25418628-25418650 ACTTGTTAAAGGTGGTAAGGGGG + Intronic
953474261 3:43192767-43192789 ACTTGTTTAAGGTAGCATTGGGG + Intergenic
956834894 3:73088803-73088825 TCTTCTTTCAGGTGGCATGGAGG + Intergenic
957584745 3:82119247-82119269 ACTTTATAAAGATGGCAAGGAGG + Intergenic
961221628 3:125205517-125205539 AGGTCTTTAAAGTGGAAAGGGGG + Intronic
962584633 3:136829713-136829735 ACATATTTAAAGTGCCAAGGGGG - Intronic
964535371 3:157715728-157715750 ACTTCTGGAATGTGGCAAGGAGG + Intergenic
967478135 3:189944290-189944312 ACTTCCTTAAGGTGGAAACCAGG + Intergenic
968849836 4:3071695-3071717 GGTTCTTTAAGGAGGTAAGGAGG + Intergenic
974212926 4:58805737-58805759 ACGTCTTTGAGATGGCAAGATGG - Intergenic
974466020 4:62257600-62257622 ATTTGTTTAAGCTGGAAAGGTGG - Intergenic
974471026 4:62317544-62317566 ACTAGTTTAAGGTGGTAGGGAGG + Intergenic
975905945 4:79212152-79212174 ACCTGTTTAAAATGGCAAGGAGG - Intergenic
977519692 4:98065676-98065698 TTTTCCTTATGGTGGCAAGGTGG - Intronic
981013963 4:139954123-139954145 ACTTATCCAAGGTGGCAGGGAGG - Intronic
981917484 4:150050843-150050865 ATTTCATTAAGGTGGCAATTTGG - Intergenic
983296670 4:165875056-165875078 ACTTCGTAAAGGTTGCATGGTGG + Intronic
984305635 4:177985885-177985907 ACTTCTATGATGTGACAAGGTGG - Intronic
986503403 5:8425611-8425633 ACTTCTGAAAGGTGGCAAGAAGG + Intergenic
988672788 5:33399972-33399994 ACTTCTGTATGGAGGCAGGGAGG - Intergenic
988951811 5:36270131-36270153 AATTCTGTAAAGTGGCAGGGTGG - Intronic
993680095 5:90866571-90866593 ACTTCTTTAACTGGGCAAGAGGG + Intronic
994615157 5:102095036-102095058 ACCTCCTTAAGGGGGCAAGAAGG + Intergenic
995932823 5:117470095-117470117 ACTTTTTTAAGGTGTCAAATTGG - Intergenic
1000131031 5:158299814-158299836 ACTTCTTTACAGTGGAAAGCAGG + Intergenic
1000133792 5:158324732-158324754 AATTCTCTAAGTTGGCAAGCAGG + Intergenic
1002204450 5:177553530-177553552 CCTTCTTCCAGGTGGCAAGCTGG + Intronic
1003442730 6:6158763-6158785 ACTTCATTAAGGTGGAAAATGGG - Intronic
1005045215 6:21635438-21635460 CTATCTTTAAGGTGGCCAGGAGG + Intergenic
1009229297 6:61043324-61043346 ACATCTTGAAGGAGACAAGGTGG - Intergenic
1021058127 7:16076240-16076262 ACTTCTGTAGCATGGCAAGGAGG - Intergenic
1021059178 7:16088789-16088811 ATTTCTTTATGCTGGGAAGGTGG + Intergenic
1021695614 7:23273098-23273120 ACTCCTGTAAGGGGGCACGGAGG + Intronic
1022462651 7:30625804-30625826 ACTTCTGTAAGATGGCATGCTGG + Intronic
1022972726 7:35532173-35532195 ACTTATGGAAGGTGGGAAGGTGG + Intergenic
1029794584 7:102880801-102880823 ACCTCTTTAAGGGGGCAGAGTGG - Intronic
1030579663 7:111338022-111338044 ACTTGTGAAAGGTGGCAAGTAGG + Intronic
1031630490 7:124037710-124037732 AGTACTTTGAGATGGCAAGGTGG - Intergenic
1032337467 7:131039024-131039046 ACTTCTGGAAGGTAGAAAGGAGG + Intergenic
1033133201 7:138762888-138762910 ACTTCTTTGAGGTGGTCACGTGG - Exonic
1042802392 8:72733829-72733851 AATTCTTGGAGGTGGGAAGGGGG + Intronic
1047503707 8:125462190-125462212 ACATTTTTGAGGGGGCAAGGGGG + Intergenic
1051421058 9:16889697-16889719 ATTTATTTAAGTTGGCAATGGGG + Intergenic
1051804447 9:20976434-20976456 ACTACTTTAAGAAGGGAAGGAGG - Exonic
1053391888 9:37741755-37741777 ACTTGTAGAAAGTGGCAAGGAGG - Intronic
1056681517 9:88723100-88723122 ACTTTTATAAGGTGGCGGGGTGG - Intergenic
1058527105 9:105870235-105870257 ACATCTTTAAGTTTGCAAGCTGG + Intergenic
1058742054 9:107953534-107953556 ACTTCTCTGAGGTTGCAAGTGGG + Intergenic
1192344702 X:70291447-70291469 ACTTCTTTTAGGTGGAGAAGGGG + Intronic
1192862949 X:75097907-75097929 ACTTGCTTAAGGTTACAAGGTGG + Intronic
1194691676 X:96993744-96993766 ACTTCTATAAAGAGGCATGGAGG + Intronic
1195145593 X:102012903-102012925 AGTTCTTTAAGGTGTAAAGTTGG - Intergenic
1198043440 X:132876645-132876667 ACTCCTTTATGGTGGGAGGGGGG + Intronic