ID: 906804783

View in Genome Browser
Species Human (GRCh38)
Location 1:48770171-48770193
Sequence CAGTTTTGCACCACAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906804783 Original CRISPR CAGTTTTGCACCACAGAGGA AGG (reversed) Intronic
900706504 1:4083694-4083716 CTGTTTTGCAGCATAGAAGACGG + Intergenic
901865692 1:12105296-12105318 CAGGTTTGCACAACAGGGCATGG - Intronic
903974543 1:27140687-27140709 CAATTTTGCAGAACAGATGATGG - Intronic
904290190 1:29480045-29480067 AAGTCATGCACCACTGAGGATGG + Intergenic
904622300 1:31782758-31782780 CTGTTTTGCCCCATAGAAGAGGG - Intergenic
906804783 1:48770171-48770193 CAGTTTTGCACCACAGAGGAAGG - Intronic
908332995 1:63089445-63089467 CAGTTTTCCCCCAGAGGGGAAGG + Intergenic
908365587 1:63420260-63420282 CAGGTTTGGGCCTCAGAGGATGG - Intronic
909245194 1:73272011-73272033 CACTATTGTACCACAGAAGAAGG + Intergenic
909797424 1:79758828-79758850 CAGTTTTCCATCACAGTTGATGG - Intergenic
913474177 1:119220947-119220969 CAGTTTTGCCACACTGATGATGG - Intergenic
915610060 1:156984662-156984684 CATTTTAGCACCTCAGAGAAGGG - Intronic
917033797 1:170723943-170723965 CAGTCATGCACCACATATGATGG - Intronic
917240503 1:172942998-172943020 CAGTGTTGCAGCAGAGATGATGG + Intergenic
918678185 1:187316774-187316796 CAGTTTTTCACCATTGAGTATGG - Intergenic
921081824 1:211745922-211745944 CAGCTCTGGTCCACAGAGGATGG - Exonic
924099371 1:240587968-240587990 CAGTTTTCCATCAAAGAGCAAGG - Intronic
1062798347 10:360987-361009 CAGCTTCGAACCACAGAGAAGGG - Intronic
1063713396 10:8503335-8503357 CATTTTTTCCCCACAGAGGGAGG + Intergenic
1063796407 10:9517968-9517990 CAGCTCAGCACCACAGAGCAAGG + Intergenic
1064137501 10:12763659-12763681 CAATTTTGCCCCCCAGCGGATGG - Intronic
1064138266 10:12768914-12768936 CAGTTCTGCAACATACAGGAGGG - Intronic
1065766893 10:29038659-29038681 CAATTTTGGACCACAGAGCAAGG - Intergenic
1067182132 10:43996309-43996331 CAGCTGTGCATCACAGAAGAGGG + Intergenic
1070065353 10:73028062-73028084 CAGGTGTGCATCACAGGGGAGGG + Intronic
1070666397 10:78348095-78348117 TCGTTCAGCACCACAGAGGAAGG + Intergenic
1071378464 10:85034039-85034061 CAGTTTTTGACCACTCAGGATGG - Intergenic
1071384314 10:85104244-85104266 CTCTTTTGGCCCACAGAGGATGG - Intergenic
1071669959 10:87599125-87599147 CTGTGTTGCTCCACAGAAGAGGG - Intergenic
1072736786 10:97884505-97884527 CAGCATTGCTCCAGAGAGGAGGG - Intronic
1073580734 10:104663406-104663428 CAGTTTTGCACTGCAGGGTAGGG - Intronic
1076486328 10:130821022-130821044 CTGTTTTGCGCCACTGAGGCTGG - Intergenic
1078085952 11:8233112-8233134 CAGTTCAGCACCCCAGAAGAGGG - Intronic
1080371194 11:31646109-31646131 CAGTTCTGTGCCACAGGGGATGG - Intronic
1086094224 11:83034388-83034410 CAGCTTTGCCCCAAAGAGCAGGG + Intronic
1086211453 11:84325110-84325132 CAGTTTTTCACCATTGAGTATGG + Intronic
1087147212 11:94824092-94824114 CAGTATTCCTGCACAGAGGATGG + Intronic
1087395514 11:97591829-97591851 CAGTTTTGTTTCACTGAGGATGG - Intergenic
1087489756 11:98810044-98810066 TAGTTTTCCACCAAAGAGCAAGG - Intergenic
1088437795 11:109834496-109834518 GAGTTTTGGATCACAGAGGCCGG - Intergenic
1088640771 11:111871137-111871159 CAGTTTTACAGCGCAGTGGAGGG + Intronic
1089184876 11:116608010-116608032 CAGTTATGCATGCCAGAGGATGG - Intergenic
1089643949 11:119865694-119865716 CAATTTTGTTCCACAGAGGCTGG + Intergenic
1090555002 11:127864635-127864657 CATTTGTGCACCACAGAGATGGG + Intergenic
1090892196 11:130933699-130933721 CAGCTTTGCACCACCGCTGAGGG + Intergenic
1091608848 12:1985511-1985533 CAGTTTTACCTCACAGAGCATGG + Intronic
1091699778 12:2651871-2651893 GAGTTCTGCCACACAGAGGAAGG - Intronic
1092609485 12:10156175-10156197 CAGTGTTGCACCACTAAGTATGG - Intergenic
1092701050 12:11231331-11231353 CAGATTTGAAGCACACAGGAGGG + Intergenic
1092935164 12:13355107-13355129 CAGGTGTGCACCACAGTGCATGG - Intergenic
1093317380 12:17667628-17667650 GATATTTGCAACACAGAGGATGG + Intergenic
1098911017 12:76208706-76208728 CTGTATGGCACCACAGATGATGG - Intergenic
1099670476 12:85685483-85685505 CAGTTTTGAACCACTGAGATTGG - Intergenic
1101880328 12:108621964-108621986 CAGTTTTGGCCCACAGAGTTTGG - Intergenic
1102332504 12:112046303-112046325 CAGTGTTTCCCCTCAGAGGAGGG + Intronic
1104798665 12:131537844-131537866 CTGCTTTGCTCCACAGAGGGAGG - Intergenic
1104981647 12:132575670-132575692 CATGGTTGCTCCACAGAGGAGGG + Intronic
1107709862 13:43141143-43141165 CAAGTTTGCAACACAAAGGAAGG + Intergenic
1109182222 13:59227387-59227409 CATTTTTGCAGCACAAATGATGG + Intergenic
1109372179 13:61437197-61437219 TAGTTTTGCAACTCAGAGCAAGG + Intergenic
1110297098 13:73880144-73880166 CAGGTGTGGACCAGAGAGGAGGG - Intronic
1111181390 13:84671229-84671251 GAGTTTTCAACAACAGAGGATGG - Intergenic
1112342338 13:98563078-98563100 CAGTAATGCATCCCAGAGGAAGG + Intronic
1113962765 13:114134001-114134023 AAGTTTTGCAACATAGAGGAGGG - Intergenic
1115109326 14:29802441-29802463 GATTTTTGCACCACAGTAGATGG + Intronic
1115309246 14:31962959-31962981 CAGTTTTTGTCCTCAGAGGAGGG - Intergenic
1116684825 14:48025222-48025244 TACTTTTGCCTCACAGAGGAAGG + Intergenic
1117721612 14:58634224-58634246 TGGTTGTGCACCAGAGAGGATGG + Intronic
1118016639 14:61667593-61667615 CAGTCATGCATGACAGAGGAAGG + Intergenic
1121567368 14:94920159-94920181 CAGTTTTACAACACAGTGGCAGG + Intergenic
1122039021 14:98969048-98969070 CATTTCTGCACCCCAGAGCAAGG + Intergenic
1122922624 14:104886259-104886281 CCTTTGTGCTCCACAGAGGATGG + Exonic
1123708631 15:22969140-22969162 CACATTTGCATCACAGGGGAGGG - Intronic
1124618938 15:31263183-31263205 CAGTTCTGCACTCCTGAGGAGGG - Intergenic
1126025385 15:44441378-44441400 CAGCACTGCACCACAGAGGAGGG + Intronic
1127632307 15:60838471-60838493 CAGCCCTGCACCACAGAGGCTGG - Intronic
1127832576 15:62763824-62763846 CAGATTGGCTCCACAGAGAATGG - Intronic
1129012612 15:72436178-72436200 CAGTTTTTCACCACTGAGTATGG + Intergenic
1129711531 15:77822713-77822735 CTGCTTTCCACCACAGAGGCTGG + Intergenic
1132359143 15:101198035-101198057 CAGTCTGTCACCACAGGGGAAGG - Intronic
1133430714 16:5734655-5734677 GTGTTTGGCACCAAAGAGGAAGG - Intergenic
1135012819 16:18898034-18898056 CACTTTTACACCATAGAGGGAGG - Intronic
1135319740 16:21485628-21485650 CACTTTTACACCATAGAGGGAGG - Intergenic
1135372576 16:21917115-21917137 CACTTTTACACCATAGAGGGAGG - Intergenic
1135439209 16:22453587-22453609 CACTTTTACACCATAGAGGGAGG + Intergenic
1138737604 16:59268987-59269009 CAGTTTAACACCAATGAGGAAGG - Intergenic
1140233959 16:73141884-73141906 CAGATTTGCAACAAAGAGCAGGG + Intronic
1140706568 16:77636085-77636107 CAGATTTGTGCCACAGAAGATGG + Intergenic
1141153275 16:81579383-81579405 CTGTTTTGGGGCACAGAGGAAGG - Intronic
1144529856 17:16026685-16026707 CAGTTTTGATGCACAGAGGTAGG + Exonic
1145763907 17:27444848-27444870 CAGGTTTGCAACACTGAGGCTGG + Intergenic
1146669530 17:34727188-34727210 CAGGTTTCTACCCCAGAGGAGGG + Intergenic
1148867820 17:50638214-50638236 CTGTTCTGAACCACAGAGGTTGG + Intronic
1149140853 17:53431334-53431356 CTTGTTTTCACCACAGAGGATGG + Intergenic
1149644948 17:58233821-58233843 CAGGTTTCCACCAGAGTGGAAGG + Intronic
1151350344 17:73528137-73528159 CAGTCCTGGACCCCAGAGGAGGG + Intronic
1151505292 17:74523265-74523287 ATGTCTTGCACCACAGAGGGTGG + Intronic
1152683103 17:81679916-81679938 CAGGTTTGTGCCACGGAGGAGGG + Intergenic
1156313505 18:35946728-35946750 GAGTTTTTTACTACAGAGGAAGG - Intergenic
1159355537 18:67334460-67334482 CAGTATTTCACCATAAAGGATGG - Intergenic
1161292568 19:3502998-3503020 CAGTTTTCCAACACATAGGAAGG - Intergenic
1164734192 19:30528732-30528754 CAGTTTTGGCCAACAGATGAAGG - Intronic
1165099034 19:33427433-33427455 CACTTTGGCTCCACAGAGGATGG + Intronic
1166868303 19:45854425-45854447 CAGTTTTTCACTCAAGAGGAGGG - Exonic
1166913332 19:46176825-46176847 CAGCCTTGGACCAGAGAGGATGG - Intergenic
1167481648 19:49735749-49735771 CAGTGTTGGACCAGGGAGGATGG + Intergenic
1167971313 19:53189176-53189198 CAGTTTTGCACCACAGTCTCAGG - Intronic
927890088 2:26742692-26742714 CATTTTTGCAGCCCAGAGCAGGG - Intergenic
929709743 2:44254700-44254722 CAGGTGTGCACCACAAAGGCTGG - Intergenic
931484877 2:62680579-62680601 CAGTTTTGCATAAAACAGGAGGG + Intronic
932638988 2:73422957-73422979 AAGTTTTGCACCTCTGAGGTAGG + Exonic
933240691 2:79917433-79917455 TAGTTTTTCACCTCAGAGAAAGG - Intronic
936333626 2:111570328-111570350 CAGATTTACACAACAGCGGACGG + Intergenic
937551189 2:123094617-123094639 AATTTTTCCCCCACAGAGGATGG + Intergenic
938888832 2:135681919-135681941 CAGTTTTGCATCAAAGGGGCTGG - Intronic
939203554 2:139070693-139070715 CAGGTTTTCAGCACAGAGGCGGG - Intergenic
943480273 2:188408824-188408846 CAGTTTTACACCACTGTGAATGG - Intronic
943517666 2:188907737-188907759 CACTTTTGCATACCAGAGGATGG - Intergenic
944243918 2:197512639-197512661 CAGGTGTGAACCACAGAGGCTGG + Intronic
1169016689 20:2298334-2298356 CAGTTTGTGAGCACAGAGGAGGG + Intronic
1171879880 20:30610841-30610863 CCTTTGTGCACCACTGAGGAAGG - Intergenic
1173867312 20:46320863-46320885 CACTCTGGGACCACAGAGGAAGG + Intergenic
1174410820 20:50333991-50334013 CAATTTTGGAGCACACAGGAGGG - Intergenic
1175893633 20:62326568-62326590 CTGTTTTCCACCACGGAGAATGG + Intronic
1178804464 21:35826836-35826858 GAGTTTGGCATCACAGAGCATGG - Intronic
1179499322 21:41797148-41797170 CAGTTTTCCACCACACTGCATGG + Intergenic
1179649034 21:42794701-42794723 CAGGTTTGCAGCTCAGAGGGAGG - Intergenic
1179936150 21:44604687-44604709 CAGCTTTTCACCACTGAGTATGG + Intronic
1180205959 21:46260709-46260731 GTGTCTTGCACCACTGAGGATGG - Intronic
1182767905 22:32772028-32772050 CAGTTTTAGCCCAGAGAGGATGG + Intronic
1182853161 22:33493799-33493821 CAGATGTGGACCACAGAGGCTGG - Intronic
1184206555 22:43007667-43007689 AAGTACTGCACGACAGAGGAGGG - Intronic
1184851227 22:47122380-47122402 CAGTGTCCCATCACAGAGGAGGG + Intronic
1185296279 22:50056917-50056939 CAGTATGGAACCAGAGAGGAAGG - Exonic
951072854 3:18352399-18352421 CAGATTTGCATCTCAAAGGAGGG + Intronic
954217405 3:49132294-49132316 CAGCTTTGCACCACAGCGGCGGG - Exonic
955189044 3:56743293-56743315 CAGTTCTGCACCAGTGAGGCTGG + Intronic
955822634 3:62912343-62912365 CAGTCTTGCAATTCAGAGGAGGG + Intergenic
957907191 3:86572580-86572602 CAGTTTTTCACCACTTAGTATGG + Intergenic
958698153 3:97553449-97553471 CAGTTCTGCATCACTGGGGAGGG + Intronic
961462775 3:127063157-127063179 CAGGTCTGCACCAGGGAGGAGGG + Intergenic
962108204 3:132415731-132415753 CAATTTTGCACTACAGAGGATGG + Intergenic
965208708 3:165756111-165756133 GAGTTCTGTACCACAGAGCATGG + Intergenic
965360797 3:167735490-167735512 CAGGTGTGAGCCACAGAGGAGGG + Intronic
965537162 3:169835460-169835482 CTGTGATGCTCCACAGAGGAAGG - Intronic
967137702 3:186526491-186526513 CAGTTTTGTGCCACAGATGGGGG - Intergenic
969213771 4:5707757-5707779 GAGTTTAGGACCACAGAGGGAGG + Intronic
973677451 4:53279735-53279757 CAGTTCTGCATGACTGAGGAGGG + Intronic
974125373 4:57689886-57689908 CAGTGTTGCTTCACAGAGGTAGG + Intergenic
975841064 4:78474742-78474764 TTGTTTTTCACCACTGAGGATGG - Intronic
986503452 5:8425898-8425920 CAGTATTTCCCAACAGAGGAGGG - Intergenic
988256430 5:28825442-28825464 CATTTTTGGACCACAGAGAATGG - Intergenic
994509419 5:100684780-100684802 CAGTATAGCACCATAGAGAAGGG - Intergenic
994515081 5:100760796-100760818 CATTTTAGCACCACAGAGTGAGG - Intergenic
996411745 5:123166052-123166074 CAGGTTAACACAACAGAGGATGG - Intronic
996947102 5:129083593-129083615 CAGTTTTAGTGCACAGAGGAGGG + Intergenic
997342393 5:133154782-133154804 CAGTCATGCACCACTTAGGATGG + Intergenic
998493725 5:142568754-142568776 CAGTGTTGCACCTCAGAGGAAGG + Intergenic
999188832 5:149731580-149731602 CCGTTTTGCATAACAGTGGAAGG + Intronic
1002651112 5:180695363-180695385 CAGTCTTTCACCACTGAGTATGG - Intergenic
1003475447 6:6477911-6477933 AAATTTTCCCCCACAGAGGATGG - Intergenic
1007312685 6:40959192-40959214 TAGTTTAGGACCACAGAAGAAGG + Intergenic
1010029404 6:71257531-71257553 CAGTTTTGCAGCACTCAGCAGGG + Intergenic
1011052389 6:83167329-83167351 CAGTACTGCATCACAGAGAAAGG - Intronic
1011230162 6:85151719-85151741 CAGTTTTTCACCATTGAGTATGG + Intergenic
1013435698 6:110104016-110104038 AAGTCTTGCACCAGAGAGAAAGG + Intronic
1015905416 6:138111774-138111796 CAGTTTTGCACAAGACAGAAAGG + Intergenic
1016354176 6:143200170-143200192 CAGTATTGGAGCACAGAGAAAGG + Intronic
1017761718 6:157574477-157574499 CAGAATTGGACCTCAGAGGAAGG - Intronic
1018514149 6:164560850-164560872 CATTTATGCCACACAGAGGATGG + Intergenic
1018928100 6:168221264-168221286 CAGTTTTGCACCACACACACAGG + Intergenic
1021940754 7:25676937-25676959 AAGTTATGCACCACTTAGGAAGG + Intergenic
1024053718 7:45646283-45646305 CAGTTTTGCAGGACAGAGACTGG + Intronic
1024378717 7:48669504-48669526 AAGTGTTGCATCACAAAGGATGG + Intergenic
1035308917 7:157952558-157952580 CAGCTCTGCACCACAGGGGAGGG - Intronic
1035603667 8:914853-914875 CAGATCTGCACCACACAGAAAGG - Intergenic
1037203128 8:16282295-16282317 CAGAGTGGCATCACAGAGGAAGG - Intronic
1041529104 8:58842533-58842555 CAATTTTGGACAATAGAGGAGGG - Intronic
1043434669 8:80226725-80226747 CAGTTTTGCAAATCACAGGATGG + Intronic
1044389611 8:91633986-91634008 CAATGTTTCAGCACAGAGGAGGG + Intergenic
1044835872 8:96295354-96295376 CTGTTTTGTACCACAGGGGCTGG - Intronic
1045839367 8:106561380-106561402 CAGTTTTGCAGCACCGTGGTGGG - Intronic
1047025628 8:120820653-120820675 ATATTTTGCACCACAGAGGAAGG + Intergenic
1048390116 8:133954969-133954991 CATTTTAGCAAAACAGAGGAAGG - Intergenic
1049272834 8:141705127-141705149 AAGTTTTGCACCTCAGAGAATGG - Intergenic
1050063694 9:1737064-1737086 CACTTTTGTACCACAGACCACGG + Intergenic
1050656606 9:7835426-7835448 TAGTGTTGAACCAAAGAGGAAGG - Intronic
1052681165 9:31694937-31694959 CAGTGTTGCACCTCAGTGCAGGG + Intergenic
1061903215 9:133683578-133683600 CAGCTTTGCACCACAGAGGCAGG + Intronic
1062044640 9:134419363-134419385 GAGTTTAGAACCACAGAGGCAGG + Intronic
1062085984 9:134648725-134648747 CAGTGTGACACCACACAGGATGG - Intronic
1062142438 9:134967005-134967027 CAGCCTTGAAGCACAGAGGAGGG - Intergenic
1186305650 X:8254391-8254413 CATTTTTGTACCTCAGAAGATGG + Intergenic
1186874455 X:13803338-13803360 GTGATTTGCACCACAGAGAATGG - Intronic
1187798080 X:23026528-23026550 CAGGATTGCATCACAGAAGAGGG + Intergenic
1188845349 X:35065462-35065484 AATTTTTGCACTACAGAGGGTGG + Intergenic
1189253331 X:39618557-39618579 GAGTTTTGCAGAACAGATGAAGG + Intergenic
1191008545 X:55737532-55737554 CAGTTTTTCACCACTGAGCATGG + Intronic
1192426973 X:71085822-71085844 GAGTTCTGTACCACAGAGGAGGG - Intergenic
1195432647 X:104806626-104806648 AAGTGTTGTACCACAAAGGAGGG - Intronic
1198372662 X:136006184-136006206 CAGCTTTGCATCAAAGGGGAGGG + Intronic
1198761463 X:140037283-140037305 AAATTTTGCACCACAGAACATGG + Intergenic
1199259133 X:145750336-145750358 CAGTGCTGCAGCAAAGAGGAGGG - Intergenic
1199576915 X:149321149-149321171 CAAATTTTCACCACAAAGGACGG - Intergenic
1200046869 X:153407860-153407882 CAGATTTTATCCACAGAGGAGGG + Intergenic
1201402010 Y:13613247-13613269 CAGTTTTGCAGAACAGAAAAGGG - Intergenic