ID: 906804919

View in Genome Browser
Species Human (GRCh38)
Location 1:48771519-48771541
Sequence ACTGGGATGTTAACCATTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906804919_906804923 2 Left 906804919 1:48771519-48771541 CCCTCAATGGTTAACATCCCAGT 0: 1
1: 0
2: 0
3: 3
4: 94
Right 906804923 1:48771544-48771566 AATCCGCAACAGATGACAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906804919 Original CRISPR ACTGGGATGTTAACCATTGA GGG (reversed) Intronic
901354244 1:8629566-8629588 ACTGAGATTTTTACCCTTGAGGG - Intronic
902106214 1:14038307-14038329 ATTGAGAAGTTAACCCTTGAGGG + Intergenic
906804919 1:48771519-48771541 ACTGGGATGTTAACCATTGAGGG - Intronic
907634575 1:56120858-56120880 TCTGGGATGTTGATTATTGAGGG - Intergenic
907959409 1:59264470-59264492 TCTGGGATGTGGACCAGTGAGGG + Intergenic
912377250 1:109219964-109219986 ACTGGGTTGTTACCGGTTGAGGG + Intronic
912446627 1:109741252-109741274 ACAGGCATGTTAAACATTGTTGG - Intronic
918026333 1:180752158-180752180 GCTGGGATGCTAACCATGGCTGG + Intronic
918582961 1:186153804-186153826 ACCCGGCTGTTCACCATTGATGG + Exonic
918640499 1:186835230-186835252 ACTGGGATGTTCACCCCTTATGG + Intronic
919013857 1:192002504-192002526 ACTGGAATGTGAACATTTGATGG + Intergenic
920929373 1:210372470-210372492 AGTGGTATGTTAAACAGTGAAGG + Intronic
921170479 1:212543142-212543164 AAAGGGATGTCAACCATAGAAGG - Intergenic
921316005 1:213891543-213891565 GCTGGGAAGTTTAACATTGAGGG - Intergenic
922954594 1:229588408-229588430 AATGGGATGGAAGCCATTGAAGG - Intergenic
1068829620 10:61478490-61478512 ACTGGAATGTAAACCGTTAATGG + Intergenic
1068866327 10:61898989-61899011 TCTGAGATGTTAACAATTGCAGG - Intergenic
1068928703 10:62566342-62566364 ACTGGTAGGTTGACCAATGATGG + Intronic
1072801190 10:98393451-98393473 ACTGGGATGGGAAAGATTGAAGG - Intronic
1076577734 10:131481561-131481583 CCTTGCATTTTAACCATTGAAGG - Intergenic
1077866817 11:6229206-6229228 ACTGGGATTCAAACCATTGAGGG - Intronic
1080294808 11:30714418-30714440 ACTGGAATGTTCACCAATGCTGG - Intergenic
1091948076 12:4567062-4567084 AATGGGAAGTTAACAATTCATGG - Intronic
1097757307 12:63420860-63420882 GCTGGGAAGTTCACGATTGAGGG + Intergenic
1102194669 12:111016540-111016562 AATGTGATGTTAACCATGGAAGG + Intergenic
1102721997 12:115024353-115024375 ACTAGGAGGTTAATCAATGAAGG + Intergenic
1108805656 13:54152639-54152661 GCTGGGAAGTTCAACATTGAGGG + Intergenic
1112148069 13:96723677-96723699 ACTGGGAGGTTATCCATGGGTGG - Intronic
1112688327 13:101859356-101859378 ACAGTTAAGTTAACCATTGAAGG - Intronic
1118113759 14:62751496-62751518 ACTGGCATCTGAACCAATGATGG - Intronic
1121220403 14:92280683-92280705 AATGGGCTGGTAACCATGGAAGG - Intergenic
1140199555 16:72883766-72883788 ACTGAAATTTTAAGCATTGATGG - Intronic
1144999965 17:19297655-19297677 ACTGGGATGATGACAAGTGAAGG - Intronic
1155601842 18:27558184-27558206 ACTGTGATGTATACCATTGGCGG - Intergenic
1160219694 18:76965724-76965746 CCTGTGATGTGAACCATTCATGG + Intronic
1166705551 19:44906067-44906089 ACTGGGATGTAAGCCATAGCAGG + Intronic
936583874 2:113734013-113734035 ACTGGTTTGTAAACCCTTGAAGG - Intronic
940709332 2:157143663-157143685 CCTGGGACGTTAACCATATATGG + Intergenic
946840402 2:223814117-223814139 ACTGGTATGTTAAAAAATGAAGG - Intronic
948242339 2:236448169-236448191 AGGGGGATGTTAAGCTTTGAGGG - Intronic
1169054671 20:2610892-2610914 ACTTGGCTGTTAATCATTTATGG - Intronic
1169831515 20:9830770-9830792 ACTGTGATGTGCATCATTGAAGG - Intronic
1171028435 20:21653976-21653998 ACTGGGACCTGAACCAATGATGG + Intergenic
1178203243 21:30432234-30432256 ACAGGGATGTTAAGTATTAAGGG - Intergenic
1179232431 21:39517202-39517224 ACTGGATTGCTAACCATGGAAGG - Intergenic
1181392099 22:22590743-22590765 ACTGGGATGCTACCCACTGTGGG - Intergenic
949745507 3:7287420-7287442 ACTGAGTTGTTAACAATAGAGGG - Intronic
950441228 3:13011850-13011872 GCTGGGATGTTACCCATGGCAGG - Intronic
951055312 3:18140241-18140263 ACTGGGCTGTTAAACATTCCTGG + Intronic
951872436 3:27379327-27379349 TCTGATATGTTAACAATTGAGGG + Intronic
958647034 3:96887426-96887448 CCTGTGATGTGAACCATTTATGG + Intronic
963066090 3:141265807-141265829 ACTGGGAAGTCAACCATGCAGGG + Intronic
965059418 3:163765103-163765125 ACTGGGATATTAGCCTTTAATGG - Intergenic
965857798 3:173109594-173109616 GTTGGGATGATAACCATTGAAGG + Intronic
967610062 3:191494388-191494410 AATGTGATGTTAACAATAGAGGG - Intergenic
971307746 4:25498379-25498401 GCTGTGATGTGAACCATTGGAGG - Intergenic
974906767 4:68067743-68067765 TCTGGGATGTTACCCTTAGAAGG + Intronic
976206669 4:82629012-82629034 AGTGGGATTCTAGCCATTGATGG - Intergenic
978726627 4:111977272-111977294 CCTGGGATGTGAACCATCTACGG + Intergenic
979875804 4:125889675-125889697 ACTGGAATGATAAGTATTGACGG - Intergenic
981880043 4:149599216-149599238 AATGGGATGTTGTGCATTGATGG + Intergenic
982312094 4:153997015-153997037 CCTGTGATGTGAACCATTTATGG + Intergenic
984031043 4:174604505-174604527 ACTAGGATGTGAACACTTGAAGG + Intergenic
987552221 5:19397903-19397925 ACTGGAATGCGAACAATTGAGGG + Intergenic
991411212 5:66347393-66347415 ACTGGGCTGTGAACCCTTGCAGG + Intergenic
993323831 5:86509482-86509504 ACGTGGATGATAAGCATTGAAGG + Intergenic
995947574 5:117667736-117667758 ACTGAGCTGTTAAACATTTAAGG + Intergenic
996083359 5:119279011-119279033 ACTGGGATGGTAAACATTTCTGG - Intronic
997028243 5:130091894-130091916 ACAGGGATCTTCACCATTAATGG - Intronic
997521887 5:134528222-134528244 ACTGGGAATTTTACCAGTGAAGG - Intronic
998148491 5:139744081-139744103 TCTGGGAAGTTGACCATTGGAGG + Intergenic
1000078022 5:157812846-157812868 AATAGGATTTTAACCATTAATGG - Intronic
1000757851 5:165183820-165183842 CCTGTGATGTTAACCATCTATGG + Intergenic
1010376921 6:75181590-75181612 ACTTGGATATTAACCTTTGGTGG + Intronic
1013923857 6:115444271-115444293 ACTGGGAAGATAAGCATTCAGGG + Intergenic
1014931519 6:127342397-127342419 CCTGGAATGTTAATCATTGCAGG + Exonic
1018377451 6:163226717-163226739 ACTGGGATGTGAGCCACCGATGG - Intronic
1020899836 7:13990648-13990670 ACTAGGACGTTAAGCAGTGAGGG + Intronic
1021339445 7:19445641-19445663 ACTGTGTTTTTAACCATGGATGG - Intergenic
1027547356 7:79544796-79544818 GCTGGGATCTGAACCAGTGACGG - Intergenic
1030105517 7:105983780-105983802 ACTGTGCTGTTACCCCTTGAAGG - Intronic
1032736280 7:134695461-134695483 GCAGGGATGCTAACCATTTATGG + Intergenic
1034138648 7:148796089-148796111 ACTGTGATGTTAAAGAGTGATGG + Intronic
1038197502 8:25381744-25381766 AATGGCATGCTAACCATTGTAGG + Intronic
1040635607 8:49270135-49270157 CCTGTGATGTGTACCATTGATGG + Intergenic
1044679333 8:94761464-94761486 AATGTGATGTTGAACATTGAAGG + Intronic
1051876631 9:21801220-21801242 ACTCAGAAGTGAACCATTGAGGG - Intergenic
1052092016 9:24340094-24340116 CCTGTGATGTGAACCATTTATGG + Intergenic
1054829975 9:69613646-69613668 ACTGGGATGTTCCTCCTTGAAGG + Intronic
1057003888 9:91538364-91538386 TCTGTGATGTGAACCATTTATGG - Intergenic
1060423223 9:123484426-123484448 AAAGGCATGATAACCATTGAAGG - Intronic
1061170304 9:128948652-128948674 ACGGGGATGTTTAACTTTGAGGG - Intronic
1193700942 X:84760471-84760493 ACTGGGATCAGAACCATTGTTGG - Intergenic
1196843180 X:119877405-119877427 ACTGGAATTTTAAACATTGTAGG - Intergenic
1198100976 X:133421503-133421525 ACTGGGATTGTTACCAGTGAAGG - Intergenic
1201455198 Y:14161474-14161496 CCAGGTAAGTTAACCATTGAGGG + Intergenic
1201789081 Y:17818073-17818095 ACGGGGATGTTAACAATATATGG + Intergenic
1201812472 Y:18087914-18087936 ACGGGGATGTTAACAATATATGG - Intergenic