ID: 906806948

View in Genome Browser
Species Human (GRCh38)
Location 1:48788300-48788322
Sequence CACAGGGTAATGACAAGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906806945_906806948 -10 Left 906806945 1:48788287-48788309 CCTTTCAGGAGGTCACAGGGTAA 0: 1
1: 0
2: 4
3: 24
4: 199
Right 906806948 1:48788300-48788322 CACAGGGTAATGACAAGGATGGG 0: 1
1: 0
2: 2
3: 11
4: 168
906806940_906806948 18 Left 906806940 1:48788259-48788281 CCTTCTGAGATAATTTCTATTAC 0: 1
1: 0
2: 1
3: 44
4: 389
Right 906806948 1:48788300-48788322 CACAGGGTAATGACAAGGATGGG 0: 1
1: 0
2: 2
3: 11
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906806948 Original CRISPR CACAGGGTAATGACAAGGAT GGG Intronic
900619025 1:3578509-3578531 CACAGGGCAATGACAGGGCAGGG + Intronic
901614247 1:10525598-10525620 GACAGTAGAATGACAAGGATTGG - Intronic
902955850 1:19923674-19923696 CACGGGTTAATGACAGGGAGTGG - Intergenic
903293941 1:22331951-22331973 CACAGTGTCAGGACAAGGTTGGG + Intergenic
904207164 1:28862837-28862859 CACACGGTGATGATGAGGATGGG - Exonic
905370138 1:37478622-37478644 TACAGGGTAGTGATAAGCATAGG + Intronic
906806948 1:48788300-48788322 CACAGGGTAATGACAAGGATGGG + Intronic
907257992 1:53194758-53194780 CGCAGAGTAAGGAAAAGGATGGG + Intergenic
908777920 1:67659699-67659721 AACATGGTAAGGACAAGGATGGG + Intergenic
910183701 1:84512394-84512416 CACAAGGTAATCACATTGATTGG - Intergenic
913095898 1:115514957-115514979 CACAGAGTGATGGCAAGGACAGG + Intergenic
914871094 1:151474636-151474658 CACAGAGAAAAGACCAGGATGGG + Intergenic
915049629 1:153054685-153054707 CACAGGGTATGGAGAAGGAGAGG + Intergenic
916239691 1:162626476-162626498 CACAGAGTACAGACAAGGATAGG + Intergenic
916765985 1:167861327-167861349 CAGAGGGTCATGACCTGGATGGG - Intronic
920988474 1:210913026-210913048 CAGAGGGTTATGAACAGGATGGG + Intronic
922072211 1:222205741-222205763 TACAGTGTAATGATCAGGATTGG + Intergenic
922229855 1:223676275-223676297 CACAGGGCAATGACATGTCTTGG - Intergenic
923854744 1:237834178-237834200 AACAGGGAAATGACAGGGGTGGG - Intergenic
924225426 1:241917850-241917872 CAAAGGGTAAGATCAAGGATTGG + Intergenic
1066010027 10:31186576-31186598 CACAGGGAAATAACAGGGCTGGG - Intergenic
1066279065 10:33897428-33897450 CACAGGGAAATGCACAGGATAGG + Intergenic
1067171709 10:43912336-43912358 CAGAGGAGAATGACAAGGAGGGG - Intergenic
1073457337 10:103645611-103645633 CACAGGCTAATCACCAGGAACGG + Intronic
1075940365 10:126386281-126386303 CTCAGGGTACAGACAAGGCTAGG + Intronic
1080023609 11:27590732-27590754 CAAAGGGAAGTGACAAAGATGGG + Intergenic
1080386608 11:31814340-31814362 CACAGGGGAATGCCAGGGATCGG - Intronic
1081063011 11:38503823-38503845 CACAGGGCAGGGACAATGATCGG + Intergenic
1081065364 11:38534096-38534118 CATTGGGCAATGACAAGGGTGGG + Intergenic
1083263099 11:61533543-61533565 CAGAGGGTAATGACGCGGAGAGG - Intronic
1083805003 11:65068194-65068216 GACAGGGAGATGGCAAGGATGGG - Intronic
1085466799 11:76729633-76729655 CACAGGGCGATGATAAGGGTGGG + Intergenic
1085589801 11:77749445-77749467 CAGAGGCTAATGCCAAGTATGGG + Intronic
1085924053 11:80993232-80993254 CCTAGGGTAATTACAAGGTTTGG - Intergenic
1086267525 11:85019325-85019347 AACATGGGAAGGACAAGGATAGG + Intronic
1088625043 11:111723933-111723955 CACAGGATACTGACAGGGAGTGG - Exonic
1089874128 11:121703709-121703731 GACAGGGAAATGAGAAGTATAGG + Intergenic
1091101468 11:132877721-132877743 CACAGAGTAAAGTCTAGGATAGG - Intronic
1093612469 12:21178951-21178973 CCCAGGGTAAAGCCAATGATTGG - Exonic
1099028191 12:77492006-77492028 AAAAGGGTAATAACAAGGAAAGG - Intergenic
1099271013 12:80511404-80511426 AATAGGGTAATGAAAAGGAATGG - Intronic
1103795416 12:123499767-123499789 CACAGGGAGATGAGAAGGAAGGG - Intronic
1103946328 12:124528705-124528727 CAGAGGGTCATGCCAAGAATTGG - Intronic
1107978452 13:45712998-45713020 CTCACTGGAATGACAAGGATAGG + Intronic
1109180503 13:59208795-59208817 CTCAAGGTATTGACAAGGCTAGG - Intergenic
1111942262 13:94623210-94623232 CACAGCCTAATGACAATGCTAGG - Exonic
1114282901 14:21211082-21211104 AACATGGGAAGGACAAGGATGGG + Exonic
1114401496 14:22414820-22414842 CACAGGGTGGTGACAAGGGTGGG - Intergenic
1117710364 14:58522110-58522132 AACATGGGAAGGACAAGGATTGG - Intronic
1119431802 14:74573298-74573320 CACAGGGTCATGGCAAGGACTGG + Intronic
1122142400 14:99670637-99670659 CTCAGGGAAATGAGAAGGAAGGG - Intronic
1122290038 14:100675755-100675777 CACAGGCCAATGACCAGGGTGGG + Intergenic
1125877676 15:43164986-43165008 CAAAGGGCAATGATAAGGAAAGG - Intronic
1128979249 15:72174792-72174814 CACAGGGAGATGTCAAGAATGGG + Intronic
1129912204 15:79237327-79237349 AACATGGGAAGGACAAGGATGGG - Intergenic
1131603603 15:93876642-93876664 CCCAGGCTAATGTCAAGGATAGG - Intergenic
1131768873 15:95712827-95712849 CACAGGGAAATGGGGAGGATGGG - Intergenic
1132238348 15:100238560-100238582 CACAGGGTAAAAGCAACGATGGG + Intronic
1134742496 16:16560290-16560312 CACAGGGTTATGGTAAAGATGGG - Intergenic
1134925065 16:18152169-18152191 CACAGGGTTATGGTAAAGATGGG + Intergenic
1137384866 16:48031927-48031949 CAGAGAGGAATGACAAGGGTAGG - Intergenic
1139047195 16:63076212-63076234 CCCAGGGGAAAGGCAAGGATAGG + Intergenic
1140328221 16:74026813-74026835 CACAGAGAAATGACAAAGAGAGG + Intergenic
1141567950 16:84915904-84915926 CACAGGGAAAGGGCATGGATGGG + Intronic
1143700640 17:8657380-8657402 CAGAGGGTAGTTAAAAGGATAGG - Intergenic
1146074403 17:29714779-29714801 CACATGGGAATTACAAGGAGAGG - Intronic
1146392731 17:32437844-32437866 CACAGTAGAATGTCAAGGATAGG + Intergenic
1148979307 17:51558127-51558149 CACAGGGAATTGACTAGGGTTGG - Intergenic
1149555560 17:57571014-57571036 CTCAGGGTAAAGACCAGGGTAGG + Intronic
1150197622 17:63317315-63317337 TCCAGGGAAATGACAAGGAGGGG - Intronic
1150816533 17:68396454-68396476 CACAGGGAAAAGACAAGGAAAGG - Intronic
1151693623 17:75702679-75702701 CTCAGTGTAATGACAAGTCTGGG - Intronic
1152405158 17:80093905-80093927 CAGAGGGCAAAGACAATGATAGG - Intronic
1153990749 18:10397272-10397294 CTCAGGATAATGACAAAAATGGG + Intergenic
1155349838 18:24895736-24895758 CACTGGCTATTCACAAGGATTGG - Intergenic
1155396174 18:25388674-25388696 CATATGATAATGACCAGGATTGG + Intergenic
1155690629 18:28618095-28618117 CACAGGGTAATGCCAAGAGGAGG - Intergenic
1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG + Intronic
1161542364 19:4859774-4859796 CCCAGGGAAATGACCAGGAGGGG + Intronic
1164728702 19:30484568-30484590 CACAGAGAAAGAACAAGGATGGG - Intronic
1165192456 19:34076442-34076464 CACAGGGCGATCACAAGTATGGG + Intergenic
1168398633 19:56069595-56069617 TACAGGGTAAAAACAAGCATAGG + Intergenic
927636870 2:24822981-24823003 CACAGGATAAGGATAAGGACTGG - Intronic
928160894 2:28923483-28923505 TACAGTATAATGACAAGGTTTGG - Intronic
930164760 2:48194213-48194235 CAGAGGGGAATGAGAGGGATGGG + Intergenic
932162719 2:69476863-69476885 CACAAGGTAAGAAAAAGGATGGG - Exonic
933040338 2:77457166-77457188 CTCTGGGAAATGACTAGGATTGG - Intronic
936701064 2:115012166-115012188 CACAGGGTAGGGGCAGGGATAGG - Intronic
939837636 2:147150207-147150229 CACTGGGCACTGACAAGCATGGG + Intergenic
943045301 2:182854003-182854025 CACAGCCTAATGAAAAGCATAGG + Intronic
943075903 2:183194373-183194395 CACTGGGTGATGAAAGGGATAGG - Intergenic
943601333 2:189924335-189924357 AACATGGGAAGGACAAGGATGGG - Intronic
943918102 2:193664427-193664449 CATAGGGTAATTACAATGAAGGG - Intergenic
944475173 2:200096222-200096244 CACTGGGTTATTAGAAGGATTGG - Intergenic
944564166 2:200970640-200970662 CACAGAGTAATTACAATAATGGG + Intergenic
944584645 2:201162693-201162715 CACAGGGAGAGGACAAGGACAGG + Intronic
945708840 2:213270366-213270388 CACAGAGTAATTACAATAATGGG + Intergenic
945857898 2:215090356-215090378 CACAGAGTGAGGACAAGGACAGG - Intronic
947252084 2:228118507-228118529 TACTGAGTACTGACAAGGATAGG - Intronic
948668549 2:239551763-239551785 CCCAGGGCAATGACAGGGAGGGG + Intergenic
1172804283 20:37600123-37600145 CACATGGGAATCACCAGGATTGG - Intergenic
1177697017 21:24585942-24585964 CACAAGGTAATTAAAAGTATTGG - Intergenic
1184633425 22:45804816-45804838 CACAGGGTAAAGAAGAGAATGGG - Intronic
950288892 3:11767602-11767624 CACAACGTGTTGACAAGGATGGG - Intergenic
953209898 3:40866544-40866566 CACAGGGAAAAGACGAGGGTAGG + Intergenic
953225925 3:41020739-41020761 AACCAGGTAATGACAAAGATGGG + Intergenic
954096180 3:48330625-48330647 CACAGGGGAGGGACAATGATCGG - Intergenic
957285005 3:78206970-78206992 CACAATCTAATGACAAGGAAGGG - Intergenic
958829037 3:99065813-99065835 ACCAGGGTAATGGCAAGAATTGG + Intergenic
960686211 3:120296685-120296707 CACAGGGTATATACAAAGATTGG - Intergenic
963306518 3:143659666-143659688 CACAGGGTGATGACAGGGATAGG - Intronic
963405586 3:144859484-144859506 CACAGAGTAATGACAAGCATAGG - Intergenic
967524944 3:190481448-190481470 CACAGTGTTGTGCCAAGGATGGG - Intergenic
967995525 3:195163498-195163520 CACATGGCAATGACAATGATAGG + Intronic
969437862 4:7199079-7199101 CACAGGAGAATCAGAAGGATGGG - Intronic
969998512 4:11339971-11339993 CATATGATAATGACAAGGAGTGG + Intergenic
970457609 4:16240536-16240558 AGCAGGGAAAAGACAAGGATTGG - Intergenic
971148643 4:24007487-24007509 CACAGGGTAATGACCTAGTTAGG + Intergenic
973628170 4:52793262-52793284 CAAAGTGTTATGACAAGTATGGG - Intergenic
974743555 4:66040103-66040125 GGCAGGGTAATGACACTGATGGG + Intergenic
978969000 4:114779579-114779601 CAAAGGTCAATGACAAGGAGAGG - Intergenic
981952478 4:150425539-150425561 CATGGCATAATGACAAGGATTGG + Intronic
983644173 4:169972834-169972856 CACAGGGTATTTACTATGATTGG + Intergenic
986281461 5:6326305-6326327 ATCAGAGTAATGACAGGGATGGG + Intergenic
986286209 5:6360900-6360922 CAGAGGGGACTGACAAGGAATGG - Intergenic
988898687 5:35707680-35707702 CAAAGGGTCATCACAATGATGGG + Intronic
989171308 5:38472416-38472438 CCCTGGTTAAGGACAAGGATGGG - Intergenic
990516083 5:56532029-56532051 CAGAGGGGAATGACAAATATTGG - Intronic
992099759 5:73395807-73395829 CACTGGGCAATGACAAGAGTGGG - Intergenic
992450697 5:76873200-76873222 CAAAGGGTAATTACTAGGGTAGG + Intronic
992940616 5:81757624-81757646 CACAGGGTAATGAGCAGGTGAGG + Intergenic
997903391 5:137789765-137789787 CACAGGGTTATCACAAGGTGAGG + Intergenic
998535386 5:142925673-142925695 CAAAGGGGAATGATAAGGAATGG - Intronic
999258475 5:150222943-150222965 CCCAGGGTAATGTAAAGGATGGG - Intronic
999585123 5:153081613-153081635 CATAGGGTAATGACGGGGAGTGG - Intergenic
1001175946 5:169469040-169469062 CACAGGGCAGTGACAAGCATTGG - Intergenic
1001334532 5:170786229-170786251 GACAGGGAAAGGACAGGGATTGG + Intronic
1004838341 6:19554487-19554509 AAGAGGGTGATGACAAAGATAGG - Intergenic
1007401589 6:41605662-41605684 CAGTTGGTAATGACAGGGATGGG - Intergenic
1009602028 6:65813440-65813462 CTCAGGGTAATAATAATGATAGG + Intergenic
1010928391 6:81770979-81771001 CACAGGGAAATGAGAAGGAAAGG + Intergenic
1013663947 6:112327337-112327359 TATAGAGTAATGGCAAGGATGGG - Intergenic
1017467698 6:154710122-154710144 AACAGGGGAATGAGAAGGAATGG + Intergenic
1019051074 6:169184448-169184470 CACAGGAAACTGACAAGGAAAGG + Intergenic
1019658799 7:2212159-2212181 CACAGGGTCCTGGGAAGGATGGG + Intronic
1019709944 7:2513600-2513622 CACGGGGTCATGACTAGGGTGGG + Intronic
1021536714 7:21713548-21713570 AAAAGGGTAATCACAAGGAATGG - Intronic
1022465600 7:30651265-30651287 CACAGCTTAATGAAATGGATAGG - Intergenic
1022881299 7:34590465-34590487 CAAAAGTTAATGACAAGTATTGG - Intergenic
1027363031 7:77428891-77428913 CACAGGGTGATAGCAAGGTTGGG - Intergenic
1032487432 7:132298344-132298366 CACAGGCTAAAGCCAAGGAGTGG + Intronic
1033265330 7:139880941-139880963 CACATTTTAATGACAAGTATGGG - Intronic
1035518185 8:254663-254685 CACTGGGGACTGACAAGGGTGGG + Intergenic
1036148826 8:6279576-6279598 CACAGAGTAATGCCAAGCAGAGG + Intergenic
1038442938 8:27584411-27584433 CACAGTGAGATGGCAAGGATGGG + Intergenic
1041220868 8:55649656-55649678 GATCGGGAAATGACAAGGATGGG - Intergenic
1045376411 8:101578828-101578850 CAGAGTTTAATGACTAGGATAGG + Intronic
1046827479 8:118707056-118707078 CCCAGGGCAATAACAAGGAATGG - Intergenic
1047020154 8:120767115-120767137 CACAAGGTAGTGACTAGGCTTGG - Intronic
1047274477 8:123395593-123395615 CAAAGGGTTATGACGAGGCTTGG + Intronic
1047852620 8:128874988-128875010 CACTGCCTAATGACAAGGACTGG + Intergenic
1055565019 9:77559557-77559579 CACAGAGTGATGGCAAGCATGGG + Intronic
1056278668 9:85018465-85018487 CACATGGCAATGCCAAGGAGAGG - Intronic
1057963030 9:99475537-99475559 CAAAGGGCGATGGCAAGGATGGG - Intergenic
1058690322 9:107514842-107514864 CACAGAGAAATGAAAAGGCTTGG + Intergenic
1058878926 9:109269815-109269837 CACAGTCTAATAACAAGGAGCGG + Intronic
1060803886 9:126562998-126563020 CTCATGGCAATGAAAAGGATTGG + Intergenic
1061822498 9:133236395-133236417 CACAGGGTAATGGAAAGCAAAGG - Intergenic
1062236803 9:135514143-135514165 CACAGGGTAATGGAAAGCAAAGG + Intergenic
1186124968 X:6403233-6403255 CACAGGAGAGTGACAAGGGTTGG + Intergenic
1186601330 X:11040884-11040906 GACAGGGTTAGGTCAAGGATCGG - Intergenic
1189133028 X:38519948-38519970 CACAAGCTGAAGACAAGGATGGG + Intronic
1190626682 X:52343952-52343974 CACAGGGTTATGTGAAGGAGAGG + Intergenic
1190701329 X:52991877-52991899 CACAGGGTTATGTGAAGGAGAGG - Intronic
1191975080 X:66862650-66862672 CACAGGGTGGTGATGAGGATGGG + Intergenic
1195465731 X:105176752-105176774 CCCAGGTTAATGTCAAGGAGGGG - Intronic
1195567821 X:106363266-106363288 CACAGTGTTAGCACAAGGATGGG + Intergenic
1196499388 X:116361429-116361451 CCCAGAGCAATGACAAGGAGAGG + Intergenic
1196818400 X:119683555-119683577 CACAGGGTCATCCCAATGATGGG + Intronic
1198073495 X:133172427-133172449 CACAGTGGAATGACAGGGAGGGG - Intergenic
1199387159 X:147236546-147236568 CACTGGGAAATGAAAAGGCTTGG + Intergenic
1200398099 X:156003003-156003025 CACAGGGGAAGGACAAGGTGAGG + Exonic