ID: 906808417

View in Genome Browser
Species Human (GRCh38)
Location 1:48802319-48802341
Sequence TATCCCAACCTAATTTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906808417 Original CRISPR TATCCCAACCTAATTTTTCC TGG (reversed) Intronic
903790373 1:25888835-25888857 TTTCCCATCCTCCTTTTTCCTGG - Intronic
906808417 1:48802319-48802341 TATCCCAACCTAATTTTTCCTGG - Intronic
906973285 1:50541824-50541846 CATCTCAACATAATTTTGCCTGG + Intronic
909199470 1:72671494-72671516 TATCCCAGCTTATTTTTTTCAGG - Intergenic
913065317 1:115247177-115247199 TATCCCTATCTCATGTTTCCAGG + Intergenic
920709254 1:208279372-208279394 TATCCAAACAAAATTTTTCTTGG + Intergenic
921364884 1:214364384-214364406 TCTCCCAACCAGAGTTTTCCAGG - Intronic
922986171 1:229867578-229867600 AATCCCAACCTATGTTTTCCTGG - Intergenic
924437535 1:244055462-244055484 TATCCCAACTTTTTATTTCCAGG - Exonic
1063739551 10:8802979-8803001 TATTCACACCTAATTCTTCCAGG + Intergenic
1064946461 10:20795610-20795632 AATACCAACCTATTTTATCCAGG + Intronic
1065231222 10:23600430-23600452 TATACCAGTCTATTTTTTCCAGG + Intergenic
1066188922 10:33037508-33037530 TCTGCCAACCTCATTCTTCCTGG + Intergenic
1067747734 10:48949015-48949037 CATCTCAAACTAATTTTACCTGG - Intronic
1068531632 10:58194886-58194908 AATACAAATCTAATTTTTCCAGG + Exonic
1068830463 10:61488707-61488729 TATCCCACAATAATTTTTACTGG - Intergenic
1072463116 10:95638459-95638481 TGTGCCAACCTAATATTTGCAGG + Intronic
1073889140 10:108077715-108077737 TTTTTCAACCTAATTTTTCCTGG + Intergenic
1078782823 11:14455801-14455823 TATCCTAACCTTACTTTACCAGG - Intronic
1080058897 11:27936133-27936155 TATGCCAACATAATTTTTAATGG + Intergenic
1080217587 11:29863081-29863103 TACCCCAATCTAAATTTTCTAGG + Intergenic
1080894052 11:36434334-36434356 TATCCAAACACAATTTTTCTTGG - Intronic
1086381605 11:86261030-86261052 TTTCCCAACCTGCTTTTTCGGGG + Intronic
1086615282 11:88810245-88810267 TATCCAAACCTAATTATTACTGG - Intronic
1086886156 11:92208276-92208298 AATTCCAACCTAAGTCTTCCTGG + Intergenic
1087153862 11:94882331-94882353 TTTCTCAATCTAATTTTACCTGG + Intergenic
1087667381 11:101066199-101066221 TATCCCAACCAAATTATTCTTGG + Intronic
1088434480 11:109795969-109795991 TATCCAAACCTAGTTTTACATGG - Intergenic
1090535164 11:127632926-127632948 CATCTCTACCTCATTTTTCCTGG - Intergenic
1091900186 12:4138271-4138293 TAACCCAATGTTATTTTTCCAGG + Intergenic
1098662842 12:73120473-73120495 TATCACAATGTAATTTTTCAGGG - Intergenic
1101614670 12:106324839-106324861 TCTCCCAACCTTCTTTCTCCTGG - Intronic
1102979255 12:117228513-117228535 CACCCCAACCTGATTTTTCTGGG - Intronic
1104348505 12:128024527-128024549 TATTCCACCCTACTTTTTCAGGG - Intergenic
1105690669 13:22835827-22835849 AATACAAATCTAATTTTTCCAGG + Intergenic
1106446954 13:29842598-29842620 TATACCAACCATATTTATCCAGG + Intronic
1108276331 13:48813969-48813991 TTGCCCAGACTAATTTTTCCTGG + Intergenic
1109251345 13:60024280-60024302 TTTCCCAATCTATTTTTTCCTGG + Intronic
1109987142 13:70002398-70002420 TCTCCCTTCCTATTTTTTCCTGG - Intronic
1113441172 13:110329706-110329728 TGTCCCAAGCGAATTATTCCAGG + Intronic
1117630594 14:57686761-57686783 GATCCCAACATAATTTTTAAAGG + Intronic
1119983153 14:79104773-79104795 TATCACATCCTAATTTTTCTGGG + Intronic
1120460831 14:84792909-84792931 TCTGCTCACCTAATTTTTCCTGG + Intergenic
1120673742 14:87394335-87394357 TGTCACTACCTACTTTTTCCAGG - Intergenic
1121734226 14:96206536-96206558 TGCACCAACCTAATATTTCCAGG - Intronic
1130004509 15:80082059-80082081 TATGCCAACCAAAATTTTGCTGG + Intronic
1134634673 16:15783321-15783343 TTTCCCTTCCTTATTTTTCCAGG + Intronic
1135700695 16:24630137-24630159 TCTACCAACCTAATTATACCTGG + Intergenic
1141010645 16:80395211-80395233 AATCCCAACAGAATTTTTCATGG + Intergenic
1142924727 17:3224576-3224598 TATCCCACCCAAATGTTACCTGG + Intergenic
1145948936 17:28800600-28800622 TTTTCCAACTTAATTTTGCCAGG + Intronic
1146934422 17:36803524-36803546 TATCCAAACCAATATTTTCCAGG - Intergenic
1147008356 17:37422903-37422925 TATCCCAAACTTATTTTTCCAGG - Intronic
1147516465 17:41122521-41122543 TATCTTAAGCAAATTTTTCCAGG + Intergenic
1148042784 17:44722056-44722078 TATCGCAACCTCCTTCTTCCAGG - Intronic
1148087027 17:45000502-45000524 TACACCAACCTAATATTTTCAGG + Intergenic
1150449463 17:65254280-65254302 GATCCCTGACTAATTTTTCCAGG - Intergenic
1154179061 18:12113939-12113961 TATGGCTACCTAATATTTCCTGG - Intronic
1156993722 18:43440605-43440627 TCTGCATACCTAATTTTTCCTGG + Intergenic
1160226265 18:77013875-77013897 TTTCCAAAGCTAATGTTTCCAGG + Exonic
1163219707 19:15909092-15909114 AATACAAATCTAATTTTTCCAGG + Intergenic
925507572 2:4585082-4585104 TGTCCCAACCTAATATTTGTAGG + Intergenic
927050206 2:19320752-19320774 CAACCCAACTTGATTTTTCCAGG + Intergenic
928834188 2:35523141-35523163 TCTGCATACCTAATTTTTCCTGG - Intergenic
934182463 2:89638576-89638598 AATCCTCACATAATTTTTCCTGG - Intergenic
934963741 2:98701578-98701600 ACTCCTAATCTAATTTTTCCAGG - Intronic
939625312 2:144469652-144469674 TATCCCAAAATAACTTTTTCAGG - Intronic
940391121 2:153133531-153133553 TCTCCAAGCCTAATCTTTCCTGG + Intergenic
940820088 2:158343509-158343531 TTGCCCAACCTAATATTACCTGG + Intronic
941854087 2:170212573-170212595 TCTACCAATCTAATCTTTCCTGG - Intronic
943751563 2:191514841-191514863 TAGCCCTTCCTAATTTTTCATGG - Intergenic
943910738 2:193563373-193563395 TGTCTGAACCTAATCTTTCCAGG + Intergenic
947447204 2:230173063-230173085 TATCCAAACCCAATTTTTGATGG + Intronic
948092369 2:235305145-235305167 TATTTCAGCCTAAGTTTTCCAGG - Intergenic
948483817 2:238267557-238267579 TGGCCCATCCTAACTTTTCCTGG - Intronic
1169181753 20:3575118-3575140 TATGCCCAGCTAATTTTTCTAGG + Intronic
1169591717 20:7150259-7150281 TCTGCCACCATAATTTTTCCAGG - Intergenic
1177219820 21:18178024-18178046 TATCCCAAGCGAATTTCTCAAGG - Intronic
1177375362 21:20263521-20263543 TTTCCCAACCAAATTCTTCTTGG + Intergenic
1177801595 21:25833777-25833799 TCACACAACCTCATTTTTCCTGG + Intergenic
1178676575 21:34636235-34636257 TGTACCAAACTAATATTTCCCGG + Intergenic
1178807309 21:35850532-35850554 TATCACCTCCTACTTTTTCCAGG - Intronic
950415616 3:12867491-12867513 TCTCCCACCCTCACTTTTCCTGG + Intronic
950997484 3:17518595-17518617 TCTTGCAACCTCATTTTTCCTGG + Intronic
951345454 3:21542884-21542906 TCTCCAAACCTAAATTTTCCTGG + Intronic
951636604 3:24785630-24785652 ATTCCCAACCTAATTTTATCTGG - Intergenic
956181216 3:66519542-66519564 TATCCCAACTTAATCTGCCCAGG + Intergenic
957297896 3:78355434-78355456 TCACGCAACCTGATTTTTCCTGG - Intergenic
958725619 3:97902357-97902379 TATCTCATCATAATGTTTCCAGG - Intronic
959677435 3:109052306-109052328 TATACCTATGTAATTTTTCCTGG - Intronic
959685356 3:109140239-109140261 TCTGCGAACCTAATCTTTCCTGG - Intergenic
960129032 3:114033688-114033710 TAGGTCAACCTAGTTTTTCCAGG + Intronic
961269096 3:125674307-125674329 TATTCCAACATAATTGTTCTGGG + Intergenic
962147092 3:132851304-132851326 TATTCCAACCTATTTTTTTTTGG + Intergenic
963347070 3:144107778-144107800 GATCACAGTCTAATTTTTCCTGG - Intergenic
964347117 3:155765207-155765229 TATCCAAACCCAACTCTTCCTGG - Intronic
964483861 3:157167278-157167300 TCTCCCATCCTTATTTGTCCTGG + Intergenic
964950855 3:162291199-162291221 TATCCTAAGCGAATTATTCCAGG - Intergenic
965890542 3:173508538-173508560 TACCCCAACCCATTTTCTCCTGG - Intronic
966448578 3:180031779-180031801 TATCACATCTTAATGTTTCCAGG + Intronic
969526987 4:7708853-7708875 TATCCCCACCCAATTTTTACAGG - Intronic
969841595 4:9886969-9886991 TATCCCAGCCTCAGTTTACCTGG - Intronic
969985534 4:11206151-11206173 TTTCCCATCCTAAAATTTCCTGG + Intergenic
970312968 4:14801624-14801646 TATCCTAAGCTAATTAATCCGGG + Intergenic
970458763 4:16251994-16252016 TATTCCAACATAATTGTTCGGGG - Intergenic
971143295 4:23948181-23948203 TATCCCAACCACATGGTTCCTGG - Intergenic
971985245 4:33813702-33813724 TATACAAACATGATTTTTCCAGG - Intergenic
972257903 4:37378517-37378539 AATTCTAACCTAATTTTGCCAGG + Intronic
974157224 4:58089637-58089659 TGTCCCAACCTTACTTCTCCAGG - Intergenic
974665013 4:64950642-64950664 TATTACATCTTAATTTTTCCAGG - Intergenic
974802278 4:66833171-66833193 TATCCCAACATTATGTTTCAGGG + Intergenic
975424296 4:74208568-74208590 TCCACAAACCTAATTTTTCCTGG - Intronic
976278705 4:83305203-83305225 TATCTCATCCAAATTTTCCCAGG - Intronic
977895009 4:102353660-102353682 TATCCTAACCCAAGGTTTCCTGG + Intronic
978456040 4:108892986-108893008 TATCCCACCCTAATTGGTGCCGG - Intronic
978461365 4:108957117-108957139 TATCCCAAACACATTTATCCAGG + Intronic
978463432 4:108983455-108983477 TGTCCCAACATAATTTTACCCGG + Intronic
978996425 4:115160422-115160444 TATCCCAATATAATTTGTGCTGG + Intergenic
983285824 4:165737846-165737868 TATTCAAGCCTAATTTTTCAAGG + Intergenic
984128315 4:175840176-175840198 TAACCCATCATAATTTTTTCAGG + Intronic
986025254 5:3844611-3844633 TTTGCCCACCTAATTTTCCCAGG - Intergenic
986966037 5:13272312-13272334 TCTCCCCACCTAATTTTTTAAGG + Intergenic
988007047 5:25428437-25428459 TATGCCTACTTTATTTTTCCTGG - Intergenic
992109337 5:73478093-73478115 TATCTCAACCTAAATCTTCCTGG - Intergenic
995538427 5:113160350-113160372 TGTCCCATCGTAATTTTTACTGG + Intronic
1000009320 5:157216848-157216870 TATCCCAGCCTACTCTTTCTTGG + Intronic
1001694332 5:173658902-173658924 TCTCCCAAGCTAATTCTTGCTGG + Intergenic
1002174158 5:177392001-177392023 CATCGCAGCCTATTTTTTCCAGG + Intronic
1003363530 6:5451123-5451145 AATCCCAAAGTAACTTTTCCAGG - Intronic
1007190108 6:40007654-40007676 TATTCCAAACTAACTTTTCAAGG - Intergenic
1007235546 6:40389065-40389087 CAGCCCTACCTACTTTTTCCTGG - Intergenic
1007540949 6:42643754-42643776 TCTCCTAACCTATTTTTTTCTGG - Intronic
1007900850 6:45410801-45410823 TATGCCAAACTAATTGTTTCAGG - Intronic
1011326652 6:86155944-86155966 AACACCAACCTATTTTTTCCAGG - Intergenic
1014347331 6:120289612-120289634 TAAATCAACTTAATTTTTCCTGG + Intergenic
1016233513 6:141833594-141833616 TCTACGAACCTAATCTTTCCTGG + Intergenic
1018089099 6:160330066-160330088 TATCAAAACATATTTTTTCCAGG + Intergenic
1020794747 7:12665852-12665874 TATCCCAACCTCATTATCCTAGG + Intergenic
1020981430 7:15074257-15074279 TTTCCCAACCTATTTTTTCAAGG + Intergenic
1022282163 7:28922245-28922267 TATCCCTAACAAATATTTCCTGG + Intergenic
1022819953 7:33950036-33950058 TATCTCAACCCATTTATTCCTGG + Intronic
1022836196 7:34117737-34117759 TATCCCAACCTTCTGTTTCTGGG - Intronic
1024825873 7:53388464-53388486 TACCCTAAACTATTTTTTCCTGG + Intergenic
1024826713 7:53398958-53398980 GTTCCCGACATAATTTTTCCAGG - Intergenic
1026943641 7:74302906-74302928 TATCCCCACCCCATTCTTCCTGG + Intronic
1035550780 8:523306-523328 TATCACAAATTAATTTTTTCGGG + Intronic
1035843906 8:2842587-2842609 TATCCTAACCAAAATTTTTCAGG + Intergenic
1036663104 8:10721076-10721098 TATCCCACCCCAATTCTGCCAGG + Intergenic
1041045596 8:53883088-53883110 TCTCCAAACCTAATTTTTTTGGG + Intronic
1042439625 8:68810622-68810644 TATGCGTACCTCATTTTTCCTGG - Intronic
1043257329 8:78152312-78152334 CATGCAAGCCTAATTTTTCCTGG + Intergenic
1045201748 8:99990431-99990453 TCTCCAAGCCTAAATTTTCCTGG + Intronic
1052103038 9:24474386-24474408 TTTCCCTAGATAATTTTTCCTGG + Intergenic
1059594062 9:115697046-115697068 TATCCCTACATTATTTTACCAGG - Intergenic
1060557375 9:124515310-124515332 TATCCCAACAGAATTTTAACAGG + Intergenic
1060830460 9:126711325-126711347 AATCCCAATCGAATTTTTCAAGG - Intergenic
1185939650 X:4301620-4301642 AATTACAACATAATTTTTCCAGG - Intergenic
1186375083 X:8990068-8990090 TAACCTAACTTAATTTTTCCTGG - Intergenic
1186620088 X:11231082-11231104 TATCCTAACCTAAAATTTCATGG - Intronic
1187429585 X:19210002-19210024 GATACCTACCTAATTTTACCTGG + Intergenic
1194949095 X:100103798-100103820 AATCACAACCTAAGTTTGCCTGG - Intergenic
1201481677 Y:14446424-14446446 TATTTCAACCTAATTTTTTCAGG - Intergenic