ID: 906809212

View in Genome Browser
Species Human (GRCh38)
Location 1:48809117-48809139
Sequence CCTACTTTAGGGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 373}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906809199_906809212 29 Left 906809199 1:48809065-48809087 CCCATGAAGATCCGTGGGGCCTG 0: 1
1: 0
2: 0
3: 6
4: 68
Right 906809212 1:48809117-48809139 CCTACTTTAGGGAAGGAGGAGGG 0: 1
1: 0
2: 3
3: 51
4: 373
906809201_906809212 18 Left 906809201 1:48809076-48809098 CCGTGGGGCCTGAAATTAGCACA 0: 1
1: 0
2: 1
3: 6
4: 104
Right 906809212 1:48809117-48809139 CCTACTTTAGGGAAGGAGGAGGG 0: 1
1: 0
2: 3
3: 51
4: 373
906809204_906809212 10 Left 906809204 1:48809084-48809106 CCTGAAATTAGCACAGCAGGGAA 0: 1
1: 0
2: 1
3: 23
4: 203
Right 906809212 1:48809117-48809139 CCTACTTTAGGGAAGGAGGAGGG 0: 1
1: 0
2: 3
3: 51
4: 373
906809200_906809212 28 Left 906809200 1:48809066-48809088 CCATGAAGATCCGTGGGGCCTGA 0: 1
1: 0
2: 0
3: 5
4: 100
Right 906809212 1:48809117-48809139 CCTACTTTAGGGAAGGAGGAGGG 0: 1
1: 0
2: 3
3: 51
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906809212 Original CRISPR CCTACTTTAGGGAAGGAGGA GGG Intronic
902951124 1:19883341-19883363 CTTTCTTTAGGGAACGCGGAGGG + Intronic
902963686 1:19982506-19982528 CTTACAGTAGGGATGGAGGAGGG + Intergenic
903243545 1:21999764-21999786 CCTACGCCAGGGAAGAAGGAGGG - Intergenic
903302174 1:22386828-22386850 TATGCTTTAGGGTAGGAGGAGGG + Intergenic
904422274 1:30402016-30402038 CAAACTTGAGGGAGGGAGGAAGG - Intergenic
905076442 1:35275699-35275721 CTTACTTTAGCAAAGGAGAAAGG + Intronic
906384016 1:45351802-45351824 CCTATTTCAGGGAAGGGCGAAGG - Intronic
906809212 1:48809117-48809139 CCTACTTTAGGGAAGGAGGAGGG + Intronic
907083985 1:51651708-51651730 CGTACTTAAGGGAATGAAGAAGG + Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
908142568 1:61202273-61202295 TCAATTTTGGGGAAGGAGGATGG + Intronic
908222387 1:62020481-62020503 CTTTCTTTATGGAAGGAGGAGGG - Intronic
908447052 1:64209245-64209267 TCTACTTTATGGAAGTGGGAGGG - Intronic
910409656 1:86926874-86926896 ACTTCTATAAGGAAGGAGGAAGG - Intronic
910736298 1:90461599-90461621 CCTACTTGAGGGCAGAGGGAGGG - Intergenic
912140150 1:106714863-106714885 CCTACCTGAGGGTGGGAGGAGGG - Intergenic
912141882 1:106740239-106740261 CCTAGATCAGGGAAGGAGCAAGG + Intergenic
912802567 1:112729482-112729504 CCTCCTTTAAGGTTGGAGGATGG + Intergenic
913366008 1:118039637-118039659 GCTACTTGAGGGTGGGAGGAGGG + Intronic
913490452 1:119374872-119374894 CCTGACTGAGGGAAGGAGGAAGG - Intronic
914044889 1:144083105-144083127 CTTACAATAGGGAGGGAGGAAGG - Intergenic
914133221 1:144877581-144877603 CTTACAATAGGGAGGGAGGAAGG + Intergenic
916602878 1:166311029-166311051 CCTACTGTGGGGTAGGGGGAGGG - Intergenic
917033962 1:170726038-170726060 CCTCATTGAGGGAAGGCGGATGG + Intronic
917997851 1:180460129-180460151 CCTACTGTGGGGTAGGGGGAGGG - Intronic
918735756 1:188061027-188061049 CCTACTTGAGGGAAGAGAGAGGG - Intergenic
918981742 1:191570369-191570391 CCTACTTGAGGGTGGGAGGGTGG + Intergenic
919046938 1:192464191-192464213 CATATTTTAGGGTAGCAGGAAGG - Intergenic
919526721 1:198662720-198662742 ACTATTTTAGGAAAGGAGAAAGG - Intronic
920655594 1:207872304-207872326 CCTACTTTGGGGATGGAGAGAGG - Intergenic
921746299 1:218743797-218743819 TCTACTTAAGGAAAGGAGAAAGG + Intergenic
922163537 1:223096327-223096349 CCTACTTGAGGGTAGAAGGTGGG - Intergenic
922219908 1:223550546-223550568 TCATCTTGAGGGAAGGAGGAAGG - Intronic
923054697 1:230417271-230417293 CTTCCTTTAAGGAAGGAGGAGGG - Intronic
923569068 1:235098409-235098431 CAAACTCTAGGGAGGGAGGAAGG + Intergenic
924633401 1:245763210-245763232 CATTATTGAGGGAAGGAGGAGGG - Intronic
924762670 1:247003440-247003462 CCGACTTTAGAGTAGAAGGAAGG + Intronic
1063752955 10:8972930-8972952 TCTACTTCAGGGGATGAGGAAGG + Intergenic
1064167217 10:12996921-12996943 CCTACGTGAGGGTGGGAGGAGGG + Intronic
1064310545 10:14208518-14208540 CCTGCCTTGGGGAAGGAGGAGGG + Intronic
1066250360 10:33626998-33627020 ACTACATTTGGGAAGGAGAAAGG - Intergenic
1066957015 10:42182787-42182809 CTTACAATAGGGAGGGAGGAAGG - Intergenic
1067331518 10:45326169-45326191 CCTGGTTCAGGGGAGGAGGAAGG - Intergenic
1068679950 10:59808671-59808693 CCAAATTTAGGGAAGAAGGAGGG + Intronic
1068753528 10:60624044-60624066 CCTACTTGAGGGTAGAGGGAGGG + Intronic
1070160350 10:73863134-73863156 TCTACTTTGTGGAAGGAGGTGGG + Intronic
1070747020 10:78939837-78939859 CCCACTGGAGGGAAGGAAGAGGG - Intergenic
1070831464 10:79420354-79420376 CCTCCCTTAGGGAATGAGGGTGG + Intronic
1072028359 10:91489164-91489186 TCTACTTTAAAGAAGGAGAATGG + Intronic
1072259988 10:93660541-93660563 CCTACTTCAGGGGAGAAGGTCGG + Intronic
1072669171 10:97416725-97416747 GCTGCGTAAGGGAAGGAGGAAGG - Intronic
1073820234 10:107253777-107253799 GCTGCATTAGGGAAGGTGGAGGG - Intergenic
1076325455 10:129617122-129617144 CCTACTTGAGGGTGGGAGGAGGG - Intronic
1077354402 11:2108595-2108617 CCTATTGTGGGGAAGGAGGAGGG - Intergenic
1077708168 11:4508652-4508674 CCTACCAGAGGGTAGGAGGAAGG + Intergenic
1078112703 11:8411418-8411440 CATTATTTAGGGAAGGAGGAAGG + Intronic
1078113245 11:8418240-8418262 ACTACTTGAGGGTGGGAGGAGGG - Intronic
1078444068 11:11391032-11391054 CCTTCCTTTGGAAAGGAGGAAGG - Intronic
1079499948 11:21091922-21091944 CCTAGTGTAAGGATGGAGGATGG + Intronic
1079839675 11:25381309-25381331 CCTGTTTTAGGGTGGGAGGAGGG - Intergenic
1080242496 11:30142842-30142864 CCTGCTTTAAGTAAGGAAGAGGG - Intergenic
1080347170 11:31337883-31337905 ACTAATTTAGGGGAAGAGGAAGG + Intronic
1081490283 11:43562857-43562879 CCAACTTCAGGTAAGGAGAAAGG + Intronic
1081587955 11:44400304-44400326 CCTCCTTTGGGGGAGGAGGGAGG + Intergenic
1082912970 11:58397443-58397465 CCTATTTTGGGGAAGAAAGAGGG + Intergenic
1083022365 11:59520047-59520069 CCTACTTGAGGGGAGGAGGGTGG + Intergenic
1085914224 11:80865502-80865524 CCTACTTGAGGGTAGAAGGTGGG + Intergenic
1086229344 11:84549574-84549596 GCGACTTTAGGGAAGTATGAAGG + Intronic
1086993754 11:93333405-93333427 CCTTCCATAGGGAAGGAGAAAGG + Intronic
1087008625 11:93492980-93493002 TCTATTTTAGGGTAGGAGAAAGG + Intronic
1087176361 11:95099616-95099638 CCTACTTTGGGACAAGAGGAGGG + Intronic
1088149771 11:106730270-106730292 CCTACTTTAGGGCAGGGGGTAGG - Intronic
1088832006 11:113545010-113545032 ATTACTATAGGGCAGGAGGAAGG - Intergenic
1088897744 11:114090950-114090972 CCCACCTTAGGGCAGGGGGAAGG - Intronic
1090071217 11:123546206-123546228 CTGACCTCAGGGAAGGAGGATGG + Intronic
1090578111 11:128130958-128130980 CCTATTTTAGTCAAGGTGGAAGG - Intergenic
1090721691 11:129481239-129481261 CCTACTAAAGGGAAGGAGCCTGG - Intergenic
1091871217 12:3892737-3892759 CCTTCTTTAGGGAAGAAAGTAGG + Intergenic
1091907376 12:4200044-4200066 CCTCCTTAAAGGAAGGAGCAAGG - Intergenic
1092836435 12:12493388-12493410 CCTACTGGATGGAAGCAGGAAGG - Intronic
1092947505 12:13470507-13470529 CCTACTATATGCCAGGAGGAGGG + Intergenic
1093366854 12:18312559-18312581 CAAACCTTTGGGAAGGAGGAAGG + Intronic
1093637591 12:21489865-21489887 CCTCCTTTAGGGAGAGAGGAGGG + Intronic
1093765822 12:22961245-22961267 GCTATTCTAGGCAAGGAGGATGG - Intergenic
1096418314 12:51432933-51432955 CCTACTGCAGGAAAGGAGGTGGG + Intronic
1096496656 12:52042862-52042884 CCTCTTCCAGGGAAGGAGGAAGG - Intronic
1097129727 12:56803136-56803158 CCTGCTTGAGGGACGCAGGAGGG - Intergenic
1098550846 12:71759521-71759543 CTTACTCAAGGGAAGGAGGAGGG - Intronic
1098871760 12:75824684-75824706 TATACTTCAGGGAAGGAAGAAGG + Intergenic
1099686265 12:85893128-85893150 CCTCCCTCAGGGAAGAAGGAGGG + Intergenic
1100183393 12:92109770-92109792 CCTACTTGGGGGATGGAGGTGGG - Intronic
1100800855 12:98228718-98228740 CCTAATTCAGGGCAGGGGGAGGG - Intergenic
1101220781 12:102637584-102637606 ACTACTATAGGTAGGGAGGAAGG - Intergenic
1101376342 12:104174397-104174419 CCCATTTTAGGGATGGAGAAAGG + Intergenic
1101406535 12:104433823-104433845 ATTACCTTTGGGAAGGAGGAGGG - Intergenic
1104277980 12:127347478-127347500 CCCACAATAGGGAAGGAGAAGGG + Intergenic
1104758647 12:131284177-131284199 CCTAGGCTAGGGGAGGAGGAAGG - Intergenic
1104927795 12:132322614-132322636 CCTACGTTCTGGAAGTAGGAGGG - Intronic
1105211037 13:18257141-18257163 CCTACTGTAGGTAAAGAGAAGGG + Intergenic
1105341078 13:19526558-19526580 CCTACTTGAGGGTTGGAGGCTGG + Intronic
1105878061 13:24577383-24577405 CCTACTTGAGGGTTGGAGGCTGG - Intergenic
1106209836 13:27631526-27631548 GCCACTTTAGAGAAGGCGGATGG - Intronic
1106363581 13:29055518-29055540 CCTACTTGAGGGTAGAAGGTGGG - Intronic
1108234549 13:48389763-48389785 ACCACTCTAGGGAGGGAGGATGG - Intronic
1111581390 13:90228279-90228301 TCTACTCTAGTGAAGGAGTAGGG + Intergenic
1111994123 13:95146252-95146274 CCTACTTTATGGTAGGAGGAGGG + Intronic
1113119525 13:106911475-106911497 CCTACTTCAGGGACAGAGAATGG + Intergenic
1113122273 13:106936217-106936239 CCTACTTGAGGCAGGGAGGGTGG + Intergenic
1113271296 13:108677561-108677583 TATATTTTAGGGAAGGGGGAAGG + Intronic
1114137625 14:19869636-19869658 CAAACATGAGGGAAGGAGGATGG + Intergenic
1115320294 14:32073419-32073441 CCTACTTGAGGGGAGGAAGAAGG - Intergenic
1117821353 14:59652670-59652692 CCTACTTGAGGGTGGGAGGAGGG + Intronic
1118216808 14:63816526-63816548 CCTGCTTCAGGGAAGAAGGGTGG - Intergenic
1118528076 14:66668624-66668646 CCTACTTGAGGGTAGAAGGTGGG + Intronic
1118887651 14:69879837-69879859 CATCCCTGAGGGAAGGAGGAGGG + Intronic
1120716202 14:87843517-87843539 CCTACTTGAGGGGAGAAGGAGGG - Intronic
1122621631 14:103061005-103061027 GCTACTTTAGAGAATGAGGCAGG + Intergenic
1202936096 14_KI270725v1_random:88989-89011 CTTACAATAGGGAGGGAGGAAGG + Intergenic
1123981315 15:25607177-25607199 CATACTTTAGGGACCAAGGAAGG + Intergenic
1124174843 15:27414837-27414859 CCTACTTTAGAGAGCTAGGAGGG - Intronic
1125037602 15:35143834-35143856 CCTTCTTCAGGGAAGAATGAAGG - Intergenic
1125302985 15:38277268-38277290 CCTACTTGAGGGTGGGAGGAGGG - Intronic
1126447631 15:48766509-48766531 CCTCCTTCAGGGAAGCTGGAGGG - Intronic
1126502482 15:49361396-49361418 CCTACTTGAGGGAGGAGGGAAGG - Intronic
1126609227 15:50511884-50511906 GCTACTCGAGGGAGGGAGGAGGG + Exonic
1127011079 15:54629278-54629300 CCTACTTGAGGGTAGGAGGAGGG + Exonic
1127275000 15:57434977-57434999 CCTAATATAGGGTAGGAGGAGGG + Intronic
1127613549 15:60660609-60660631 CCGACTTTTGGGAAGAAGGGAGG + Intronic
1128857846 15:71034886-71034908 CCTACCAGAGGGCAGGAGGAGGG + Intronic
1128926878 15:71664645-71664667 CCTACTTGAGGGTGGGAGGAGGG - Intronic
1129128213 15:73464591-73464613 CCTCCTGTAGAGAAGTAGGAAGG + Intronic
1130207131 15:81887614-81887636 CCTACATTAGTGAGGGAGGATGG - Intergenic
1130220018 15:82011500-82011522 CTTACTTAAGGGAAAGAGGAGGG + Intergenic
1131559508 15:93427241-93427263 CCTTCTGAAGGGAACGAGGAGGG + Intergenic
1135526907 16:23220212-23220234 CCTGGAGTAGGGAAGGAGGAAGG - Intergenic
1136229136 16:28876786-28876808 CCCACTTTTGGGGAGGGGGATGG - Intergenic
1137424901 16:48370207-48370229 CCTACTTAAGGGAAAGGGAAGGG - Intronic
1137502725 16:49023934-49023956 CTTTCATTTGGGAAGGAGGAAGG + Intergenic
1137732854 16:50701904-50701926 CCTAGATTAGGAAAGAAGGAAGG + Intronic
1138068250 16:53964385-53964407 CCTAGTTGAGGCCAGGAGGAAGG + Intronic
1139084516 16:63568308-63568330 CCTGTTTTAATGAAGGAGGAAGG - Intergenic
1139424627 16:66871866-66871888 CATGCTTTAGGAAAGCAGGAGGG + Intronic
1139958050 16:70702556-70702578 CCTACTGCTGGGAAGGAGGTGGG + Intronic
1140137628 16:72221630-72221652 CCTACTCTCGGGAAGGATGAAGG + Intergenic
1140219677 16:73034549-73034571 GCTAGTTTGGGGCAGGAGGAAGG - Intronic
1140317755 16:73915379-73915401 CCTCCTTTAGGAAGGGAGGCAGG + Intergenic
1140710327 16:77671632-77671654 GCTCCCTTAGGGAAGGAAGAGGG + Intergenic
1141890298 16:86922066-86922088 CCAATTCTGGGGAAGGAGGAAGG + Intergenic
1143431569 17:6891548-6891570 CATAGTTTAGGAAAGGAGGCTGG + Intronic
1145720782 17:27070509-27070531 CCTACTTGAGGGTGGGAGGTGGG + Intergenic
1147326338 17:39671533-39671555 CCTGATTTTGGGGAGGAGGAAGG - Exonic
1147801849 17:43096978-43097000 CCTACTTGAGGGAGGAAGGTGGG + Intronic
1147873632 17:43605313-43605335 CCTACCACAGGGGAGGAGGAGGG + Intergenic
1148435694 17:47682763-47682785 CCTGGTTTGGGGGAGGAGGAGGG + Exonic
1148463064 17:47849117-47849139 CCTGCTTGAGGGAAGGGGGTGGG - Intronic
1148756408 17:49975376-49975398 CTCACCTTGGGGAAGGAGGAGGG + Intergenic
1150598051 17:66624377-66624399 AGTACTTTGGGGAAGGAGTAGGG + Intronic
1153079224 18:1201591-1201613 CCAACTATAGGGAAGGAGCTTGG - Intergenic
1153126297 18:1796024-1796046 CCCAGGTTAGGGCAGGAGGAAGG + Intergenic
1153759675 18:8318406-8318428 CCTACTTTGGGGACTGAGGCAGG - Intronic
1154026552 18:10713038-10713060 CCTATTTTAGGGGAGCAGGCAGG + Intronic
1155073791 18:22338171-22338193 CCTGCTATAGGCAATGAGGAAGG + Intergenic
1155415797 18:25598000-25598022 CCTGCTCTAGAGAAGGAGGCAGG - Intergenic
1156340579 18:36206636-36206658 CCTACTTGAGGGTAGAAGGTGGG - Intronic
1156596569 18:38554495-38554517 CCTGCTTCAGGGAAGAAGGATGG - Intergenic
1156699513 18:39808771-39808793 CCTACTTGAGGGGGGGAGGGTGG - Intergenic
1157235900 18:45965290-45965312 CCTACTTGAGGGCAGAAGGTGGG + Intronic
1157374883 18:47153369-47153391 CCTGCTTTAGGGAGGGTGGGAGG - Intronic
1157826104 18:50813829-50813851 CCTACTTGAGGGTTGGAGGGTGG + Intronic
1158197130 18:54900586-54900608 CCTGCTTCAGGGCAGAAGGAGGG + Intergenic
1160073387 18:75648431-75648453 GCTCCCTTAGGTAAGGAGGAAGG + Intergenic
1161607778 19:5224368-5224390 CCTTATTAATGGAAGGAGGAGGG - Intronic
1162017290 19:7852451-7852473 CCTTCGTGGGGGAAGGAGGATGG - Intronic
1162744045 19:12789428-12789450 GCTACTCTAGGGAAGGAGGGGGG + Intronic
1164604538 19:29588104-29588126 CCTACAGCAGGGAAGGAGGGGGG - Intergenic
1166228353 19:41411176-41411198 CCTGCCTTAGGGCAGAAGGATGG + Intronic
1166377999 19:42338567-42338589 CCTACCTGAGGGTTGGAGGAGGG - Intronic
1166854586 19:45777265-45777287 CCAACTTTATGGAGGGAGCATGG + Intronic
1168379731 19:55909870-55909892 CTCAGTGTAGGGAAGGAGGAGGG - Intronic
1202684447 1_KI270712v1_random:36509-36531 CTTACAATAGGGAGGGAGGAAGG - Intergenic
925930774 2:8706118-8706140 AATAATTTAGGGAAGGAGGCGGG + Intergenic
926272992 2:11381332-11381354 TTTACTTTTGAGAAGGAGGAAGG - Intergenic
926739740 2:16101455-16101477 CCTGTTTTAGTGAAGAAGGAAGG - Intergenic
928932556 2:36639011-36639033 CCTACAAGAGGGTAGGAGGAGGG + Intronic
929611408 2:43273524-43273546 CCTACTGGAAGGCAGGAGGAAGG + Intronic
931127724 2:59296364-59296386 CCTTCTGTATGGAATGAGGAAGG - Intergenic
932063926 2:68533152-68533174 CTTACATGAGGGAAGGTGGAAGG - Intronic
932226965 2:70049186-70049208 CTTACTTGAGGGAGGGGGGAGGG - Intergenic
932382575 2:71298847-71298869 CCCTCCTTAGGGAGGGAGGAGGG - Intronic
933708533 2:85308751-85308773 CCAGCTTTAGGAAAGGAGGGTGG + Intronic
934247271 2:90318337-90318359 CTTACAATAGGGAGGGAGGAAGG + Intergenic
934262054 2:91484266-91484288 CTTACAATAGGGAGGGAGGAAGG - Intergenic
934305098 2:91815252-91815274 CTTATAATAGGGAAGGAGGAAGG - Intergenic
934328159 2:92037496-92037518 CTTATAATAGGGAAGGAGGAAGG + Intergenic
934466539 2:94268035-94268057 CTTATAATAGGGAAGGAGGAAGG + Intergenic
935594982 2:104871368-104871390 CCTATTTTGGGGAAGGAGTGCGG + Intergenic
936019131 2:108981352-108981374 CCAACTTCAGGGAAGAAGAAAGG + Intronic
936452438 2:112643848-112643870 CCTCCCTTAGGGGAGGACGAAGG + Intergenic
938590261 2:132729004-132729026 ACAAGTTTAGGGAAGGAGGTGGG + Intronic
938654086 2:133412941-133412963 CCTTCTGCAGGGAGGGAGGAAGG + Intronic
938665682 2:133533452-133533474 CAAACTTTAGAGAAAGAGGAAGG - Intronic
940547523 2:155107526-155107548 CCTACTTTAGGGTGGAGGGAGGG + Intergenic
940955668 2:159724829-159724851 CCTGTTTTAGGGTAGGGGGAGGG - Intronic
941996822 2:171608999-171609021 CAAACACTAGGGAAGGAGGAGGG + Intergenic
943679718 2:190755447-190755469 CCAAATTTAGGGAAGGCAGAGGG + Intergenic
943718407 2:191177293-191177315 GCTCATTTAGGGAAGTAGGAAGG + Intergenic
943994659 2:194745873-194745895 CCTGCCTTAGGAAAGGAGTAGGG + Intergenic
946710226 2:222497835-222497857 CCTACTTTAGAGAAGGTGGTTGG + Intronic
947104679 2:226656120-226656142 CCTTCTTTTGTGAAGGAGGTTGG - Intergenic
947778580 2:232735843-232735865 CCAACTTTGGGGAAAAAGGAAGG - Intronic
947975085 2:234358358-234358380 CCTACTTGAGGGTGGGAGGTTGG - Intergenic
948770286 2:240248259-240248281 CCACCTTCAGGGAAGGAGCAGGG - Intergenic
1169356479 20:4910775-4910797 CTTACTTTATGAAATGAGGAGGG - Intronic
1170247628 20:14240682-14240704 CCTACTTGAGGGCAGAAGGAGGG + Intronic
1170982014 20:21222943-21222965 CCAACTACAGGGAATGAGGAAGG + Intronic
1171067816 20:22036054-22036076 GCTACTTTAGGGCAGGTGGTAGG + Intergenic
1172942213 20:38661923-38661945 CCTACTATGGGGGAGGGGGAGGG + Intergenic
1172962145 20:38806676-38806698 TCTACATGGGGGAAGGAGGAGGG - Intronic
1173235879 20:41244923-41244945 CTTACTTCAGGGAGGGAGGAAGG + Intronic
1173559879 20:43995660-43995682 TCTACTTGAGGGTGGGAGGAGGG - Intronic
1173927237 20:46789858-46789880 CACACTCCAGGGAAGGAGGATGG - Intergenic
1175979740 20:62732243-62732265 CCTAAGATAGGGAAGGAGGCAGG - Intronic
1176934570 21:14851284-14851306 CCTACTTGAGGGTGGGAGGATGG - Intergenic
1178090221 21:29155239-29155261 CCTACTTTTGGGAAAGATGGGGG - Intronic
1179109677 21:38435573-38435595 ACTGCTTCAGGGAAGGGGGAGGG - Intronic
1180280444 22:10688669-10688691 CTTACAATAGGGAGGGAGGAAGG + Intergenic
1180694604 22:17743767-17743789 CCAGCTTTGGGGAAGGAGGTGGG + Intronic
1180765210 22:18342295-18342317 CCTACTGTAGGTAAAGAGAAGGG - Intergenic
1180813820 22:18777389-18777411 CCTACTGTAGGTAAAGAGAAGGG + Intergenic
1181200005 22:21211724-21211746 CCTACTGTAGGTAAAGAGAAGGG + Intronic
1181701730 22:24625235-24625257 CCTACTGTAGGTAAAGAGAAGGG - Intronic
1184430945 22:44441324-44441346 CCTCCTCAAGGGCAGGAGGAAGG + Intergenic
1203226830 22_KI270731v1_random:83200-83222 CCTACTGTAGGTAAAGAGAAGGG - Intergenic
1203263920 22_KI270734v1_random:3076-3098 CCTACTGTAGGTAAAGAGAAGGG + Intergenic
949152071 3:781369-781391 CCTACTTCAGGGGAGAAGGATGG - Intergenic
949312103 3:2711502-2711524 CCTACTTTTCTGAAGGAAGAAGG + Intronic
949599661 3:5584239-5584261 CCTTCTTTAGCCAAGGAGCAAGG - Intergenic
949935146 3:9110554-9110576 CCTCTTTTAGGGAAGCAGGAGGG - Intronic
950133552 3:10564431-10564453 CCCACTGTTGGGGAGGAGGATGG - Intronic
951696580 3:25451123-25451145 CCTAGATTAAGGAAGGTGGAAGG + Intronic
952015437 3:28951166-28951188 CCTGCTTCAGGGGAGAAGGAAGG + Intergenic
952547305 3:34434005-34434027 CCTACTTGAGGGAAGAAGTTTGG + Intergenic
952704237 3:36361093-36361115 CCTACTTTAGGGTAGAGGGTGGG + Intergenic
953052053 3:39353462-39353484 CCTGCTGTAGGGTGGGAGGAGGG + Intergenic
953545186 3:43859269-43859291 CCTTCTTTAAGGGAGGAGGGAGG - Intergenic
954518957 3:51206011-51206033 CCTATTTGAGTCAAGGAGGATGG - Intronic
955380350 3:58433563-58433585 CCTTCTCTCGGGAAGGAGGCCGG - Intronic
955715722 3:61827414-61827436 CATACTATAGGAAAGGTGGAAGG + Intronic
956001541 3:64734854-64734876 TCAACTTTAGGGAATGAGGAAGG - Intergenic
957535705 3:81500947-81500969 CCTACTTGAGGGTAGAAGGCTGG + Intronic
957655945 3:83075523-83075545 CCTACTATAGGGGAGAGGGAGGG + Intergenic
958807479 3:98829432-98829454 CCTACTGGAGGGTGGGAGGAGGG - Intronic
959035184 3:101354405-101354427 CCTACTTGAAGGTGGGAGGAGGG - Intronic
959071017 3:101702049-101702071 CCAGCTTGGGGGAAGGAGGAGGG + Intergenic
959188121 3:103073335-103073357 CCTACTTGAGGGTGGAAGGAGGG - Intergenic
959510467 3:107205199-107205221 CCTACTTGAGGGTAGGAGAAGGG + Intergenic
959847107 3:111046133-111046155 CTTGCTTCAGGGAAGGAGGGTGG - Intergenic
959847133 3:111046309-111046331 CTTGCTTCAGGGAAGGAGGGTGG - Intergenic
959881920 3:111453671-111453693 CCTACTTTAGGGTAGAGGGTGGG + Intronic
961160143 3:124717236-124717258 CCTACTTTCAGGATGGATGATGG + Intronic
961944896 3:130675754-130675776 ACTAAATTAGGAAAGGAGGATGG - Exonic
963581486 3:147131302-147131324 ACTAGATTGGGGAAGGAGGAAGG - Intergenic
965085973 3:164098854-164098876 CCTACTGTAGGGGAGGTGGAGGG - Intergenic
965867500 3:173222899-173222921 TCTGCTTTAGGGGAGGAGGGTGG + Intergenic
966223241 3:177570972-177570994 CCTGTTTTGGGGAAGGAAGATGG + Intergenic
966356306 3:179082997-179083019 CCTACTATAGGGAAGGCAGCTGG + Intergenic
966623626 3:181993055-181993077 CCTACTTGTGGCAAGGGGGAGGG + Intergenic
967243419 3:187463754-187463776 CCCACTTGAGGCAATGAGGAAGG - Intergenic
967688536 3:192445811-192445833 GCCACTTTAGGGAAGGTGGGAGG - Intronic
968895789 4:3402405-3402427 CAGGCTTCAGGGAAGGAGGAAGG - Intronic
968982259 4:3856688-3856710 GCTGCTTTAGGGAAGGCGAAGGG - Intergenic
969692919 4:8715832-8715854 CCTACATTAGAGAAGGAAAATGG + Intergenic
970322494 4:14888579-14888601 CCTCCTCTAGAGAATGAGGATGG - Intergenic
970628836 4:17919780-17919802 CCTACTTCAGGGCAGGTGAAAGG - Intronic
971153204 4:24055811-24055833 GCTACTGTAGGGAAGTAGGAGGG - Intergenic
971954303 4:33396054-33396076 TCTGCTTGAGGAAAGGAGGAAGG + Intergenic
972960638 4:44448387-44448409 ACTACTTCAGGGAAGGGCGAGGG + Exonic
974177852 4:58346565-58346587 TCTGCTTTTGGGAAGGAAGATGG + Intergenic
974514243 4:62887797-62887819 CTTACTTGAGGGAAGAAGGTGGG + Intergenic
974609906 4:64204142-64204164 TCAGCATTAGGGAAGGAGGAGGG - Intergenic
976011896 4:80499087-80499109 CCTACTTGAGGGTGGGAAGAGGG + Intronic
976297525 4:83486912-83486934 CCTACTTCAGGGAAGGACACCGG + Intronic
976481323 4:85549758-85549780 CCTACTTGAGGGTAGAGGGAGGG - Intronic
978346731 4:107777905-107777927 CATATTTTATGGAAGAAGGAAGG + Intergenic
978400900 4:108329645-108329667 ACTACTAGAGGGAGGGAGGAGGG + Intergenic
979834739 4:125350770-125350792 CTTACTGTAGAGAATGAGGAGGG - Intronic
980312742 4:131154538-131154560 CCTACCTTAGGGCAGGTGAAAGG + Intergenic
980698047 4:136385683-136385705 ACTACTTCAGGGGATGAGGAAGG + Intergenic
980840250 4:138250774-138250796 ACTACTTTAGAGAAGAGGGACGG + Intergenic
981564893 4:146089900-146089922 GCTGATTTAGAGAAGGAGGAAGG + Intergenic
982415939 4:155132022-155132044 CCTACTTTAGGGTAGCGGGAAGG + Intergenic
983508411 4:168580963-168580985 CCTACTGGAGGGAAGAAGGTTGG + Intronic
984746305 4:183222585-183222607 CCTAATTTGGGGATGTAGGAGGG + Intronic
986144485 5:5064608-5064630 CCCACATTAGGGAATGAGCATGG - Intergenic
987183018 5:15386252-15386274 CCAGCTCTGGGGAAGGAGGAGGG - Intergenic
989013457 5:36901093-36901115 CCTACTTGAGGGTGGGAGAAGGG - Intronic
989415226 5:41167388-41167410 CCTACTTTTGAGAAGGAAAATGG - Intronic
990106554 5:52270610-52270632 TCTACTTGAGGGTGGGAGGAGGG + Intergenic
990334867 5:54762698-54762720 CCAACTTTGGAGATGGAGGAAGG - Intergenic
990356753 5:54975248-54975270 CTTATTTTAGAGAAGGAGGCAGG - Intergenic
990433921 5:55768280-55768302 CCTACTTTAGGGTAGAAAGTGGG - Intronic
991076780 5:62548665-62548687 TATACTTTTGGGAAGGAGAAAGG - Intronic
991459006 5:66836786-66836808 CCTACTTGAGGTTGGGAGGAGGG + Intronic
992411125 5:76506229-76506251 GCTACTTGAGGGCAGGACGAAGG + Intronic
992716416 5:79514654-79514676 GCTAAATTAGGGAAGGAGCAGGG + Intergenic
993225723 5:85165779-85165801 CTTACATCAGGGAAGGAAGAAGG - Intergenic
993715232 5:91269603-91269625 GCTACTTTAGGGACTGAGGTGGG - Intergenic
993747869 5:91624111-91624133 ACTACTTGAGGGAAGAAGGAAGG + Intergenic
993774852 5:91980660-91980682 GCAGCATTAGGGAAGGAGGAGGG - Intergenic
995381830 5:111543838-111543860 TCAAATTTAGGGAGGGAGGAAGG - Intergenic
995523301 5:113031152-113031174 CCTGCTTTTGGGAGAGAGGATGG + Intronic
997188573 5:131906857-131906879 CCTACTTGAGGGTGAGAGGAGGG + Intronic
997805952 5:136918028-136918050 CATGGTCTAGGGAAGGAGGAAGG - Intergenic
998026954 5:138825577-138825599 CCTACTTTATGAAAGGATGCTGG - Intronic
998395011 5:141812611-141812633 GCTTCTCTAGGGAAGAAGGAAGG + Intergenic
998938949 5:147260403-147260425 GCTCCCTTAGGGAAAGAGGAAGG - Intronic
999254362 5:150201855-150201877 CCTACTTCATGGGAGGAGGGTGG - Intronic
1000012855 5:157249057-157249079 CTTTCTCTAGGGAAGGAGGGAGG - Intronic
1000645611 5:163757078-163757100 CCCACCTGTGGGAAGGAGGAAGG + Intergenic
1001099424 5:168801956-168801978 CCAACTTTAGGGGAAGGGGAGGG - Intronic
1006341460 6:33449314-33449336 CCAAGATTAGGGAAGGAAGAGGG - Intronic
1006422095 6:33941359-33941381 CATTCTCAAGGGAAGGAGGAAGG - Intergenic
1007546811 6:42700657-42700679 CCTCCTTCAGGAAAGCAGGAGGG - Intronic
1007967799 6:46018065-46018087 CATACTTTAGGGAAGGACCAAGG + Intronic
1009871299 6:69454991-69455013 CCTACTTGTGGGTGGGAGGAGGG + Intergenic
1011385171 6:86788673-86788695 CCTACTTCAGGGAAGAAGGCAGG + Intergenic
1013671356 6:112406878-112406900 CCTCCATTAGGGATGGAGAACGG + Intergenic
1016806987 6:148221597-148221619 GCTACTTTAAGGCAGGAGGAAGG + Intergenic
1017099162 6:150832221-150832243 CTTACTTTGGAGAAGGAAGAAGG - Intronic
1017698865 6:157048099-157048121 CCAAATTTAAGGCAGGAGGAGGG - Intronic
1017929857 6:158942363-158942385 CCTACTTGAGGGTAGAAGGTGGG - Intergenic
1018019468 6:159746061-159746083 TGTATTTTGGGGAAGGAGGAGGG - Intronic
1018047176 6:159975527-159975549 CCTACCTTGGGGCAGGTGGAAGG + Intronic
1018826578 6:167412290-167412312 CCTGCTTCAGGGAAGAAGGATGG - Intergenic
1019883820 7:3886150-3886172 CCTACGTCAGGGATGAAGGATGG + Intronic
1020436426 7:8167465-8167487 CCTACTTGCGGGTAGGTGGAGGG + Intronic
1020901456 7:14008512-14008534 GCTACTTTTTGGAATGAGGAAGG + Intergenic
1021380767 7:19963210-19963232 CCTACTTTAAGGATGAAGAAGGG + Intergenic
1021650229 7:22825869-22825891 CCTACTTGAGGGTGGGAAGAGGG - Intergenic
1021817104 7:24457921-24457943 CTTCCATAAGGGAAGGAGGAAGG + Intergenic
1023601312 7:41884220-41884242 CCTCCTTTTGGGGAGGAGCATGG + Intergenic
1024709038 7:51995295-51995317 TGTACTCTGGGGAAGGAGGAAGG + Intergenic
1025908869 7:65811387-65811409 CCTACGTGAGGGAAGGAGGCTGG - Intergenic
1027799398 7:82732976-82732998 TCTACTTTAGGAAAGGAGAGAGG + Intergenic
1028202280 7:87975831-87975853 CCTACAATAAGGATGGAGGAGGG + Intronic
1029162633 7:98563460-98563482 CCTGCTGTAGGGGAGGAGCATGG + Intergenic
1029439283 7:100578309-100578331 CCTGCTTTCTGGCAGGAGGATGG - Intronic
1031647743 7:124247467-124247489 CCTACTTGAGGGTAGAGGGAAGG - Intergenic
1032625005 7:133582125-133582147 CCTACTTGAGGGTAGAGGGAGGG - Intronic
1032953375 7:136942372-136942394 ACTTCCTAAGGGAAGGAGGAGGG - Intronic
1033709140 7:143921118-143921140 TCTACTTGAGGGTAGGAGGAGGG - Intergenic
1034206592 7:149321413-149321435 CCTGGTTTCGGGGAGGAGGAGGG - Intergenic
1035490681 7:159274229-159274251 CCTACTTGAGGATGGGAGGAAGG + Intergenic
1036055476 8:5248163-5248185 CATAAATTAGGGAAGGAGAATGG + Intergenic
1038317503 8:26500217-26500239 CCTACTTGAGGGTGGGAGGAGGG + Intronic
1038906113 8:31904865-31904887 CCTACTGGAGGGTGGGAGGAAGG + Intronic
1038916307 8:32027473-32027495 CCTAGATTAGGGAGGGAGGGAGG - Intronic
1038988646 8:32841596-32841618 CCTACTTGAGGGTGGGAGGAGGG - Intergenic
1039176460 8:34813129-34813151 CCTAATTTAGGGAAGAAGGAAGG + Intergenic
1039609188 8:38905531-38905553 CTTGATTTAGGGAAGGAGGAGGG - Intronic
1040587637 8:48758042-48758064 CCAACTTTAGGAAAGGAAGAGGG - Intergenic
1041005450 8:53493353-53493375 CCTACAGCAGGGAAGGAGGGAGG - Intergenic
1042939906 8:74096988-74097010 CCTACTTGAGTGACGGAGGTGGG + Intergenic
1043978954 8:86615837-86615859 GCCACCTTAGGGAGGGAGGAAGG + Intronic
1045636743 8:104199925-104199947 CCTACTTGGGGAAAGGAGGTAGG + Intronic
1045881848 8:107050313-107050335 ACCACTTAAGGGAAGAAGGATGG - Intergenic
1047022328 8:120787799-120787821 CCTATTTGAGGGAATGATGAAGG + Intronic
1047174219 8:122525129-122525151 CCTATTGCAGGGCAGGAGGAAGG + Intergenic
1047344538 8:124014278-124014300 CCGACCTTAGGGAAAGATGAGGG + Intronic
1048290102 8:133174759-133174781 GCTACCTTAGGGAAGGGGCATGG - Intergenic
1048640737 8:136357667-136357689 CCTACTTAAGGGTGGGAGGTGGG - Intergenic
1048761936 8:137804898-137804920 TCTACTGAAGGAAAGGAGGAAGG + Intergenic
1048818312 8:138355008-138355030 CCTGCTGTAGGGTGGGAGGAAGG - Intronic
1048929335 8:139298710-139298732 CCTACTGGAGGGTGGGAGGAGGG - Intergenic
1049231385 8:141486024-141486046 CCTACATTAGGAAAGAAGAAAGG - Intergenic
1049644126 8:143728484-143728506 GCTCGTTTAGGGAAGGAGAAGGG + Exonic
1050063931 9:1738850-1738872 CCTAATTTGGAGAAGGAGGAGGG - Intergenic
1050250139 9:3734996-3735018 CCTACTTTGGGAAAGGAGTTAGG - Intergenic
1051200066 9:14607533-14607555 GCTACTTTTGGGGAGGAGGGTGG + Intergenic
1051323836 9:15942440-15942462 CTTTCTTAAGGGAAGGAGAAAGG + Intronic
1051564996 9:18487484-18487506 TCAATTTCAGGGAAGGAGGAAGG - Intronic
1051738242 9:20225383-20225405 ACTACTTTTGGGGAGGAGGAAGG + Intergenic
1052360797 9:27554479-27554501 CCTACTTGAGGGTGGGAGAAGGG + Intronic
1052393541 9:27909783-27909805 TCTACTTGAGGGTGGGAGGAGGG + Intergenic
1053061200 9:35033376-35033398 ATTACTTTTGGGAAGGATGAAGG + Intergenic
1053696587 9:40644806-40644828 CTTATAATAGGGAAGGAGGAAGG + Intergenic
1053943009 9:43275016-43275038 CTTATAATAGGGAAGGAGGAAGG + Intergenic
1054307837 9:63444034-63444056 CTTATAATAGGGAAGGAGGAAGG + Intergenic
1055015936 9:71618195-71618217 CCTACTTGAGGGTGGGAGGAGGG + Intergenic
1055348561 9:75361621-75361643 CCGAATTTAGGAAAAGAGGAAGG + Intergenic
1056748052 9:89322024-89322046 CCTTCTTTAAGGAAAGATGAGGG - Intronic
1056750063 9:89343493-89343515 CCTACTTGAGGGTGGGAGGAAGG - Intronic
1057023709 9:91720025-91720047 ACTACTTTGGGGAATGATGAGGG + Intronic
1057310771 9:93941719-93941741 CCTACTCTGGGGCTGGAGGAGGG - Intergenic
1057689264 9:97268786-97268808 TCAACCTTGGGGAAGGAGGAGGG - Intergenic
1057721130 9:97532759-97532781 CCTACATGAAGGAAGGAAGATGG + Intronic
1058172635 9:101701365-101701387 CCTACTGGAGGGTGGGAGGAGGG - Intronic
1058815589 9:108680216-108680238 CCTAGTTACGGGAAGAAGGAGGG - Intergenic
1058833475 9:108839914-108839936 TCTACTTGAGGGTGGGAGGAGGG + Intergenic
1059157270 9:112001302-112001324 CCTCCTTGAGTGAAGCAGGACGG - Intergenic
1059500666 9:114750818-114750840 CCTACTGGAGGGAAGGAGGCGGG - Intergenic
1059568977 9:115414000-115414022 GTTACTTTAGGAAAGAAGGAAGG + Intergenic
1060358532 9:122932639-122932661 GCTACTTTAGAGACGGAGGCAGG - Intergenic
1061670580 9:132185968-132185990 CCTGGTGTGGGGAAGGAGGAGGG + Intronic
1062360516 9:136185868-136185890 CCTGCCTCAGGGTAGGAGGAGGG + Intergenic
1202779037 9_KI270717v1_random:18466-18488 CTTATAATAGGGAAGGAGGAAGG + Intergenic
1203586106 Un_KI270747v1:4875-4897 CTTATAATAGGGAAGGAGGAAGG + Intergenic
1186497422 X:10022711-10022733 CTTACTAGAGGGAGGGAGGAGGG + Intronic
1186662541 X:11683595-11683617 CCTACTTGAGGGTGGGAGGAGGG + Intergenic
1187058156 X:15760395-15760417 TCTAGTTTAGTAAAGGAGGAGGG + Intronic
1187282127 X:17865429-17865451 CCAGGTTTAGGGAAAGAGGATGG + Intergenic
1187504772 X:19870257-19870279 CTTCCTCTAGGGAAAGAGGAGGG + Intronic
1188679128 X:32979896-32979918 CGTAATTTAGGGAGGGAGGTTGG + Intronic
1190427441 X:50346213-50346235 CCTAGTGTAGGGAATGAGTAAGG - Intronic
1190532106 X:51388917-51388939 CCTACTTGAGGGAGGAAGGTGGG + Intergenic
1191020428 X:55854154-55854176 CCTACTTAAGGGTGGAAGGAAGG - Intergenic
1191044633 X:56122505-56122527 CCTACTTTAAGGAGAGATGAAGG + Intergenic
1191072221 X:56412504-56412526 CCTACTTTAGGGAAGAGGATGGG - Intergenic
1192722319 X:73712055-73712077 TCAACTAAAGGGAAGGAGGATGG + Intergenic
1193275655 X:79584308-79584330 CCTAGTTAAGGGTAGAAGGAGGG - Intergenic
1193285470 X:79709328-79709350 CCTATTGAAGGGTAGGAGGAGGG + Intergenic
1195576353 X:106455701-106455723 CCTACTTGAGGGTGGGAGGTGGG + Intergenic
1196015711 X:110938186-110938208 CCTACTTTAGAGACTGAGGTGGG + Intergenic
1196098330 X:111823346-111823368 CCATCTTCAGGGAAGGAGGGAGG - Intronic
1196870174 X:120105837-120105859 CCTACTGAAGGGTAGGAGGAGGG + Intergenic
1198622800 X:138533232-138533254 CCAAAATTAGGGAAGGAGAAAGG + Intergenic
1201075230 Y:10181636-10181658 CCTACTTGAGGGAGGAAGGGTGG + Intergenic
1202591088 Y:26484031-26484053 CCTACTTGAGGGTTGGAGGCTGG - Intergenic