ID: 906810009

View in Genome Browser
Species Human (GRCh38)
Location 1:48817098-48817120
Sequence ACTGGGAAAAAAAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 933
Summary {0: 1, 1: 0, 2: 2, 3: 79, 4: 851}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906810004_906810009 29 Left 906810004 1:48817046-48817068 CCATTCTAGGAACTGTAAATACT 0: 1
1: 0
2: 2
3: 18
4: 233
Right 906810009 1:48817098-48817120 ACTGGGAAAAAAAATGAGGAGGG 0: 1
1: 0
2: 2
3: 79
4: 851

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906810009 Original CRISPR ACTGGGAAAAAAAATGAGGA GGG Intronic
900630414 1:3632123-3632145 ACTGGAAAAGAAAATGAAGTTGG - Intronic
900868152 1:5283260-5283282 ACAGGGTAAATAAATGAGGATGG + Intergenic
901161859 1:7183638-7183660 ACTGTGAAAAAGAAAGAGGATGG + Intronic
901347828 1:8562739-8562761 TCTGGGCAAAAAAAAGGGGAGGG + Intronic
902059412 1:13629637-13629659 AGTGGGAAAAAACAGGAGGTGGG - Intergenic
902415319 1:16235465-16235487 ACTGGGGAAATTAATAAGGAGGG - Intronic
902610302 1:17593199-17593221 ACTGGGATAAAAAACGAGTGAGG - Intronic
903118186 1:21195445-21195467 TCTGGGAAAAAAAATGGAAATGG + Intergenic
904105548 1:28079064-28079086 CTGGGGAAAAAAAATGAGAATGG - Intronic
904196338 1:28788554-28788576 ACTGGGTCAGACAATGAGGAAGG - Intergenic
905093789 1:35451346-35451368 ACTGAGAAATAAAGTAAGGAGGG + Intronic
905203514 1:36329701-36329723 AATGAAAAAAAAAATGAGTAAGG + Intergenic
905204520 1:36335597-36335619 ACTGGGAAAACAAAACAGTAGGG + Intergenic
905240858 1:36580667-36580689 ATTGGGAAGGACAATGAGGAGGG + Intergenic
905506666 1:38485315-38485337 AGTGGGAAAGAAAAGGATGAGGG + Intergenic
906467874 1:46100573-46100595 ACTGTCAAGAAAAATTAGGAAGG - Intronic
906506726 1:46385763-46385785 ACTGAAAAAAAAAATGTGGGGGG - Intergenic
906672763 1:47668669-47668691 ACTGATAAAAAATCTGAGGATGG + Intergenic
906810009 1:48817098-48817120 ACTGGGAAAAAAAATGAGGAGGG + Intronic
906825398 1:48974057-48974079 GCTGTGAGAGAAAATGAGGAGGG + Intronic
907053949 1:51347932-51347954 ACTCTGAAAAAAAAAGATGATGG - Intergenic
908106498 1:60848557-60848579 CCTGGGAAAAAACAGGAGGGTGG + Intergenic
908133045 1:61096141-61096163 AATAGGAAAAAAATTGAAGATGG + Intronic
908139227 1:61166414-61166436 ACAGGGAAAAGAAATGAGTATGG - Intronic
909605746 1:77506528-77506550 ACATGGACAGAAAATGAGGAAGG - Intronic
909665141 1:78123664-78123686 ACTGGCAAACAGAATGTGGATGG + Intronic
909988819 1:82196225-82196247 TATGGAAACAAAAATGAGGATGG + Intergenic
910178931 1:84460401-84460423 ATGGGGAAAAAAAATTAGCAGGG + Intergenic
910499615 1:87875025-87875047 ACTTGAAAAAAAAAGGAGGAAGG - Intergenic
910554814 1:88519607-88519629 GGTGGGAAAAAAAATCAGGGAGG + Intergenic
911013336 1:93305064-93305086 ACTGAGAAAAAAAATGACAGAGG - Intergenic
911065048 1:93780524-93780546 ACTGGAAAAGAAAATGGAGATGG + Intronic
911395957 1:97310321-97310343 AATGGGAAAGAAAATTAAGAAGG - Intronic
912228399 1:107762907-107762929 AATGGAAAATAAAATGAGGTAGG + Intronic
912708318 1:111931251-111931273 ACTGGGAGAAGAGATGAGGAGGG + Intronic
912781234 1:112550297-112550319 ACTCAGAAAATAAATGAGGAAGG - Intronic
912836899 1:113004700-113004722 ACTGGGAAGAAATTTCAGGAGGG + Intergenic
912992429 1:114501928-114501950 AGTGGGAAAAAGAACAAGGATGG - Intronic
913081565 1:115392773-115392795 AGTGGGAAAATAAATAAGTATGG + Intergenic
913431225 1:118793609-118793631 ACTGGAAAAAAAAATGAACAAGG + Intergenic
914685019 1:149970822-149970844 ACTGTGAAAGAAATAGAGGAAGG - Intronic
914766122 1:150639373-150639395 ACTGGGAAAAGGTATGAGGGGGG + Intergenic
915151725 1:153838498-153838520 AGGGGGAAAAAAAAAGAGGCAGG - Intronic
915770542 1:158417860-158417882 ACATGGAAAAAATAAGAGGAAGG + Intergenic
915916462 1:159943707-159943729 ACTGGGAAGAGAAAGGAGGGAGG + Intronic
916744929 1:167677868-167677890 AGTGGGAAAAATTATGAGGGGGG + Intronic
916971175 1:170018194-170018216 GCTGGTAAAAAAAATGAGCATGG - Intronic
917628303 1:176867989-176868011 AATGAGAAAGAAAATGAAGAAGG - Intronic
917832015 1:178901107-178901129 AATGGGAAAAAGAATGAACATGG - Intronic
918065793 1:181100844-181100866 ACTGGGTACAAAGATGAGTAAGG + Intergenic
918136860 1:181681458-181681480 ACTGGAAATAAACAGGAGGATGG - Intronic
918595410 1:186287208-186287230 AAGGGGAAAAAAGATGAAGATGG - Intergenic
918728072 1:187950939-187950961 AGTTGAATAAAAAATGAGGAAGG + Intergenic
919180334 1:194072150-194072172 AATGGGAAACAAAATGTGGGTGG + Intergenic
919676778 1:200391740-200391762 TTGGGGAAACAAAATGAGGAAGG + Intergenic
920256544 1:204659114-204659136 ACTGAGAAATGTAATGAGGATGG - Intronic
920387397 1:205578685-205578707 ACACTGAAAAAAAAAGAGGAGGG - Intronic
921326477 1:213989570-213989592 ACTGGGAAGACTAGTGAGGAGGG + Intronic
921591801 1:217012749-217012771 ACTCAGAAAAAAAAGGAGCAGGG - Intronic
921784408 1:219211360-219211382 AATGGGAAAAAAAAGGCAGAGGG - Intronic
922230432 1:223680982-223681004 AGTGGGAAACGAAGTGAGGAAGG + Intergenic
922982742 1:229841624-229841646 AATAGAAAAAAAAAAGAGGATGG - Intergenic
923514675 1:234684989-234685011 CCTAGGGAAAAAAATGAAGATGG + Intergenic
923802607 1:237225177-237225199 ACTTGGGAAATAAAAGAGGAAGG + Intronic
923845175 1:237722203-237722225 ACTGGAAAACAAAATGGGTAAGG - Intronic
923993268 1:239463831-239463853 GCGGGGAGAAAAAATGGGGAGGG - Intronic
924054127 1:240108376-240108398 AATAAGAAAAAAAATAAGGAGGG - Intronic
1063196744 10:3750300-3750322 ACTGGGAAAAAAAGAAAGGCAGG - Intergenic
1063286119 10:4690482-4690504 AAAGGGAAGAAAAATGAGGCAGG + Intergenic
1063490616 10:6460453-6460475 AGTAGGAATAAAAATTAGGAGGG - Intronic
1063580984 10:7306735-7306757 AGGGGGGAAAAAAAAGAGGAAGG + Intronic
1063905859 10:10779481-10779503 GAAGGGAAAAAAAAAGAGGAAGG - Intergenic
1064447276 10:15406932-15406954 AATGGGGAAATAAATGAGGGAGG + Intergenic
1064576260 10:16748857-16748879 TCTGGGAAAAAAATGGAGCATGG - Intronic
1064583000 10:16812707-16812729 ACTTGGAAAAAAAATGATAAAGG + Intronic
1064849869 10:19698576-19698598 CCTGGGAGAAGAAATGGGGAAGG + Intronic
1065038651 10:21666743-21666765 ACTGTGAAAAGAGATAAGGAAGG - Intronic
1065246979 10:23768322-23768344 ACTGGGAGGAAACATGAGCAGGG + Intronic
1065681353 10:28236564-28236586 ACGGAGAAAAAAAATGAGATCGG + Intronic
1065982973 10:30920565-30920587 ACTGCCAAGTAAAATGAGGATGG - Intronic
1066533769 10:36367986-36368008 ACTGGAAATAAAGATGAAGAAGG + Intergenic
1066571424 10:36777140-36777162 AACGGGAAAAAAAAAAAGGAAGG - Intergenic
1066635139 10:37492446-37492468 ACTGGGAAACAAGATGAGAAAGG + Intergenic
1067267932 10:44763350-44763372 AATGGGGAAAGAAAGGAGGAAGG + Intergenic
1067403981 10:46003796-46003818 ACTGGGACAAAAAATGCCAAGGG - Intergenic
1067484248 10:46632144-46632166 AGTGAGAAAAAAAATGAGACAGG - Intergenic
1067580141 10:47439606-47439628 ACTGGGAACAAATGTTAGGAGGG - Intergenic
1067736189 10:48852791-48852813 ACAGGGGAAGAAAATAAGGATGG - Intronic
1067850110 10:49749351-49749373 GCTGGGCAAACAAATGAGCAAGG + Intronic
1068329895 10:55549534-55549556 ACAGGGAAAGATAATGAGGGAGG + Intronic
1068899663 10:62253431-62253453 AATGGGTCAAAAAATAAGGAAGG + Intronic
1069114070 10:64482674-64482696 GATGGGCAAAAAAATGGGGAGGG + Intergenic
1070498328 10:77045804-77045826 ACTGGGAACAGAAATCATGATGG - Intronic
1070729660 10:78817626-78817648 ACTGGGGAATGAAAAGAGGAAGG + Intergenic
1070917342 10:80163439-80163461 AAAGGGAAAATAAATGGGGAAGG - Intronic
1070964767 10:80523147-80523169 AGTGGGATAAAGCATGAGGAGGG - Exonic
1070965976 10:80530687-80530709 ACTGGCAAAAATCATGGGGAGGG - Exonic
1071047511 10:81400184-81400206 AGTGGGAAGAAAAGGGAGGAAGG + Intergenic
1071455960 10:85851881-85851903 AGGGAGAAAAAAATTGAGGATGG - Intronic
1071625921 10:87169761-87169783 AGTGAGAAAAAAAATGAGACAGG + Intronic
1071768923 10:88702890-88702912 AATTGGAAAACAACTGAGGAAGG - Intergenic
1072012121 10:91311342-91311364 ACTGGGAGAAAATATGAGGAAGG + Intergenic
1072141808 10:92595533-92595555 ATTGGGAAAAAAATAGGGGATGG - Intronic
1072496783 10:95969510-95969532 ACTTGAAAAAAAAATTAGGAGGG + Intronic
1072573042 10:96675219-96675241 CCTGGGAAGGAAAATGGGGAGGG + Intronic
1073192066 10:101658568-101658590 AATGAAAAAGAAAATGAGGAAGG + Intronic
1073279103 10:102339024-102339046 ATTGGAAAAAAAAATGAAGTTGG + Intronic
1073429106 10:103474753-103474775 ACTGGATAAAAAGATGAGGGGGG - Intronic
1073645710 10:105300745-105300767 GCTGAGAAAAAAAATTAAGACGG + Intergenic
1073676458 10:105652457-105652479 ACTAGGAAAATAAATGAGTATGG - Intergenic
1074091205 10:110257890-110257912 TCTGGAAAAAAAAATAAGGGGGG + Intronic
1074257760 10:111820215-111820237 TGTGGGAAAAAAAAGCAGGATGG - Intergenic
1074748453 10:116559217-116559239 CCTGGGAAAACAAATGATGTGGG + Exonic
1074852417 10:117449390-117449412 ACTTGGAAAAAAGATGAGGTGGG + Intergenic
1075033232 10:119041269-119041291 ACTAAGAAAAAAAATGAGGCTGG + Intronic
1075058129 10:119235262-119235284 ACTAGGGAAACAAATCAGGAGGG + Intronic
1076043822 10:127274767-127274789 AATGGGAAAAAAAATAAACAGGG - Intronic
1076141760 10:128084983-128085005 ACAGGAAAAAAACATGAGCAGGG - Exonic
1076456561 10:130604005-130604027 ATTGGGAAAAATATTCAGGAAGG - Intergenic
1076582664 10:131523141-131523163 TCAGGGAAAAAAAAAGAGAAAGG - Intergenic
1077346040 11:2054489-2054511 AATGCGTAAAAAAATGAGAATGG - Intergenic
1077510345 11:2956892-2956914 GCTTTGAAAAAAATTGAGGATGG - Intronic
1077802629 11:5556359-5556381 ACTGAGAGAAAAGAAGAGGAAGG + Intronic
1077811852 11:5646154-5646176 TCTGGGAAGAAACATGAGGGTGG - Intergenic
1077826314 11:5812192-5812214 ACTTTGAGAAGAAATGAGGAGGG + Intronic
1077991759 11:7418348-7418370 AATAGGAAAAAAAATGAGAACGG - Intronic
1078164879 11:8873873-8873895 ACTAGCAACAAAAAAGAGGAAGG + Intronic
1078167016 11:8895955-8895977 AATTGGAAAAAAAATGTGGAGGG + Intronic
1078323426 11:10357895-10357917 ACAGGGTAGAAAATTGAGGAAGG - Intronic
1078747007 11:14125402-14125424 ACTAAGAAATAAAAGGAGGAGGG + Intronic
1078837856 11:15048943-15048965 AGTGGGAAAGAAAGGGAGGAAGG + Intronic
1078853615 11:15188009-15188031 TCTGAGAAAGAAAAGGAGGAAGG + Intronic
1079645149 11:22853648-22853670 ATTGGAAAAAAAAAGAAGGAAGG + Intronic
1080529158 11:33157481-33157503 ACTGGCAAAAACAATAAGCAAGG + Intronic
1081057942 11:38433892-38433914 AGTAGGAAAAAAGATGAGGGAGG + Intergenic
1081168550 11:39837465-39837487 AGTTGGAAAAAAAAAGAGGAAGG + Intergenic
1081459708 11:43260905-43260927 ACTGGCACAAAAAGTGTGGAGGG + Intergenic
1081491966 11:43576279-43576301 GCAGGAAAAAAAAGTGAGGAGGG + Intronic
1082953373 11:58842257-58842279 AGTCAGAAAAAAAATTAGGATGG + Intronic
1083165174 11:60880364-60880386 ACTGGGAAAACAAAGGAAAATGG - Intergenic
1083323427 11:61861504-61861526 ATATGGAAACAAAATGAGGATGG - Intronic
1083771670 11:64871069-64871091 AAGGGGAAAAAAAGTCAGGAGGG + Intronic
1084036748 11:66515942-66515964 ACAGGGAAATAAAAAGAGAAGGG - Intronic
1084767232 11:71320503-71320525 ACTGGGACAAAGCATGAGGCAGG - Intergenic
1085007871 11:73111458-73111480 ACTGAAAAAAAAAAAAAGGATGG - Intronic
1085065798 11:73494624-73494646 ATTGGGGAAAAAATGGAGGATGG + Intronic
1085076246 11:73595499-73595521 AGACTGAAAAAAAATGAGGAGGG - Intronic
1085240721 11:75051833-75051855 TCCAGAAAAAAAAATGAGGAGGG - Intergenic
1085637333 11:78168839-78168861 ACTAGGAAAACAAGTGGGGAGGG + Intergenic
1085857059 11:80187197-80187219 ACAAGGAAAAAAAAAGTGGAGGG - Intergenic
1085893533 11:80609546-80609568 AGTGGGAAAAGAAAAAAGGAAGG - Intergenic
1086322617 11:85666044-85666066 AAAGGAAAAAAAAATGAGGATGG - Intronic
1086371126 11:86156680-86156702 TCTGGGTAACAAAAGGAGGAGGG + Intergenic
1086494932 11:87393011-87393033 ATTGGGAGAAAAAAACAGGATGG - Intergenic
1086836319 11:91628009-91628031 ACAGAGGAAAAAAATGATGATGG - Intergenic
1087301106 11:96436945-96436967 TCTGGAACAGAAAATGAGGATGG + Intronic
1087417955 11:97882839-97882861 ACAGGGAAAGAAGATGAGAAGGG + Intergenic
1087433764 11:98086570-98086592 ACTGTGTAAGAAAATGAGTAAGG + Intergenic
1087455550 11:98381427-98381449 AGTTTGAAAAAAAATGAGTAAGG + Intergenic
1088431351 11:109762703-109762725 AATGGGAATAAAAAAAAGGAAGG - Intergenic
1088762146 11:112941835-112941857 ACTGGGAAATAGAATCAGCAGGG - Intergenic
1089105733 11:116002410-116002432 CCTGAGCAAAAAAATGGGGATGG - Intergenic
1089248409 11:117138851-117138873 AAGGGGAAAAAAAAAGAGGATGG - Intergenic
1089356924 11:117860046-117860068 ACAGGGAAAGAAACTGAGGTAGG + Intronic
1090284082 11:125483998-125484020 AATGTGAAAGAGAATGAGGATGG - Intronic
1090604690 11:128409169-128409191 AATGGCAGAAAAAATTAGGAGGG - Intergenic
1091164878 11:133466639-133466661 ACTGAGAAAAAAGATGTGGCTGG - Intronic
1091232486 11:133997830-133997852 ACTGGGAAATGAGATGAGGTGGG - Intergenic
1091535383 12:1403200-1403222 AGGGGGAAAAAAAAGGAAGAAGG - Intronic
1091578599 12:1764243-1764265 AATGGGATAAAAAATGAGTGAGG + Intronic
1091955481 12:4638203-4638225 GCAGGGGAAAAAAATGAGAAAGG + Intronic
1092094814 12:5832724-5832746 ACTGGGAGAAACAAGAAGGAGGG + Intronic
1092484506 12:8890868-8890890 ACTGAGAGAAGAAATGTGGAAGG - Intergenic
1092684092 12:11021852-11021874 AATGGCAAATAACATGAGGAAGG + Exonic
1092912884 12:13163969-13163991 ACTGCGGAAGAAATTGAGGAGGG + Intergenic
1093067690 12:14675630-14675652 CCTGGGAAAAATAATGGAGAGGG + Intronic
1093185778 12:16017697-16017719 ACTTGGAAAAAAATTAAGCAGGG - Intronic
1093772890 12:23038004-23038026 ACTGGAAAACACAATGAAGATGG - Intergenic
1093917619 12:24823375-24823397 AGGGGGCAAAAAAATGAAGAAGG - Intronic
1093959540 12:25257102-25257124 ACTGGGAAGAAAAAGGTGGCTGG - Intergenic
1093995845 12:25641839-25641861 AGAGTGAAAAAAAATTAGGATGG - Intronic
1094026106 12:25960661-25960683 CTTGAGGAAAAAAATGAGGAAGG - Intronic
1095180295 12:39140094-39140116 AAGGGGAAAAATAATGATGAAGG - Intergenic
1095781569 12:46065892-46065914 AGTGGGAAAAGAAGAGAGGAAGG - Intergenic
1096819953 12:54226212-54226234 ACTGTGGAATAAAATGAAGAAGG - Intergenic
1097158771 12:57030944-57030966 AATGGGAAAAAAATAGAAGAGGG + Intronic
1097342347 12:58453576-58453598 ACTGGGAGAATCTATGAGGAAGG - Intergenic
1097353489 12:58575028-58575050 ACTGGGATAAAAAATGTTAAAGG + Intronic
1097463967 12:59899806-59899828 ACAGGGTAAAAAAATGACAAAGG - Intergenic
1097515479 12:60599707-60599729 ACTGTGATAAAAAATGATGATGG + Intergenic
1097811123 12:64020457-64020479 GCTGGGAAAAAAAAAGAAAAAGG + Intronic
1097967145 12:65593604-65593626 AAGGGGAAAAAAAGTGAAGAAGG - Intergenic
1098425187 12:70355930-70355952 AGTAGGAAGAAAAATGTGGAAGG + Intergenic
1098565899 12:71935287-71935309 ACTGGAAAAAAAGAAGAGGTGGG - Intergenic
1098805413 12:75015954-75015976 AAAGGGAAAAAAAAGGAGGAGGG + Intergenic
1098987411 12:77027667-77027689 AATGGGAAAATAATTGAGGCAGG - Intronic
1099561870 12:84188944-84188966 ACTGGAAAAAAAAATAAGGCAGG + Intergenic
1100096828 12:91049743-91049765 ACTGAGAAAAAATATGTGAAGGG - Intergenic
1100307450 12:93364021-93364043 AGGGGAAAAAAAAATGAGGCAGG - Intergenic
1100972530 12:100086358-100086380 TCTGGGAAAAAAAAAGGGGGGGG + Exonic
1101021083 12:100554424-100554446 ATTGGGAACAAAAATGAAGCAGG - Intronic
1101210538 12:102531327-102531349 GCTAGGAAAAAAAATTAGGAGGG + Intergenic
1101408918 12:104453332-104453354 CCTGGGAAAGAGAAGGAGGAAGG - Intergenic
1101688480 12:107050183-107050205 AGAGAGAAAAACAATGAGGAGGG + Intronic
1101774261 12:107779369-107779391 ACTGAAAAAAAAATTGAGGGAGG + Intergenic
1101920040 12:108925011-108925033 ATTGGTAAAAAAAAAAAGGAAGG - Intronic
1102838579 12:116092364-116092386 TCTGGGGAAAAAGAGGAGGATGG + Intronic
1103051468 12:117783566-117783588 TCTGGGAAAAAAAATGGAAAAGG + Intronic
1103197546 12:119058030-119058052 ACTGGGAAAGAAGATGGGGAAGG + Intronic
1105019592 12:132807323-132807345 AGTGTGAAAGAAAATGAGGATGG - Intronic
1106226462 13:27790485-27790507 ACTGGGAAAGAATATGGGGGTGG - Intergenic
1106742909 13:32665988-32666010 ACTGGGAAAGGAACTGGGGAGGG + Intronic
1107087775 13:36444562-36444584 GCTGGGAAAAAAAAGCAGGGTGG - Intergenic
1107328749 13:39274072-39274094 CCTGGTAATGAAAATGAGGAAGG + Intergenic
1107739319 13:43432480-43432502 AATAGAAAAAAAAATGAGGTGGG + Intronic
1107750786 13:43563947-43563969 TCTGGAAAAAAAAAGGAGGAAGG + Intronic
1107905150 13:45054735-45054757 AGTGGGAAAATAAACCAGGAGGG - Intergenic
1108842845 13:54641821-54641843 ACACGGATAAAAAATGACGATGG + Intergenic
1109373667 13:61459329-61459351 AGTGGTAAAAGAGATGAGGATGG - Intergenic
1109408194 13:61928050-61928072 AGTGGGATCAAAAATTAGGAAGG + Intergenic
1109763958 13:66868532-66868554 ACTGAGAAAAAAAATGTGTTGGG + Intronic
1110324957 13:74202961-74202983 ACTGGTAAAGAACAGGAGGAAGG + Intergenic
1110547460 13:76771584-76771606 ACTGTGAAAGATAGTGAGGAGGG + Intergenic
1111159951 13:84382050-84382072 ACTAGGAAATAAAATGAGATTGG + Intergenic
1111371140 13:87319319-87319341 ACTGGGGAAAACAATAATGAAGG + Intergenic
1111796444 13:92926723-92926745 ACTGAAAACAAAAATGAGGGGGG + Intergenic
1111807914 13:93060978-93061000 ACAGGGAAAAAGAAATAGGATGG + Intergenic
1111894569 13:94125389-94125411 TCTGGGAAAAAAAATGCACATGG - Intronic
1112005801 13:95252709-95252731 AGTAGGAAAAAAAATCAGTAGGG + Intronic
1112514593 13:100042176-100042198 ACTGGGAAAAAGCATGATGTGGG + Intergenic
1113077244 13:106479251-106479273 ACTGAGGAAAACAATAAGGAGGG + Intergenic
1113162619 13:107399190-107399212 ACTGGGAAACAAATGGAGGTAGG + Intronic
1113402288 13:110005152-110005174 ACTGGGAAACAAGAGGAGGCTGG + Intergenic
1113707010 13:112441567-112441589 ACTTGGAATAAAGGTGAGGAGGG - Intergenic
1114824959 14:26065911-26065933 ACTAGAAAAAAAAAATAGGAAGG + Intergenic
1115439333 14:33414019-33414041 TCTGAGAAAAATAAAGAGGAAGG - Intronic
1115482011 14:33869761-33869783 TCTGGGAAAGAAAATGGAGATGG + Intergenic
1115518508 14:34209333-34209355 ACATGGAAAAAAAATTAGGAAGG + Intronic
1115682436 14:35756458-35756480 ACAGGGAAAAAACACGAAGAGGG + Intronic
1116257738 14:42578641-42578663 ACAGGGAAACAACATGAGCAGGG - Intergenic
1117769624 14:59119736-59119758 ACTGTGGAAAAAAATGATGAAGG + Intergenic
1117980763 14:61340141-61340163 ACCGGGAAGAAAAATGAACAGGG - Intronic
1117988621 14:61412754-61412776 AGTGGGAAAAAAAGTGGGAAGGG - Intronic
1118143411 14:63109952-63109974 TCTGGCAAACAAAATAAGGAAGG - Intergenic
1118533909 14:66737229-66737251 AAGGGGAAAAAGAAAGAGGAAGG - Intronic
1118567183 14:67154329-67154351 GCTGGGATAGAAAATGATGAGGG - Intronic
1118913030 14:70077690-70077712 TCTGGGAAAAGAAATGGGCATGG - Intronic
1118969032 14:70616356-70616378 ACTGGGGAGAGAAATGAGGAAGG + Intergenic
1119495617 14:75076204-75076226 AATGGGAAAAAAGATCAAGATGG - Intronic
1120024467 14:79567385-79567407 AATGGGAAACAAAATGGGGAAGG + Intronic
1120392580 14:83927556-83927578 TCTGTGAAAAAAAATGATGTTGG - Intergenic
1120668029 14:87330335-87330357 AATGAGAATAATAATGAGGATGG - Intergenic
1120694211 14:87625931-87625953 ACAAGCAAAACAAATGAGGAAGG - Intergenic
1120717205 14:87852734-87852756 AGAGGGACAAAAAAGGAGGAAGG - Intronic
1124142936 15:27093313-27093335 GATGGGAAAACCAATGAGGAGGG - Intronic
1124572154 15:30874114-30874136 ACAGGGAACAAAAATAATGATGG - Intergenic
1124680613 15:31727411-31727433 AGTGGGGAAAAAAAGGAGGGTGG - Intronic
1124807085 15:32895338-32895360 AAAGGGAAACAAAAAGAGGAAGG + Intronic
1125094926 15:35839714-35839736 ACTGGGAGAGAAACTGAGGCAGG - Intergenic
1125250174 15:37692452-37692474 AAATGGAAAAAAAATGTGGAAGG + Intergenic
1125262176 15:37839157-37839179 GCTGAGAAATAAAATGAAGAAGG + Intergenic
1126338083 15:47608545-47608567 ACTGGGAAGAGAAATTATGAAGG - Intronic
1126396954 15:48228328-48228350 AGTGGGAAGAAAAGTGGGGAGGG - Intronic
1126650155 15:50911835-50911857 ACTGAGTAAAGAAAAGAGGAAGG + Intronic
1127237104 15:57065954-57065976 AATGGGAACAAAAATAAAGAAGG - Intronic
1127360692 15:58242476-58242498 AATGAGAAAAAAAATGATGATGG + Intronic
1127532210 15:59854513-59854535 ACTGAGATCAAAGATGAGGAAGG - Intergenic
1127663898 15:61125707-61125729 ACTGGGAGGAGAAAAGAGGAAGG - Intronic
1127678941 15:61274147-61274169 ACTTGGAAGAAAAATAAGGTTGG + Intergenic
1128093776 15:64937426-64937448 ACTATAAAAAAGAATGAGGACGG + Intronic
1128936308 15:71749310-71749332 ACAGGGAGAAGAAAAGAGGAAGG + Intronic
1129354477 15:74980450-74980472 ACTGTTAGAGAAAATGAGGAGGG - Intronic
1129553470 15:76479161-76479183 ATGAGGAAAAAAAAGGAGGAGGG + Intronic
1129601404 15:77000840-77000862 ACTAGAAAAAAAAAGGAGGGAGG - Intronic
1129953391 15:79611626-79611648 CCTGGGCAAAATATTGAGGAAGG - Intergenic
1129975036 15:79815018-79815040 ACTGGGAGAAGAGAGGAGGAAGG - Intergenic
1130170492 15:81507228-81507250 AGTGAAAGAAAAAATGAGGATGG - Intergenic
1130625949 15:85514989-85515011 ACTGGGAAATAAATTTGGGAAGG + Intronic
1130768232 15:86895173-86895195 GCTGGGAAAAGAAAAGAGGGGGG - Intronic
1130886019 15:88093291-88093313 AGTGGGAAAAAAAGGGAGGGGGG + Intronic
1131289053 15:91089211-91089233 AGTGGGAATGGAAATGAGGAGGG + Intergenic
1131779404 15:95840491-95840513 ACAGATAAAAAAACTGAGGAGGG + Intergenic
1131795145 15:96008576-96008598 ACTGAGAATAAAAAGGATGAGGG + Intergenic
1132177939 15:99730255-99730277 TCTGGGAAAGAAAATGCCGAGGG - Intronic
1132397559 15:101485745-101485767 TCTGGGAAAGAAGAGGAGGAGGG - Intronic
1133434143 16:5764789-5764811 AATGATAAAAAAAATGATGATGG - Intergenic
1133572359 16:7054072-7054094 ACAGAGAACAAAAATGAAGAGGG - Intronic
1133654558 16:7847891-7847913 ACTGGGAGGGAAAATGAGGATGG + Intergenic
1133722412 16:8507347-8507369 ACAGGTGAAAAAACTGAGGATGG + Intergenic
1133840499 16:9403805-9403827 AATGGGGTAAAAATTGAGGAAGG - Intergenic
1134144678 16:11750525-11750547 ACTGGGTACAAAAATCAAGATGG - Intergenic
1135224962 16:20647756-20647778 ATTGGGAAGAAAACTGAGGCAGG + Intronic
1135549685 16:23388459-23388481 AGGGGGAAAAAAAAAGAAGAAGG + Intergenic
1135633978 16:24058323-24058345 AGTGGCATAAAAAATAAGGAAGG - Intronic
1136648866 16:31648197-31648219 AGTGGGGAAAAAGATGATGATGG + Intergenic
1137004397 16:35259526-35259548 ACTGGGACAAAGCATGAGAAAGG + Intergenic
1137377830 16:47969175-47969197 TCTGGGAAAAGAAAAGAGGGTGG - Intergenic
1137535356 16:49318487-49318509 ATTAGGAAAAAAAAAGAAGACGG - Intergenic
1137678607 16:50318419-50318441 ACAAGGGAAAAAAATCAGGATGG - Intronic
1138271813 16:55701148-55701170 GCAGGTAAACAAAATGAGGATGG + Intronic
1138359998 16:56420112-56420134 CCTGGGAGAAAAAGAGAGGAAGG + Intronic
1139052047 16:63136238-63136260 AATGAGAAAAAAAGTGAGCATGG + Intergenic
1139180219 16:64738458-64738480 CCTGGGAAAGAAAATGATGGAGG + Intergenic
1139235676 16:65336023-65336045 ACTGGAAAAAAAAAAAAGAAAGG + Intergenic
1139569761 16:67804290-67804312 ACTGGGAAAAAAAGGGAGACTGG + Intronic
1140079640 16:71733025-71733047 AGTGGGATAAAGAATGAGAATGG + Exonic
1140175412 16:72654442-72654464 ACTGGGATAAAGAGTGAGAAGGG + Intergenic
1140347605 16:74229041-74229063 AGAGGGAAAAAATATGGGGATGG + Intergenic
1140684733 16:77422535-77422557 AGAGTGAAAAAAAAAGAGGAAGG + Intronic
1140770593 16:78200366-78200388 AATAGGAAAAGAAAGGAGGAAGG + Intronic
1140869038 16:79089957-79089979 ACTGGAAAAAAAAAAAAGGGGGG + Intronic
1140965882 16:79965610-79965632 ACGGGAGAAAAAAATGAAGAAGG - Intergenic
1141320636 16:83005330-83005352 ACAGGGAGAAAGAGTGAGGAGGG - Intronic
1141667987 16:85475720-85475742 ACTGGGAAGAAAGAGGAGGCAGG + Intergenic
1141849035 16:86631437-86631459 ACTGGGAGAGAGGATGAGGACGG - Intergenic
1142738811 17:1918352-1918374 AGTGAGAAAAAAAAAGAGAAGGG - Intergenic
1143142444 17:4748798-4748820 GCTGAGAGAAAAGATGAGGAGGG - Intergenic
1143247963 17:5501563-5501585 ACAGAGAAAAAAAAGGAAGAAGG - Intronic
1143347980 17:6264056-6264078 ACTGGGAAACTACACGAGGAAGG + Intergenic
1143980356 17:10863867-10863889 AAGGGGAAAAAGAAAGAGGAAGG - Intergenic
1144004331 17:11086612-11086634 AGTGGGAAAAAAAAGGAGAGAGG - Intergenic
1144084441 17:11796274-11796296 ATTAGGAAAACACATGAGGATGG - Intronic
1144405809 17:14951706-14951728 ATTAGGAACAAAAAGGAGGAGGG - Intergenic
1145086609 17:19947273-19947295 ACTCAGAAAACAAATTAGGAAGG + Intronic
1145910211 17:28537943-28537965 TCTGGGAAAGAAAATGACGAGGG - Exonic
1146025824 17:29319954-29319976 ACTGTGAAAGAGAATGAGGGAGG + Intergenic
1146048101 17:29527123-29527145 TCAGGGAAAAAAAAAGAGGCTGG + Intronic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1146717792 17:35100891-35100913 ACTGGGAAGAAAAGTTGGGAGGG + Exonic
1146837336 17:36122573-36122595 ACTGGGACACAAAAGGAGGCTGG - Intergenic
1147543938 17:41383943-41383965 ACAGGGAAAAGAAGTGAGGTAGG - Intronic
1148037847 17:44681636-44681658 ACTGGGAAAGAACATAAAGATGG + Intronic
1148379790 17:47187877-47187899 ACTGGTAAAAAGAATTTGGATGG + Intronic
1148404660 17:47400350-47400372 CCTGTGAAAAGAAATGTGGATGG - Intronic
1149042174 17:52203079-52203101 ACAGGCAGAAAAACTGAGGAAGG - Intergenic
1149397817 17:56262731-56262753 AATGAGATAATAAATGAGGATGG + Intronic
1149670449 17:58403596-58403618 GCTGGCAAAAAAAAAGAGAAGGG - Intronic
1150040320 17:61853337-61853359 ACTGAAAAAGAAGATGAGGAGGG + Intronic
1150322510 17:64227371-64227393 ACTGGGCAAAAAAAAGGAGAGGG + Intronic
1150506660 17:65705694-65705716 ACATGGGAAAAAAGTGAGGAAGG + Intronic
1150573292 17:66407140-66407162 AATGGGAAAAAAAAAAAGGTTGG - Intronic
1150895323 17:69203464-69203486 AGAGGGAAAAGAGATGAGGATGG - Intronic
1151563641 17:74884713-74884735 ACTCGGAAAAAAAAAGAAAAAGG - Intronic
1151947537 17:77327730-77327752 ATTTAGAAAAAAAAAGAGGAGGG - Intronic
1152227300 17:79098359-79098381 ACTGGGAATGATAATAAGGATGG + Intronic
1154223211 18:12475509-12475531 ACTGGAAAAAAAAAAGAAGTTGG + Intronic
1154332779 18:13443236-13443258 TTTGGGAGAAAAAATGACGAAGG - Intronic
1154494901 18:14948412-14948434 ACTTGGGAAAGAAATGAGGGAGG - Intergenic
1155362256 18:25015385-25015407 ACAGGGAAAAAAAAGTAGGATGG - Intergenic
1155405257 18:25480884-25480906 ATTGGGAAAAAATGTGAGTAAGG + Intergenic
1155550251 18:26957197-26957219 ACTGAGAATAAAAAGGATGAGGG + Intronic
1156276227 18:35585183-35585205 AATGGGATAAGAAATGTGGAGGG - Intronic
1156318991 18:36000274-36000296 CCTGTGAAAAGAAATGAGAAAGG - Intronic
1156615488 18:38778725-38778747 ATTGTGAAAAAGAATGAGCATGG + Intergenic
1156973473 18:43186952-43186974 ACAGGAAAAAAAAATGAGTGGGG - Intergenic
1157001110 18:43526567-43526589 ACATGGAAAAAAAGTGAGAAAGG - Intergenic
1157017155 18:43729299-43729321 ACTGTGAAAAAAAATCTTGAAGG - Intergenic
1157210940 18:45741331-45741353 CTTGGGAACAAAAAGGAGGAGGG + Intronic
1157771454 18:50350871-50350893 ACCAGGAAAAAAAAAGAGAAAGG - Intergenic
1157773268 18:50369612-50369634 AATGGGGAAAAAAATCAGGCTGG - Intergenic
1158057720 18:53301755-53301777 ATTGGAGAAGAAAATGAGGATGG - Intronic
1158196300 18:54888935-54888957 ACTGTTTAAAAAAATTAGGAGGG - Intronic
1158225721 18:55198989-55199011 ACTGGGAAAGAAATTGTGAAAGG - Intergenic
1158237018 18:55328174-55328196 ACTTTGCAAAAAATTGAGGAAGG - Intronic
1158439230 18:57459318-57459340 ACTGTGAACAAAGATGAGGAGGG + Intronic
1158522358 18:58182347-58182369 AGTGGGACAGAAAATGAGGGAGG + Intronic
1159000573 18:62971357-62971379 ACTGGGAAAAAAAAAAAATAAGG - Intronic
1159361735 18:67413936-67413958 AATGAGAAAAAAAATAAGCATGG - Intergenic
1160478506 18:79216688-79216710 ACAGGGAAAAGAAAAGAAGAGGG - Intronic
1161184263 19:2905878-2905900 ACAAGGAAAAAAAATGAGGCTGG + Intronic
1161216236 19:3096212-3096234 TTTGGGGAAAAAAATCAGGAAGG - Intronic
1161755189 19:6128072-6128094 GCTGTGAAAAAGAATGAGAAAGG + Intronic
1161899798 19:7109923-7109945 ACTGGGAGCAGAAAGGAGGAGGG + Intergenic
1162245764 19:9398901-9398923 ACCGTGAAAAAAAATTAGAATGG + Intergenic
1162381916 19:10336220-10336242 ACAATAAAAAAAAATGAGGATGG + Intronic
1163305213 19:16473579-16473601 ACTGGAAGAACAAAAGAGGAAGG + Intergenic
1163761729 19:19140682-19140704 ACGAGGAAAAAAAAAGAGGCTGG + Intergenic
1164494209 19:28744565-28744587 AATGGGGAAAAAAAGGAGGGAGG - Intergenic
1164861499 19:31565542-31565564 ATTGGGAAAAAGAGTGTGGATGG + Intergenic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1165769950 19:38374228-38374250 GCTTGGGAAAAAAATGTGGAAGG + Intergenic
1165965657 19:39577350-39577372 ACTGGAAAAAAAAACAAAGAAGG - Intergenic
1166074750 19:40407461-40407483 ACCGGAAAAAAAAATGAGCCGGG - Intronic
1166215458 19:41331707-41331729 ACTGAGAAAGAAAATCAGGCGGG - Intronic
1167028606 19:46941043-46941065 AGAGGGAAAAAAAAGGAGGGTGG - Intronic
1167446018 19:49537983-49538005 ACTAAAAAAAAAAAAGAGGAAGG - Intronic
1167691872 19:50990221-50990243 ACTGGGAAAAGAATTGGGGATGG - Intergenic
1167813699 19:51858554-51858576 ACTGTCAAACAAAATGGGGAAGG + Intronic
1167824060 19:51955889-51955911 ACTGTGAAAATAAATAAAGAGGG - Intergenic
1168456389 19:56512768-56512790 ACTTAGAAAAAATGTGAGGAGGG - Intronic
924990809 2:311305-311327 ACTGGAAAAAATACTCAGGAGGG - Intergenic
925365380 2:3307687-3307709 GCTGGGAAAAGAAGTGAGGCAGG + Intronic
926289549 2:11517501-11517523 ACTTGAAAAAAAAAAGAGGAAGG + Intergenic
926384526 2:12323295-12323317 AATGGAAAAAAAAAGGAGCAGGG - Intergenic
926420984 2:12699005-12699027 ATTTGGAAAAAAAATCAGGATGG + Intergenic
926855571 2:17252258-17252280 TCTGGAAGAGAAAATGAGGAGGG - Intergenic
927288904 2:21385431-21385453 ACTTGGAAAAAAACAGAGGAAGG - Intergenic
928332893 2:30371153-30371175 AGGGTGAAAAAAAATGAGGCTGG + Intergenic
929186663 2:39102362-39102384 AAGGGGAAAAAAAATTAGGTGGG + Intronic
929223310 2:39487483-39487505 ACTAGGAAACAAAGTGAAGAAGG - Intergenic
929651520 2:43684394-43684416 AAAGAGAAAAAAATTGAGGATGG + Intronic
930356317 2:50325145-50325167 ACTGAGAAAGAAGAAGAGGATGG + Intronic
930414956 2:51079069-51079091 TATGGGAAAAAAAATGGGGTGGG + Intergenic
930451325 2:51541564-51541586 ACTGTAAAAGCAAATGAGGAAGG - Intergenic
930786002 2:55271873-55271895 AGTGGGGAAAAAAAAGAGGTTGG - Intergenic
930945524 2:57069142-57069164 TCTGGGCATAACAATGAGGAAGG - Intergenic
931816614 2:65909473-65909495 TCTGGGACAAAAAAAGAGGTTGG + Intergenic
931946404 2:67313349-67313371 ACTGGGACAAATATTGAGGAAGG - Intergenic
932149980 2:69361985-69362007 AAAAGGAAAAAAAATGGGGAGGG + Intronic
932387364 2:71348405-71348427 ACTGGGGAAAAAAAAGATGAAGG - Exonic
932440610 2:71732304-71732326 ATTGGGGAAAAAGAAGAGGAAGG + Intergenic
932461782 2:71886751-71886773 CCTGTGAAAAGAAGTGAGGAGGG - Intergenic
932822585 2:74914220-74914242 AAAAGGAAAAAAAAGGAGGAAGG + Intergenic
932910039 2:75796820-75796842 ACTGTGAACAAAAATGAAGCTGG + Intergenic
933099960 2:78242287-78242309 AATGTGATAAAAAATGGGGAGGG + Intergenic
933126001 2:78606907-78606929 TTAGAGAAAAAAAATGAGGAAGG + Intergenic
933141941 2:78802113-78802135 ATTTTGAAAACAAATGAGGAAGG - Intergenic
933159459 2:79008132-79008154 ACAGTGAAAAAAAATGATCAGGG + Intergenic
933226869 2:79759836-79759858 ATTGGAAAAAAAAATGAGAGAGG - Intronic
933938231 2:87224363-87224385 ACTGGGCACAAAACTCAGGAAGG - Intergenic
934161720 2:89255947-89255969 ACTATGAAAATAAATGATGATGG + Intergenic
934205564 2:89926468-89926490 ACTATGAAAATAAATGATGATGG - Intergenic
934789700 2:97048398-97048420 ACTGGGAAAATAAAGGATGATGG + Intergenic
934816769 2:97334141-97334163 ACTGGGAAAATAAAGGATGATGG - Intergenic
934820927 2:97374343-97374365 ACTGGGAAAATAAAGGATGATGG + Intergenic
935195509 2:100812638-100812660 ACGGGGAGAAGAATTGAGGAAGG + Intergenic
935315534 2:101829952-101829974 AGAGGGACATAAAATGAGGAGGG - Intronic
935704690 2:105845746-105845768 GCTGTGAAAAAAAAATAGGAAGG + Intronic
935916733 2:107960622-107960644 ACTAGGACAAAAGAGGAGGAAGG - Intergenic
936043127 2:109164998-109165020 CCTTGGAATATAAATGAGGAAGG + Intronic
936354905 2:111741412-111741434 ACTGGGCACAAAACTCAGGAAGG + Intergenic
936548565 2:113414292-113414314 ATAGGGAAGAAAAATGAGGAAGG - Intergenic
936790070 2:116140978-116141000 AATCTGAAAAAAAAAGAGGAAGG + Intergenic
937564356 2:123265636-123265658 GCTGGGAAAAGTAATAAGGAGGG + Intergenic
937928303 2:127184711-127184733 ACAGGCAAAAAACAAGAGGAGGG - Exonic
938451239 2:131423381-131423403 ACATGGGAAAAAAATCAGGAGGG + Intergenic
938509428 2:131925272-131925294 TAAGGAAAAAAAAATGAGGAAGG + Intergenic
939117503 2:138077249-138077271 GTTGGGAAAAAAAAGGATGAGGG - Intergenic
939288802 2:140166899-140166921 ACTTGGCAATAAACTGAGGATGG + Intergenic
939461389 2:142500246-142500268 ACTGTGAAAATAAAAGAGAATGG - Intergenic
939595124 2:144113242-144113264 AGAGGGAAAAAAAATAAGAAAGG + Intronic
941173779 2:162172056-162172078 ACTGGGAAAGAAATGGGGGAGGG - Intronic
941821912 2:169852014-169852036 ACCGGGAAAAAAAATAACCATGG - Intronic
941836420 2:170025487-170025509 ACTTGGAAAGAAAAGAAGGAAGG + Intronic
941867644 2:170351306-170351328 TCTGGGAAAAAGAATGGGGTAGG + Intronic
941955327 2:171198182-171198204 ACAGAGAAAAAAAATGATAACGG + Intronic
942498585 2:176564715-176564737 ACTGGAAACCAAAATGAGAATGG + Intergenic
942844938 2:180412924-180412946 ACTTGGAAAAGGAATGAGGTGGG + Intergenic
943040683 2:182801206-182801228 ACTGGGAAAAAACAAAAGCAAGG + Intergenic
943214925 2:185019977-185019999 TCTGAGAAAGAAAATGAGTAAGG + Intergenic
943983289 2:194584572-194584594 ACTTGGAAAAAAAGTGAAAACGG + Intergenic
944689946 2:202149661-202149683 AGTGGGAGAAGTAATGAGGAGGG + Intronic
944864411 2:203846745-203846767 TCTGTGAGATAAAATGAGGAGGG - Intergenic
944870394 2:203905549-203905571 ACTGGGAGAAATAATGACAAAGG + Intergenic
944926310 2:204468287-204468309 ACTGGAACAGAAAATGAAGATGG + Intergenic
945324024 2:208462422-208462444 CCTGGGAATAAGAATGTGGAAGG + Intronic
945507163 2:210656153-210656175 ACTGGGAAAGAAAAGAAGGTGGG - Intronic
945541534 2:211093229-211093251 CCAGGGAACAAAAATTAGGAAGG + Intergenic
945703181 2:213197532-213197554 ACAGGGAAGCAAAATGAGGAAGG + Intergenic
945966072 2:216188303-216188325 ACTGGGAAATAATGTGAAGAGGG - Intronic
946410512 2:219513119-219513141 GCTGAGAAAAAAAGTGAGAAAGG - Intergenic
946934736 2:224708394-224708416 AGTAGTAAAATAAATGAGGATGG - Intergenic
947103209 2:226643686-226643708 AAAGGGAAAAAAAAGGAGGGGGG + Intergenic
947321826 2:228927601-228927623 TATGGGAAAGAAAAGGAGGAAGG + Intronic
947856946 2:233330536-233330558 ACTGTGAAAGAAAGGGAGGAAGG - Intronic
1168855669 20:1005957-1005979 ACTGGGGCAAGAAATGAGGGTGG - Intergenic
1168917763 20:1505320-1505342 ACTTGGAAAGAAATTGGGGAAGG + Intergenic
1169189665 20:3650129-3650151 CCTGGGAAATAAAAAGAGCAGGG + Exonic
1169970790 20:11267589-11267611 ACTGGGTAAAAAAAGCAAGAGGG - Intergenic
1170032272 20:11955891-11955913 AGTGGGAAGAGAAAAGAGGATGG + Intergenic
1170117134 20:12872614-12872636 ACAGGGAAAAATAGTGAGGAGGG - Intergenic
1170157405 20:13281171-13281193 GCTGGGTACAAAAATGAGCAAGG + Intronic
1170209199 20:13831150-13831172 ACTAGAAAAAAAAATGGGCAGGG - Intergenic
1170516666 20:17137210-17137232 ACTCAAAAAAAAAATAAGGATGG + Intergenic
1170964860 20:21058983-21059005 AATGGGAATAAAAATGACAATGG - Intergenic
1172780685 20:37435460-37435482 ACTGAGAAAAACAGAGAGGATGG - Intergenic
1172864867 20:38088252-38088274 TCTGGGAAGAATAATGAGGCAGG - Intronic
1172957649 20:38772526-38772548 AAGGGGAAAAAATAGGAGGAGGG - Intergenic
1173049903 20:39549213-39549235 ACCGGGAAAAGACATGATGAAGG + Intergenic
1173093814 20:40004000-40004022 ACTAGGAAAAAAAGATAGGAGGG - Intergenic
1173441566 20:43081804-43081826 ACTGGGAAAAAAGACAAAGAAGG - Intronic
1174044101 20:47721244-47721266 TGTGTGAAAACAAATGAGGAAGG + Intronic
1174582451 20:51581652-51581674 TGATGGAAAAAAAATGAGGATGG - Intergenic
1174923231 20:54727644-54727666 AAGGAGAAAAACAATGAGGATGG - Intergenic
1174973073 20:55299841-55299863 GTTGGGAAATAAAAGGAGGATGG + Intergenic
1175455562 20:59110007-59110029 ATTAGGAAAAAAAATGATGCTGG + Intergenic
1176784052 21:13233290-13233312 TAAGGAAAAAAAAATGAGGAAGG - Intergenic
1177146903 21:17416603-17416625 ACTGGGAAGGGAAAGGAGGAAGG + Intergenic
1177475316 21:21612983-21613005 AATGGAAAAGAAAATGAGAAGGG + Intergenic
1177500457 21:21948068-21948090 ACAGGGCAAGAAAATAAGGATGG + Intergenic
1177982102 21:27927122-27927144 TAAGGAAAAAAAAATGAGGAAGG - Intergenic
1178129319 21:29553140-29553162 ACAGGGAGAAGAAAAGAGGAGGG + Intronic
1178271516 21:31194126-31194148 ACAGGCAAAAAAAAAGAGAAAGG - Intronic
1178780284 21:35596638-35596660 ACTGGGGGAAAAAAGGGGGATGG + Intronic
1178790771 21:35697979-35698001 GCTGGGAAAAAAAAACATGATGG + Intronic
1179207234 21:39292969-39292991 ACTATGAAAAAAAGTGGGGAGGG + Intronic
1179264513 21:39791247-39791269 ACTAGTAAAATAAATGATGATGG - Intronic
1180758539 22:18180820-18180842 ACTGTGACAAAAATTAAGGAAGG - Intergenic
1180768826 22:18364612-18364634 ACTGTGACAAAAATTAAGGAAGG - Intergenic
1180777486 22:18497783-18497805 ACTGTGACAAAAATTAAGGAAGG + Intergenic
1180810208 22:18755093-18755115 ACTGTGACAAAAATTAAGGAAGG + Intergenic
1180826701 22:18867836-18867858 ACTGTGACAAAAATTAAGGAAGG - Intergenic
1181115730 22:20631706-20631728 ACAGGGACAAAAAAAGAAGATGG + Intergenic
1181196350 22:21189345-21189367 ACTGTGACAAAAATTAAGGAAGG + Intergenic
1181213177 22:21303779-21303801 ACTGTGACAAAAATTAAGGAAGG - Intergenic
1181409072 22:22705391-22705413 ACTGGGCCTAAATATGAGGAAGG - Intergenic
1182011834 22:27007528-27007550 ACTGGGGATATAAATGGGGATGG - Intergenic
1182535253 22:30996910-30996932 ACAAAAAAAAAAAATGAGGAAGG + Intergenic
1182781731 22:32873791-32873813 GCTGGGAAAAGAGATAAGGAGGG + Intronic
1183129425 22:35819801-35819823 ACAGAGAAAAAATAAGAGGAGGG + Intronic
1183630409 22:39029195-39029217 ACTGGGAGAGAGAAAGAGGAGGG - Intronic
1183633870 22:39049281-39049303 ACTGGGAGAGAGAAAGAGGAGGG - Intronic
1184110498 22:42391189-42391211 TCTGGGAGAGAAGATGAGGAAGG - Intronic
1184440877 22:44513912-44513934 AGAGAGAAAAAAAAGGAGGAGGG - Intergenic
1184962426 22:47941270-47941292 CCTGGGTAGAAAAGTGAGGAGGG + Intergenic
1203230448 22_KI270731v1_random:105496-105518 ACTGTGACAAAAATTAAGGAAGG - Intergenic
1203276844 22_KI270734v1_random:93746-93768 ACTGTGACAAAAATTAAGGAAGG - Intergenic
949192519 3:1267230-1267252 AGAGGGAAAAAAAGTGAGGAAGG - Intronic
949365713 3:3278397-3278419 AAGGGGAAAAAAAAAGAGGATGG - Intergenic
949371808 3:3343450-3343472 ATTGAAAAAAAAAATGAGGTGGG + Intergenic
949835199 3:8261185-8261207 ACAGAAAAAAAAAATGAGAAGGG - Intergenic
949903140 3:8836503-8836525 CCTGGGAAAGAAAATCTGGATGG - Intronic
950072399 3:10163276-10163298 ACTGGGAAAAAAGCAGAGTATGG - Intergenic
950269912 3:11605423-11605445 ACTAGGAATAAAAATGAGAAAGG - Intronic
950552343 3:13674303-13674325 AATGGGAAAAAGAAACAGGATGG - Intergenic
950604607 3:14066957-14066979 AATGGGAGAAAAGATGATGATGG + Intronic
950916770 3:16654014-16654036 AATGCAAAATAAAATGAGGAAGG + Intronic
951375755 3:21914136-21914158 ACTCTTAAAAAAAATGAAGATGG + Intronic
951665279 3:25116344-25116366 AGTGGGAAAAAAAAAGGGAAGGG - Intergenic
952083768 3:29793338-29793360 AGTGGAAAAAAAAATTATGACGG - Intronic
952473760 3:33684390-33684412 TGTGGGAGAAAAAGTGAGGATGG - Intronic
952555915 3:34530924-34530946 ACTGAGAAAAAGCATGAGTAAGG + Intergenic
952637697 3:35551818-35551840 ACTGGGCAAAAAAATTAACATGG - Intergenic
952770373 3:36994296-36994318 ACTGTGACAAAAAATGTGAAGGG + Intronic
953530724 3:43737491-43737513 ACTGGGAAAAAAAAAAAAGATGG + Intergenic
953579485 3:44140979-44141001 TCTGGGAAAAAAAATTAGCAGGG - Intergenic
953843115 3:46405871-46405893 TCTGGAAAAAAAAAAGAAGAAGG - Intergenic
954169634 3:48790713-48790735 AGTGGGAAAAATAAAGAGCATGG + Intronic
955096449 3:55803046-55803068 GCTGGGGAAAAATATGAGTATGG + Intronic
955905367 3:63801986-63802008 ACTGGGAGAAAACAGGAAGATGG + Intergenic
956258824 3:67314451-67314473 AGTAGGAAAGAAAATGAGGATGG - Intergenic
956344966 3:68268539-68268561 ACTGGGAGAAAATATGGTGAAGG + Intronic
956675893 3:71731441-71731463 ACTGAAAAAAATAATGAGGAAGG - Intronic
956840250 3:73133388-73133410 ACTGAAAAAAAAAACGAGCAGGG - Intergenic
957186469 3:76948367-76948389 ACTAGGAAAAATAGTGAAGAAGG - Intronic
957233665 3:77555239-77555261 ACTGGGAAAAAAAATTTGTGTGG + Intronic
957400564 3:79707372-79707394 ACTAAGAAAAAAAATGGGCAAGG - Intronic
957514281 3:81230865-81230887 ACTGAGGAAAACAATGAAGAGGG - Intergenic
957524037 3:81357374-81357396 ACTGGGTAACAAGAAGAGGATGG + Intergenic
957824142 3:85418966-85418988 AGGGGAAAAAAAAATGAGAAGGG + Intronic
957836491 3:85598544-85598566 ACTGTGAAAAAAGAACAGGAAGG + Intronic
957840659 3:85664582-85664604 ATAAGGAAAAAAAATGATGATGG - Intronic
957978703 3:87479831-87479853 ACTGTGAAAGAAAGTGATGAAGG + Intergenic
958153113 3:89717661-89717683 ATTAGAAAAAAAAAAGAGGAGGG - Intergenic
958408068 3:93773003-93773025 ACTGGGAAAAAAAAAAAGAAAGG + Intergenic
958690886 3:97464644-97464666 ACTGGGAAAAAAGATGATTCTGG + Intronic
959559248 3:107760704-107760726 ACAGGGGAAAAAACTGATGATGG + Intronic
959588601 3:108050992-108051014 ACTGGGAAAGAAAATGTGTTAGG + Intronic
959859799 3:111204385-111204407 TCTGGGAAAAAAAAAAAAGAGGG + Intronic
959931672 3:111990972-111990994 ACTGAAAAGAAAAATGAAGAGGG - Intronic
959963906 3:112332870-112332892 ACTGAGAAAGGAAATGAGGTGGG - Intronic
960451398 3:117813331-117813353 ACTAGGGAAAAAAATGGGAAGGG - Intergenic
960677330 3:120208509-120208531 ACTGATGAAATAAATGAGGAAGG - Intronic
960954543 3:123022664-123022686 AGTGGAATAAAAAATGAAGATGG - Intronic
961118045 3:124348614-124348636 ACTGTGGAAAACAATGTGGAGGG + Intronic
961130581 3:124463040-124463062 AATGTGAAATAAAATGAGGATGG - Intronic
961418122 3:126776776-126776798 ACTAAGAAAAAAAATGATGTTGG - Intronic
962334468 3:134514375-134514397 AAGGAGAAAAAAAATGAGAATGG + Intronic
962533122 3:136301959-136301981 AAAGAGAAAAAAAATGAAGATGG + Intronic
962611102 3:137076889-137076911 ATGGGAGAAAAAAATGAGGAGGG + Intergenic
963326178 3:143865875-143865897 ACAGGGAAGAAAGATGAGAATGG - Intergenic
963360281 3:144263906-144263928 CCTGGAAAAAAAAATTAGAAAGG + Intergenic
963647886 3:147940177-147940199 ACTGGGCAAAAAAAGGAGTTGGG + Intergenic
963728069 3:148944091-148944113 ATATGGAAAAAAAATGAGGCTGG + Intergenic
963768218 3:149361088-149361110 ACAGAGAAAAAGAATAAGGAGGG - Intergenic
963768950 3:149368949-149368971 ACTGGAAAAAAAAAAGGGGGGGG + Intergenic
964108283 3:153062445-153062467 ACTGGGAAGATAAATAAAGATGG - Intergenic
964159263 3:153626967-153626989 ACTGGGAAAAAAGTTATGGATGG + Intergenic
964518951 3:157543126-157543148 GCTGGGGAAAAAAACGAGGCGGG + Intergenic
964762068 3:160143831-160143853 ACTAGGAAAAAAAAAGAGTGAGG + Intergenic
964780444 3:160331308-160331330 CCTGGGAAAACAAAGTAGGATGG + Intronic
965053319 3:163680564-163680586 ACTGGGGAAAAATATTAGAAAGG - Intergenic
965550593 3:169961251-169961273 AGTGGGAAAGGACATGAGGAGGG + Intergenic
966627281 3:182031879-182031901 AAAGGGAAAAGAGATGAGGAGGG - Intergenic
967544346 3:190706789-190706811 ACTTGGCCAAAAAATGAGGGTGG + Intergenic
968462921 4:734669-734691 AGTGGGAAAAAAACTTAGAATGG - Intronic
970218844 4:13786510-13786532 AAAAGGAAAAAAAATGAAGAAGG - Intergenic
970253296 4:14139964-14139986 ATTGGGAAAGTAAATGAGGCAGG + Intergenic
971159847 4:24122582-24122604 ACTGAGAAAAGAAATGGGTATGG + Intergenic
971409846 4:26358921-26358943 ACTGGGATAAAAACAGTGGAAGG - Intronic
971619450 4:28836457-28836479 AAAGGGAAAGAAAATGAGTATGG + Intergenic
971704805 4:30026853-30026875 AATAGTGAAAAAAATGAGGAAGG - Intergenic
971961970 4:33500507-33500529 AGTGGAAAAAAAAAAAAGGATGG - Intergenic
972607069 4:40623380-40623402 ACTAAGAAAAGAGATGAGGAAGG - Intronic
972947438 4:44273538-44273560 ACTGGGAAAAAAGATGAAGATGG + Intronic
972991931 4:44830988-44831010 ACTGGGAAATTAAATTAAGATGG + Intergenic
973261945 4:48173909-48173931 ACTGGGAGAAGAAAGTAGGACGG - Intronic
973324528 4:48845164-48845186 GCTGGAAAAACAAATGAGGGAGG - Intronic
973715530 4:53672090-53672112 AGTGGGAAAAAAAATGAGATTGG + Intronic
973764747 4:54152835-54152857 ACTTGGAAAGTAAATGAAGATGG + Intronic
973885773 4:55319417-55319439 ACTAAGAAGAAAAAGGAGGAGGG + Intergenic
974056780 4:56991533-56991555 ACTGAGAAACAAAGTGAGGTAGG + Intronic
974356450 4:60818946-60818968 CATGGAAAAATAAATGAGGAAGG - Intergenic
974396156 4:61337547-61337569 ACAGGAAAAGAAAACGAGGAAGG - Intronic
975008026 4:69314561-69314583 AGAGGGAAAAAAGATGAGAATGG + Intronic
975009997 4:69339188-69339210 AGAGGGAAAAAAGATGAGAATGG - Intronic
975167102 4:71188421-71188443 ACCAGGAAAAGAAATGGGGAGGG - Intronic
975237499 4:72016478-72016500 GCTGGGATCAAAAATGAAGATGG - Intergenic
975549287 4:75594603-75594625 AATGGAAAAAAAAATAAGCAAGG + Intronic
976059384 4:81108400-81108422 ACTTGTAAAGAAAATGAGGCAGG + Intronic
976072707 4:81260017-81260039 ACTTGGAAAGAAAATGTAGAAGG - Intergenic
976648361 4:87408757-87408779 GTTGGGAAAAAAACTGAGGCAGG - Intergenic
977246097 4:94633527-94633549 ATTGGGGCAAAAAATGAGTAAGG - Intronic
977310102 4:95375376-95375398 ACAGGGTAAAAAAATGACAATGG + Intronic
978069341 4:104447218-104447240 AGATGGAAAAAAAATTAGGAAGG + Intergenic
978203135 4:106046730-106046752 TCTGAGAAAAAACATGAGGTTGG - Intronic
978487762 4:109275565-109275587 TGAGGGAAAAGAAATGAGGATGG + Intronic
978630984 4:110744294-110744316 ACTGAGAGAAAAAAAGAGGCAGG - Intergenic
978831966 4:113097523-113097545 AAAGGGAAAATAAATTAGGATGG + Intronic
978941578 4:114442682-114442704 CCTGTGAAAAGAAATGAAGAAGG + Intergenic
978979204 4:114921269-114921291 ACTGGAATAAAAAATAATGATGG + Intronic
979139304 4:117152114-117152136 ACTGGGAAACAAAGAGAGGTTGG - Intergenic
979285722 4:118922093-118922115 AATGGTTAAATAAATGAGGAGGG + Intronic
979798002 4:124871266-124871288 ACTGGGAAAAGGTAGGAGGAAGG - Intergenic
980857242 4:138454755-138454777 ACTGGCAAAGCAAATGAGGGAGG - Intergenic
981562599 4:146063938-146063960 TCTGTGAAAGGAAATGAGGAAGG - Intergenic
982012631 4:151121349-151121371 ACTGAGGAAAAAAATAAGTATGG + Exonic
982055221 4:151542360-151542382 ACTGGGAATAAAAAAAAGCAGGG - Intronic
982222617 4:153137908-153137930 ACTGAAAAAAAAAATGGGCATGG + Intergenic
982270906 4:153587018-153587040 AGTGAGAAAAAAAATAAAGATGG - Intronic
982369449 4:154618753-154618775 GCTGTGAACAAAAATGAAGAAGG + Intergenic
982395338 4:154909843-154909865 AGTGAGGAAAAAAATGAGGCAGG - Intergenic
982781830 4:159499324-159499346 ACTGTAAAACAAAATTAGGATGG + Intergenic
982906086 4:161074200-161074222 AGTGGGAAAAATAATGATAATGG + Intergenic
983554430 4:169047138-169047160 TCAGGGAAAAAAATTGGGGAGGG + Intergenic
984680673 4:182605635-182605657 AATGGGAAGAAACATGAAGAGGG + Intronic
984885687 4:184447182-184447204 CCTGGGAAAGGAAATAAGGAAGG + Intronic
985189154 4:187352870-187352892 ACTGGGGAAAAAGATTTGGATGG - Intergenic
985769944 5:1803050-1803072 AGTGGGAAAAAGAATGAATAAGG - Intronic
986193423 5:5517099-5517121 ACTGGGCACAGAGATGAGGAAGG - Intergenic
986503551 5:8426820-8426842 ACTGGGAAAAACAAAAATGAGGG + Intergenic
986840716 5:11694132-11694154 ACTAGGAAAAAACATGAAAATGG + Intronic
987255736 5:16149128-16149150 ACTGGGCAAGGAAATGAGAAGGG - Intronic
987343144 5:16956055-16956077 TCAGGGAAAAAAAAAGAGGGGGG + Intergenic
989500162 5:42157151-42157173 CCTGGGAACAAAACTGAGAAGGG - Intergenic
989564993 5:42893217-42893239 ACTGATCAAAAAATTGAGGAGGG - Intergenic
989770651 5:45140753-45140775 ACTGGGTAAAGAAAAGAGAAAGG - Intergenic
990905266 5:60796184-60796206 AGTGAGAAAACAGATGAGGAAGG - Intronic
991201954 5:64005104-64005126 AGTGTGAAAAAAAATGCTGAAGG + Intergenic
991273143 5:64809992-64810014 ACTAGAAAAAAAAAAGAGGCGGG - Intronic
991369721 5:65905363-65905385 ACTGGGAAAACAAAAGAGCTCGG + Intergenic
991377507 5:65981542-65981564 ACTGGTATAAAAAATGAGGGAGG + Intronic
992482542 5:77166345-77166367 AATGGGATACAAAATGAGAAGGG + Intergenic
992629661 5:78667956-78667978 AAGGGGAAGAAAAAGGAGGAGGG - Intronic
993103164 5:83566576-83566598 ACCAGGAAAAAAAAAGATGATGG - Intronic
993505097 5:88699650-88699672 AAAGGGAAAAAAAAAGAGAAAGG - Intergenic
993904405 5:93606817-93606839 ACTGGGAAAAAAATTGTGTGTGG + Intergenic
994125474 5:96165171-96165193 AGTGGGAAAAAAAAAGACTAAGG - Intergenic
995037453 5:107551136-107551158 TCTGGAAAAAAAGATGATGATGG - Intronic
995167472 5:109061731-109061753 ACTGGGAATAAAGCTGTGGAGGG + Intronic
995542963 5:113202209-113202231 AGGGGGAAAAAAAAAAAGGAAGG + Intronic
995857847 5:116612358-116612380 ACAGGTAGAGAAAATGAGGAGGG + Intergenic
995948982 5:117686656-117686678 AGTGGGAAAAAAAATAGGGCAGG + Intergenic
996319019 5:122192950-122192972 AATGGGAACAAAAATGGGAAAGG - Intergenic
996354677 5:122582387-122582409 ACTGAAATAAGAAATGAGGAAGG - Intergenic
996453412 5:123653900-123653922 TTTGGGAAAAAAAGTGAGGTAGG + Intergenic
996588081 5:125113814-125113836 ACAGTGAAAGAAAAAGAGGAAGG + Intergenic
996813616 5:127548100-127548122 CCTGGAAAACAAAAGGAGGAAGG - Intronic
996884753 5:128341740-128341762 CCTGGGATGAACAATGAGGAAGG - Intronic
996913896 5:128688133-128688155 ACTGGGAAAATAAAAGAATAAGG + Intronic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997317956 5:132953753-132953775 AGTGGAAAAAGAAGTGAGGAGGG - Intronic
997963405 5:138338810-138338832 ACTGAAGAAAAACATGAGGAAGG - Intronic
999535948 5:152517827-152517849 ATTGGGTAAAAAGATAAGGATGG - Intergenic
999551762 5:152695265-152695287 GCTGAGAAGAAAAATGAGGCTGG - Intergenic
999602459 5:153282376-153282398 ACTGAGAAAAATAAAGAGTAAGG - Intergenic
999659563 5:153845579-153845601 AGTGGGAAAGAAAATGGGAAAGG + Intergenic
999684208 5:154087988-154088010 ACTCAGAAATGAAATGAGGATGG - Intronic
999712115 5:154328078-154328100 AAGGGGAAAAAAAAAAAGGAGGG + Intronic
999795785 5:154988664-154988686 AGTGGGAAACAGAAAGAGGATGG - Intergenic
999889302 5:155959343-155959365 ACTTGGAGAAAACATAAGGAAGG - Intronic
1000040446 5:157481002-157481024 ACTGGGAAGAAAAAGAAGGGAGG + Exonic
1000166659 5:158656295-158656317 ATAGGGAAAATAAATGAGTAAGG - Intergenic
1000532710 5:162443986-162444008 ACTGGAAAAAGCAATGAGGCAGG - Intergenic
1000731399 5:164838651-164838673 AATAGGAAAGAAAAGGAGGAAGG - Intergenic
1000767730 5:165312751-165312773 GCAGGGAAAAAAAATGAGAGGGG - Intergenic
1001649175 5:173303172-173303194 ACTGGGAAAAAAATAGAGTTTGG - Intergenic
1002349861 5:178576531-178576553 TCTTTGAAAAATAATGAGGACGG - Intronic
1002416657 5:179124357-179124379 GCTGGGAGGAAGAATGAGGATGG - Intronic
1002590461 5:180287933-180287955 AATGGGAGAAAAAATGCGGTAGG + Intronic
1002924541 6:1597370-1597392 ACTGAGAATTAACATGAGGATGG - Intergenic
1002958668 6:1893525-1893547 ACTGAGAATGAAAAAGAGGATGG - Intronic
1002965888 6:1966174-1966196 ACTGGGAGCCAAAATGAGTAGGG + Intronic
1002968211 6:1989030-1989052 ACTGTAAGAAAAAATGAGCATGG - Intronic
1003461748 6:6335065-6335087 TCTGAAAAAAAAAATGAGAAAGG - Intergenic
1003782065 6:9440405-9440427 AATGGGAAAAAAAATTATGGTGG - Intergenic
1003788021 6:9509502-9509524 ACTGTTATAAAAAATGAGCAAGG + Intergenic
1003884721 6:10511295-10511317 CCTGTGTAAACAAATGAGGACGG + Intronic
1004097549 6:12573295-12573317 GCTGGGGGGAAAAATGAGGATGG + Intergenic
1004630899 6:17420172-17420194 ACTGGGGATAAAAATGGGGCAGG - Intronic
1004689526 6:17980998-17981020 TCTGGGGAAAGAAATGAAGAGGG + Intronic
1005503834 6:26452786-26452808 TGTGGGAAAAAAAATCAGGCTGG - Exonic
1006155958 6:32012920-32012942 ACTGGAAAACAAAATGAGCGGGG - Intergenic
1006162291 6:32045774-32045796 ACTGGAAAACAAAATGAGCGGGG - Exonic
1006671595 6:35732688-35732710 ACTGGTAAAGAGAATGAGGAAGG + Intergenic
1006884029 6:37365098-37365120 ACTGGGAAAAAAAACAACTAGGG + Intronic
1007231604 6:40352020-40352042 ACTGATGAAAAAAATGAGGCAGG + Intergenic
1007238419 6:40407610-40407632 ACTTGGAGAAAAAATGCAGAAGG + Intronic
1007266813 6:40602529-40602551 AATGGGAAAAAGAAAGAGGCAGG - Intergenic
1007755577 6:44097226-44097248 AGTGGGTAAATAAATGTGGAAGG - Intergenic
1008110169 6:47483466-47483488 ACAGGGAAACAAAATGAGACAGG + Intronic
1008200392 6:48580769-48580791 ATTTAGAGAAAAAATGAGGAAGG + Intergenic
1008714044 6:54266758-54266780 ACTGGGAAATAAATTGAAGATGG - Intergenic
1008761740 6:54860261-54860283 ACTTAGAAAAAAAATGAAGCTGG + Intronic
1009645832 6:66400017-66400039 ACTGGAAATAGGAATGAGGAGGG + Intergenic
1010249826 6:73696118-73696140 AGAGGGAAAAAAAATCAGGGAGG + Exonic
1010880946 6:81170941-81170963 GATGTGAAATAAAATGAGGAGGG - Intergenic
1011262451 6:85483569-85483591 ACTGGGGAAAAAAAAGAAAAAGG - Intronic
1011701125 6:89955862-89955884 AATGGGAAAAAATAAGAGGGGGG + Intronic
1011802710 6:91035861-91035883 GCTGAGTAAAAAAATGAGTAAGG + Intergenic
1012462552 6:99479849-99479871 TCTTGGAAAAAAAATGAAAAAGG - Intronic
1012592575 6:101000769-101000791 ACTGGGTAAAAAAATGTGTAAGG + Intergenic
1012835865 6:104266369-104266391 ACTTTGGAAAAAAATGAAGAAGG - Intergenic
1012843401 6:104359159-104359181 ATTAGGAAAAAAAAAGAGGCAGG + Intergenic
1012846682 6:104398405-104398427 ACTGGGATGAAAAAGGATGAAGG - Intergenic
1013637163 6:112039879-112039901 ACTGGGGAAAAAAAAGAATATGG + Intergenic
1013687181 6:112599199-112599221 TCTGGAAAACAAAATGAAGAGGG + Intergenic
1013921184 6:115406238-115406260 AAAGGAAAAAAAAATCAGGATGG - Intergenic
1014068322 6:117152157-117152179 GAAGGGAAAAAAAGTGAGGAGGG + Intergenic
1014075264 6:117228183-117228205 ACAGAGAAACAAAGTGAGGAGGG - Intergenic
1014638153 6:123874439-123874461 ACTGGGAAAAGGCATGAGTAGGG + Intronic
1014750531 6:125250620-125250642 ATTGGGAAAAACAATGAGCAGGG - Intronic
1014906759 6:127039596-127039618 ACTGATAAAAAAAATTAAGAAGG + Intergenic
1014937566 6:127401747-127401769 ACTCAGAAATAAAATGAGAAGGG + Intergenic
1015112445 6:129609001-129609023 AGAGGAAAAAAAAAAGAGGAGGG + Intronic
1015129347 6:129792452-129792474 ACTGGGTAAAAGAAAGAGGGTGG + Intergenic
1015425037 6:133055563-133055585 ACTGTGAAAAAAAGTCAGAAGGG + Intergenic
1015542429 6:134328635-134328657 ACTTAGAAAAAGAATGAGGCTGG - Intergenic
1015681825 6:135817117-135817139 ACTGGGGAAAAAAATGGCAATGG + Intergenic
1015739600 6:136439657-136439679 AGTGGGAAACAAAATGTAGAGGG - Intronic
1016505670 6:144776261-144776283 ACTGGGAAAAAATGTGGAGACGG - Intronic
1017167407 6:151422605-151422627 ACTGGGAAAAAAATTAATAATGG + Exonic
1017399392 6:154041857-154041879 AAAGGGTAGAAAAATGAGGAAGG - Intronic
1018306188 6:162458643-162458665 ACTGGGAAAAAAAAAAAAAAAGG - Intronic
1018936732 6:168278691-168278713 ACTGAGATTTAAAATGAGGAGGG - Intergenic
1019135408 6:169904710-169904732 AGCGGGAAATAAAATGACGAAGG + Intergenic
1020385046 7:7591944-7591966 AGTGGGAAAAAAAACATGGAAGG - Intronic
1020392844 7:7677378-7677400 AGAGGGAAATAAAATGGGGATGG - Intronic
1020799963 7:12721118-12721140 ACTGGAAAAAACAAGGAAGAAGG - Intergenic
1020808582 7:12822892-12822914 ACTAGTCAAAAAATTGAGGAGGG + Intergenic
1021132588 7:16928973-16928995 AAGGGGAAAAAAAATAAAGATGG - Intergenic
1021899874 7:25274741-25274763 AATGGGAAATAAAATGAGAAAGG - Intergenic
1021915605 7:25429317-25429339 AATGGAAAACAAAATGAGAATGG - Intergenic
1022010158 7:26301812-26301834 ACTGGAAAAAAAAATGGGTATGG - Intronic
1022386674 7:29905825-29905847 ATGGGGAAAAAAAAAGAGCAAGG - Intronic
1023449249 7:40265017-40265039 ACTGAGAAAAAAACTAAGAAAGG + Intronic
1023726924 7:43152198-43152220 TCTGGGAAAAAAAATGTTCAAGG + Intronic
1023896339 7:44436010-44436032 CATGGGACAAAAAATGAGAAGGG + Intronic
1024111085 7:46146702-46146724 ACTGGTAATAAAAATTATGAGGG - Intergenic
1024143535 7:46486689-46486711 ACTGAGAATAAAAATGAAAAAGG - Intergenic
1024891015 7:54203729-54203751 ACTGTGAATAAAGATGGGGAGGG - Intergenic
1025262998 7:57433603-57433625 ACTGGGGATAAAAATAAAGAGGG + Intergenic
1025604293 7:63028264-63028286 AGTGTGAGAGAAAATGAGGAAGG + Intergenic
1026338895 7:69418793-69418815 ACATGAAAAAAAAATTAGGAGGG - Intergenic
1026456661 7:70578642-70578664 GTTGGGAAAAATAATGAAGAGGG - Intronic
1026482812 7:70793347-70793369 ACAGGAAAAAAAAATCTGGAAGG - Intergenic
1026688985 7:72536192-72536214 ACTGGGAAAAAAAAAAAAAAAGG + Intergenic
1027439919 7:78208604-78208626 ATTGGCAAAGAAAATGTGGAAGG + Intronic
1027467536 7:78534832-78534854 ATTAGAAAAAAAAATGAGTAAGG + Intronic
1027473477 7:78601332-78601354 GCTAAGAAAAAAAATGAGGCTGG + Intronic
1027640082 7:80722523-80722545 ACTGGGAGGAAGAATGAGGGAGG - Intergenic
1028564442 7:92212766-92212788 ACTAGGAATAAAAGTAAGGAGGG - Intronic
1029408643 7:100393792-100393814 CCTGGCAAAAAATAGGAGGAAGG + Intronic
1029870564 7:103687551-103687573 GATGGGGAAAAAAATCAGGAGGG - Intronic
1030473460 7:109998360-109998382 ACTGGAAAAAAAAATTAGATAGG - Intergenic
1030486801 7:110179074-110179096 AGAGGGAAAAGAAAGGAGGAAGG + Intergenic
1030515821 7:110536437-110536459 ACTGGGAAAAAATACGGTGATGG + Intergenic
1030555453 7:111019208-111019230 AGAGGGAAAAAAACTGACGAGGG + Intronic
1030916207 7:115316941-115316963 ATTGCCAAAACAAATGAGGAAGG + Intergenic
1031018957 7:116605954-116605976 ACTGGGAAACAAATTAAGGAGGG + Intergenic
1031030063 7:116724675-116724697 AATCGGAAAAAAAATCAGCAAGG + Intronic
1031040440 7:116833490-116833512 TCTGGGGAAAAAAATAAGAAAGG - Intronic
1031284774 7:119853198-119853220 ACTGGGAAAAGAAATTAGCTGGG - Intergenic
1031705258 7:124972945-124972967 ACAGGCAAAAAAAATGAGGTCGG + Intergenic
1032045096 7:128599716-128599738 ACAGGCAAAAAAAATGAAGTTGG - Intergenic
1032171030 7:129584744-129584766 CCTGGAAAAAAAGATGAGAAGGG + Intergenic
1032585023 7:133138429-133138451 ATTTAAAAAAAAAATGAGGAAGG - Intergenic
1033027067 7:137784875-137784897 ACTGGGTAAACAAATCACGATGG + Intronic
1033137384 7:138796696-138796718 GATGGGAATAAAAAGGAGGATGG - Intronic
1033426347 7:141248030-141248052 ACTGAAAAAAAAAAAGAGAAAGG - Intronic
1033500638 7:141945673-141945695 GTAGGGAAAATAAATGAGGAAGG - Intronic
1033606858 7:142933829-142933851 CCTGGGGAAGAAAAGGAGGAGGG + Intergenic
1034143533 7:148847267-148847289 ACTGGGAAGAAATCTGAGAAGGG - Exonic
1034249044 7:149673619-149673641 ACTGAGAAAAAAAATCACAATGG + Intergenic
1034309318 7:150072684-150072706 ACTGGGAAATAAACTGAGGCAGG + Intergenic
1034328293 7:150258111-150258133 ACTAGGAAAAAAAGTTAGAACGG + Intronic
1034764923 7:153711353-153711375 ACTAGGAAAAAAAGTTAGAACGG - Intergenic
1034797537 7:154027952-154027974 GCTGGGAAATAAACTGAGGCTGG - Intronic
1035417546 7:158703213-158703235 ACTGACAAAGAAAATGGGGAGGG + Intronic
1036387348 8:8294051-8294073 CCTGGGAAAGAAGAAGAGGAGGG + Intergenic
1036508554 8:9379298-9379320 ACTTTTAAAAGAAATGAGGAAGG - Intergenic
1036524574 8:9522691-9522713 AATGGGAAAAAAAAGGTGAATGG + Intergenic
1036537630 8:9665965-9665987 ACAGAGAGAAAAAAAGAGGAGGG - Intronic
1036775970 8:11613384-11613406 CCTGTGAAAAAAAATGAGAGTGG + Intergenic
1037298286 8:17424313-17424335 GCTGGAAAAAGAAAAGAGGAGGG + Intergenic
1037453439 8:19039930-19039952 ACTGTGAAGAAAAATGAAGCAGG + Intronic
1037540228 8:19863707-19863729 ACTGGGAGAAAAAGTGAGACCGG - Intergenic
1038111792 8:24508044-24508066 AAAGGGAAAGAAAATGAGCATGG + Intronic
1038989723 8:32854925-32854947 TTTGGGAAAAAAAAAAAGGAGGG + Intergenic
1039334871 8:36577680-36577702 AATGCCAAAAAAAAAGAGGATGG - Intergenic
1039889564 8:41674837-41674859 ACTAGGAAGAACAAGGAGGAAGG + Intronic
1040110535 8:43565178-43565200 GTTGGGAAAAAAACTGAGGCAGG + Intergenic
1040385889 8:46914781-46914803 ACTGGGAGAAGGAATCAGGAGGG - Intergenic
1040537178 8:48320625-48320647 AAGGGGAAAATAAAGGAGGAAGG + Intergenic
1040793260 8:51258560-51258582 AATGGGAAGAAGAATGAGAAGGG + Intergenic
1040889443 8:52301811-52301833 AATGAGGAAAAAAAGGAGGAAGG - Intronic
1041234395 8:55784882-55784904 ACTGTGCAAAATACTGAGGATGG - Intronic
1041371650 8:57167155-57167177 ACTGAAAGAAAAAATGAGGGAGG - Intergenic
1041689099 8:60671944-60671966 ACAGGGGGAAAAAGTGAGGATGG - Intergenic
1041883554 8:62781261-62781283 ACTGATGAAAGAAATGAGGAGGG + Intronic
1042107963 8:65348865-65348887 ACTGAAAAAAAAAATGAAAATGG - Intergenic
1042281802 8:67064071-67064093 CCTGGAAAGAAAAATGGGGAGGG - Intronic
1042533110 8:69834350-69834372 GCTGAGAAAAGAAAGGAGGAAGG + Intronic
1042852748 8:73233107-73233129 AGTGGGAAGAAGAAGGAGGAAGG - Intergenic
1043211000 8:77517727-77517749 ACTTGCAAGAACAATGAGGATGG + Intergenic
1043545047 8:81306169-81306191 GCTGTGAAAAAAATTAAGGATGG + Intergenic
1043570222 8:81594668-81594690 ACCAAGAAAAAAAATAAGGAAGG - Intergenic
1043611812 8:82073603-82073625 GCAGTGAAAGAAAATGAGGAAGG - Intergenic
1046123570 8:109876220-109876242 AATGGGAAAAAAATTGTGTAAGG - Intergenic
1046234934 8:111411345-111411367 ACTGGAAAATACAATGGGGAAGG - Intergenic
1046652765 8:116856458-116856480 ATTGGCCAAAAAAATGGGGAGGG + Intronic
1046940927 8:119930810-119930832 CCTGGAAAACTAAATGAGGAAGG - Intronic
1047042308 8:121009524-121009546 ATGGGGAAAAAAAATGACCAAGG + Intergenic
1047340041 8:123972214-123972236 AGTGGAAAGAGAAATGAGGAGGG + Intronic
1047414536 8:124653130-124653152 GATGGGAAAGAAACTGAGGAAGG + Intronic
1047875524 8:129132997-129133019 ACTGGGTGGAAAAATGAGAATGG - Intergenic
1047936900 8:129790570-129790592 ATTTGAAAAAAAAATCAGGAGGG + Intergenic
1048412430 8:134189228-134189250 AGAGAGAAAAAAAATGAGAAAGG - Intergenic
1048711706 8:137219192-137219214 CGAGGGGAAAAAAATGAGGAAGG + Intergenic
1048748172 8:137639145-137639167 CCTGGGGAAAGAAATGAGGCAGG - Intergenic
1048809098 8:138268984-138269006 AATGTGAAAGAAAAAGAGGAGGG + Intronic
1048936474 8:139361714-139361736 ACTGGGAAAAGTAATGAGTGAGG - Intergenic
1049904431 9:202880-202902 ATAGGGAAGAAAAATGAGGAAGG + Intergenic
1050101459 9:2124279-2124301 ACTGAGAATCAAAATGTGGAAGG + Intronic
1050218444 9:3357583-3357605 GCTGGGAAGGGAAATGAGGAAGG + Intronic
1050624161 9:7485947-7485969 ACTGGGAAAAAAAGAGTTGATGG + Intergenic
1050737534 9:8781085-8781107 ACTGGAAAAAAAAAAGTGGTTGG - Intronic
1051159560 9:14191438-14191460 AATGGGAAAATAAATGATGACGG + Intronic
1051164759 9:14249718-14249740 AAAGGGAAAAGAAATGAGGAAGG + Intronic
1051918105 9:22231159-22231181 GTTGGGAAAAAAACTGAGGCAGG - Intergenic
1052062665 9:23979854-23979876 AGTGGGAAAAAAAAAAAGGAGGG - Intergenic
1052200948 9:25779166-25779188 ACTGAGAACTAACATGAGGAGGG - Intergenic
1052202169 9:25796439-25796461 ACTGGGAAGAAACATTAGAAAGG - Intergenic
1052263809 9:26548648-26548670 ACTGGGGGAAAGAATGAGGTAGG - Intergenic
1052288032 9:26809255-26809277 ACTGTTAAAAGAAATGAGGGTGG + Intergenic
1052540230 9:29802242-29802264 AGGGGGGAAAAAAAGGAGGAGGG - Intergenic
1052719978 9:32162660-32162682 ACTTGGCAAAAGAAAGAGGAGGG - Intergenic
1052930749 9:34053489-34053511 ACTGGTAAAAAAGATGGGGATGG - Intergenic
1053243145 9:36513189-36513211 TCTGGAAAAAAAAAAGAGGTGGG + Intergenic
1053376807 9:37614327-37614349 AATGGGAAATAACATGGGGAAGG + Intronic
1053727003 9:41014454-41014476 ATAGGGAAGAAAAATGAGGAAGG + Intergenic
1054869989 9:70040353-70040375 GCAGGGAAAAAGACTGAGGAGGG - Intergenic
1054925686 9:70586497-70586519 TCAGGGACAGAAAATGAGGATGG + Intronic
1055087083 9:72325347-72325369 GGGGGGAAAAAAAATGATGAAGG - Intergenic
1056017527 9:82406256-82406278 ACTGGGACAAATAAGGAGGAAGG - Intergenic
1056703238 9:88928436-88928458 ACTGCAAAAAAAAATGAAGTTGG - Intergenic
1057183122 9:93040431-93040453 ACTGGGGAGAAAACTGAGGTTGG + Intergenic
1057538593 9:95942493-95942515 TCTGGGAAAAAAAATGGAGAGGG + Intronic
1058383132 9:104401246-104401268 ACTGAAAAAAAAAATGAACAGGG - Intergenic
1058561051 9:106229520-106229542 ACTGGGAAACAAGACTAGGAAGG - Intergenic
1058566672 9:106293001-106293023 ATTGGGAAAATAAATGACGGGGG + Intergenic
1058574947 9:106390843-106390865 ACTGGGAAGATAAATGAAGGAGG + Intergenic
1058605790 9:106721400-106721422 ATCGGAAAAAAAAATGGGGAGGG + Intergenic
1058810312 9:108632742-108632764 TTTGGGAAAAGAAATGAAGAGGG - Intergenic
1058840570 9:108903669-108903691 ACTGACAAAAAAAAGGAGAAGGG + Exonic
1058902021 9:109450369-109450391 ACTGAGAGAAAAAAAGAGAAAGG + Intronic
1059238434 9:112782388-112782410 AGTAGGTAAACAAATGAGGATGG - Intronic
1059886961 9:118756566-118756588 ATTGGGAAAAAAATTTATGATGG - Intergenic
1059946940 9:119418841-119418863 ACTGGAAAAAAGAATAGGGATGG + Intergenic
1060017763 9:120101705-120101727 ATTGGGAAAAAAGAGTAGGATGG - Intergenic
1060419931 9:123461138-123461160 ACTGGCAAAAGCAATGAAGAAGG - Intronic
1186039915 X:5464380-5464402 ACAGAGAAAAAATATGAGAAAGG + Intergenic
1186143178 X:6598708-6598730 AGTGGGAAAAGAAAAGAAGAAGG - Intergenic
1186296609 X:8155578-8155600 ACTGGCAAAGAAAAGGAGGTGGG + Intergenic
1186433712 X:9525981-9526003 ACTAGAAACAAAAATGAGGCAGG - Intronic
1186785983 X:12956249-12956271 CCTGGGAAAACAGATGAGGCTGG - Intergenic
1187261547 X:17689197-17689219 GAAGGGAAAAAAGATGAGGAGGG - Intronic
1187261551 X:17689215-17689237 AAAGGAAAAAAAGATGAGGAAGG - Intronic
1187456860 X:19448922-19448944 GCTGGGAAAAAAAAGTAGAATGG - Intronic
1187490484 X:19746948-19746970 ACAAAGAAAAAAAATAAGGATGG + Intronic
1187550854 X:20303979-20304001 ACTTAGAGAAAATATGAGGAGGG - Intergenic
1187868748 X:23747129-23747151 AAAGGTAAAAAAAATGAGCAGGG + Intronic
1187937440 X:24349737-24349759 ACTGGAAGAAAACATGAGGGGGG - Intergenic
1188310757 X:28613666-28613688 ACTGGGCAAGAGAATGTGGATGG - Intronic
1188412635 X:29892716-29892738 AATGGGAAACAATGTGAGGATGG + Intronic
1188695664 X:33187630-33187652 AGTGGGGCAAAAAATGAGGTAGG + Intronic
1188870746 X:35367935-35367957 AATAGAAATAAAAATGAGGAAGG + Intergenic
1189165540 X:38857419-38857441 TTTGGGAAACAAAATGAGGAGGG - Intergenic
1189371929 X:40435538-40435560 TCTGGGGAAACAAATGAGAAGGG + Intergenic
1189417884 X:40831201-40831223 ACTGTGAAAAAAAAATAGAAAGG - Intergenic
1189438183 X:41011045-41011067 ACTGGGGAAATAGATGAGAAAGG + Intergenic
1190087691 X:47409950-47409972 GCTGGGTTAAAAAATGAAGAAGG - Intronic
1190722433 X:53161100-53161122 ACTGGAAAAACAAATAAAGAAGG - Intergenic
1190922919 X:54873599-54873621 AATGGGAAAAAAAATGGACAGGG - Intergenic
1191159257 X:57310880-57310902 ATTGGGAAAATAAATGATAATGG + Intronic
1192368290 X:70493354-70493376 ACTGTGAAAGAACATGAAGATGG - Intronic
1193299489 X:79872582-79872604 ACTGGAAAAAAAAAGGTGGGGGG + Intergenic
1193753505 X:85377573-85377595 ACTGGGATAAAAGATTAGAATGG - Intronic
1194291527 X:92078671-92078693 GCTTAGAAAAAAAATGAGTAAGG - Intronic
1194424239 X:93717164-93717186 AATGGGAAAAAAAATGTTCAAGG + Intergenic
1194607275 X:95996338-95996360 ACTGTGAAAAGAATTTAGGAAGG - Intergenic
1194666955 X:96685593-96685615 ACTTGGAATAAAAAGGAGGGAGG - Intronic
1194747771 X:97647895-97647917 ACAGTGAAAAAAAATGACAAGGG - Intergenic
1194768611 X:97872519-97872541 ACTAATATAAAAAATGAGGAAGG - Intergenic
1194888602 X:99349741-99349763 ACTGATAAAAAAAATGTAGATGG - Intergenic
1195080639 X:101366737-101366759 ACTGGGAAAAAAAATGCCTTTGG + Intronic
1195890497 X:109688379-109688401 GCAGGGAAAATTAATGAGGAAGG - Intronic
1197020356 X:121680263-121680285 CGTGGGATAAAAAATGAGTAGGG + Intergenic
1197371563 X:125632922-125632944 TCTGTGAAAAAAAATGATGTTGG - Intergenic
1197448085 X:126577403-126577425 ATTGGGAAAAAATATGAAAATGG + Intergenic
1197521509 X:127504012-127504034 ACTGTGAAAAAAAGAGTGGATGG - Intergenic
1197670348 X:129270363-129270385 ACTATGAAAAGAAATAAGGAAGG - Intergenic
1197794958 X:130288652-130288674 TCTTAGAAAAAAAAAGAGGAAGG - Intergenic
1197838822 X:130723715-130723737 CCTGGGAAACAAAATGGGGAGGG - Intronic
1198273545 X:135079081-135079103 CTAGGGAAAAAAAAGGAGGAGGG - Intergenic
1198344578 X:135747093-135747115 GTTGGGAAAAAAACTGAGGCAGG + Intergenic
1198739435 X:139825188-139825210 GGAGAGAAAAAAAATGAGGAAGG + Intronic
1198871537 X:141180930-141180952 AAGGGGAAAGAAAATGAGGAAGG - Intergenic
1198875939 X:141226503-141226525 ACTGGCAAGACAAATAAGGAAGG - Intergenic
1199026717 X:142947935-142947957 ACTGGCAAAACATATGAGGTTGG - Intergenic
1200308845 X:155056958-155056980 GCTGGGAAAAAACTTCAGGAGGG - Exonic
1200609045 Y:5303253-5303275 GCTTAGAAAAAAAATGAGTAAGG - Intronic
1201596695 Y:15678396-15678418 ACTGATAAAGAACATGAGGATGG + Intergenic