ID: 906812018

View in Genome Browser
Species Human (GRCh38)
Location 1:48836862-48836884
Sequence CTTTTATGTGCTGGTTGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 219}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906812018 Original CRISPR CTTTTATGTGCTGGTTGTAG AGG Intronic
901009371 1:6190753-6190775 CTGTTATGTGTTGGTTTTTGAGG - Intronic
901618594 1:10562661-10562683 CTTTGATCTGTTGGTTGAAGTGG + Intronic
902855812 1:19203869-19203891 CTTTTGAGTGCTGCTTGTTGTGG - Intronic
904144274 1:28377525-28377547 CTTTGATGGGCTGGGTGTGGTGG - Intronic
906812018 1:48836862-48836884 CTTTTATGTGCTGGTTGTAGAGG + Intronic
907425497 1:54376718-54376740 CTTTGATGCGCTGGTGGTGGAGG - Intronic
907591737 1:55680215-55680237 CTTTTATGCACTGCTGGTAGTGG - Intergenic
908751101 1:67423893-67423915 CTTTTAAGGGCTGGGTGCAGTGG + Intronic
908992120 1:70103827-70103849 CTTTTATCTCCTGGTTTTATGGG + Intronic
910882049 1:91930440-91930462 CTTTTATTTGGTGGTGGTGGGGG + Intergenic
911004175 1:93200260-93200282 TTGTTATGTGCTGGGTGTGGTGG - Intronic
912805305 1:112752044-112752066 CTTTTATTGGCTGGGTGTGGTGG + Intergenic
915126334 1:153667780-153667802 CTTTCATGTGGTGGTTTTGGGGG - Intronic
917420171 1:174855023-174855045 CATTTATGGGCTGGGTGTGGTGG - Intronic
923659344 1:235945037-235945059 CTTTTAGGGGGAGGTTGTAGCGG - Intergenic
924488806 1:244514453-244514475 CTCTTGTGTTCTGGTTGTGGTGG + Intronic
924597194 1:245457151-245457173 CATTTATGGGCTGGGTGCAGTGG - Intronic
924813313 1:247422089-247422111 CTTTTATGGGCTGGGCGCAGTGG + Intronic
1065676590 10:28181850-28181872 TTTTTATGTGCTGGCTCTAGCGG - Intronic
1069529088 10:69202124-69202146 ATTTTATGGGCTGGGTGTGGTGG - Intronic
1070095820 10:73337615-73337637 CTTTTATCTGCTGGGTGCAGTGG + Intronic
1071336651 10:84605908-84605930 TCTTTATGTGCTGGTAGTGGCGG + Intergenic
1072597082 10:96883641-96883663 CTTTGATGAGGTGTTTGTAGAGG + Intronic
1073947871 10:108773104-108773126 GTCTTCTGTGTTGGTTGTAGTGG - Intergenic
1075377665 10:121992130-121992152 GTTTTATGTGTTGGTGCTAGTGG + Intronic
1076537934 10:131194966-131194988 CTTTGATGGGCTGGATTTAGTGG - Intronic
1078520529 11:12059455-12059477 TCTTTATGTGCTGGGTGCAGTGG - Intergenic
1079017500 11:16881647-16881669 TCTTTATGTCCTGGTTCTAGAGG - Intronic
1079044777 11:17091678-17091700 TCTTTATTTACTGGTTGTAGTGG + Intronic
1079197819 11:18345774-18345796 CTCATATGTGCTGGGTGTGGTGG - Intronic
1079917168 11:26383761-26383783 CATTTATTTGCCGGTTTTAGTGG - Intronic
1086174142 11:83869772-83869794 CTTTTAAGTGCTACTTGTAAAGG + Intronic
1087436653 11:98127767-98127789 CTTTTATATGTTGGTTGGATTGG + Intergenic
1088150751 11:106742205-106742227 CTTTTATGTGCAGGATGTGCAGG + Intronic
1088684054 11:112270438-112270460 TTTTTATGGGCTGGGTGCAGTGG - Intergenic
1089542047 11:119195154-119195176 CTGTTATGTGCTGGTCGGTGAGG - Intronic
1089695425 11:120213245-120213267 CTGTGATGTGCTGGCAGTAGTGG + Intronic
1090368988 11:126233793-126233815 CTTTTTTGGGCTGGGTGCAGTGG + Intronic
1092315963 12:7413662-7413684 CTTGCATGTGCTGCTTGCAGAGG - Intronic
1092578651 12:9816250-9816272 CTTGTTTGTGCTGGGTTTAGAGG - Intergenic
1093125638 12:15324738-15324760 CTTCTATGTGCTGGTTTTTTAGG + Intronic
1093654665 12:21681077-21681099 CTTTTGTGTGGTGGTGGTGGTGG + Intronic
1096911483 12:54988997-54989019 CTTCTATGTTCTGGTTGTTAAGG + Intergenic
1097948152 12:65396401-65396423 GTTTTATGGGCTGGGTGCAGTGG + Intronic
1098026711 12:66211821-66211843 CTTTTCTGGGCTGGGTGTGGTGG + Intronic
1099867653 12:88304049-88304071 CTTTTATGTGTTGGTTCTACAGG + Intergenic
1101947331 12:109147530-109147552 CTTTTAGGAGCCGGTTGTGGAGG - Intronic
1102071000 12:110019588-110019610 CTTTTATGTGCCCTTTCTAGTGG + Intronic
1103590186 12:121986610-121986632 TTTTTAATTGCTGGATGTAGTGG + Intronic
1105295036 13:19081283-19081305 CTTTGATTTGCTGGTTTTGGGGG - Intergenic
1105833175 13:24183807-24183829 CTTCTCTGTGCTGGGAGTAGAGG + Intronic
1105976577 13:25479131-25479153 ATTTTATGGGCTGGGTGTGGTGG - Intronic
1107503292 13:41003219-41003241 CTTTTTTGTGCTCTTTGTTGGGG - Intronic
1109283733 13:60387552-60387574 CTTGTATGAGCTGGATGTATAGG + Intergenic
1111975000 13:94957088-94957110 CTTTTCTTTGGTGGTTGGAGTGG + Intergenic
1112306788 13:98281565-98281587 CTTTCTTGTGCTTGTTGTATGGG - Intronic
1113380204 13:109797139-109797161 CTTTTCTGTGCTGCTTGCATTGG + Intergenic
1114200034 14:20511495-20511517 GTCTTATGTGATTGTTGTAGAGG - Intergenic
1116845290 14:49859738-49859760 CTTTTATGGGCTGGGCGCAGTGG - Intergenic
1117648126 14:57873961-57873983 TTTTTATGTGCTTGTTGTCATGG - Intronic
1117875090 14:60244041-60244063 CTTTTACATGCTGGTAGTAAAGG - Intergenic
1117942838 14:60987338-60987360 CATTTATTTGCTGGTGGTAAAGG + Intronic
1118288078 14:64495667-64495689 CTTTTATCAGCTGGGCGTAGTGG + Intronic
1118882658 14:69842502-69842524 CTCTGCTGTGCTGGTTCTAGGGG + Intergenic
1121195121 14:92065038-92065060 CTTCTATGTCTTGATTGTAGTGG - Intronic
1123705196 15:22946133-22946155 CTTTTTTGTGTTTTTTGTAGAGG - Intronic
1124357779 15:29009582-29009604 CCTTTAGGTGGTGGTGGTAGTGG - Intronic
1124469054 15:29967321-29967343 CTTTAATGTGCCGGGTATAGTGG - Intronic
1126915450 15:53461162-53461184 CATTCCTGAGCTGGTTGTAGAGG + Intergenic
1127845397 15:62866234-62866256 CTTTTATCTGCTTTTTGTATTGG + Intergenic
1128572196 15:68741887-68741909 CTTTTATCTGGAGGTTCTAGGGG - Intergenic
1128865203 15:71109790-71109812 CTACTATGTGCTAGTTGTAGCGG - Intronic
1129354252 15:74978723-74978745 ATTTCATGTGCTGGCTGTAGAGG - Intronic
1130031609 15:80319406-80319428 CTTTTATGTGCTTTATGTATTGG - Intergenic
1130565772 15:84993588-84993610 CTTTTTTGGGCTGGGCGTAGTGG + Intronic
1131383030 15:91980290-91980312 TTTTACTGTGCTGGGTGTAGAGG + Intronic
1131769847 15:95725288-95725310 CTTCTATGTGGTCGTGGTAGGGG - Intergenic
1131939834 15:97548847-97548869 CTTATAAGGGCTGGTTGCAGTGG - Intergenic
1134081892 16:11330569-11330591 ATTTTGTGTACTGGTTGTGGTGG - Intronic
1134248491 16:12557647-12557669 ATTTTTTGGGCTGGGTGTAGTGG - Intronic
1134646872 16:15875809-15875831 CATTAATGTGCTGGGTGTGGTGG + Intronic
1135925575 16:26690752-26690774 CTTTTATGTGCTCATTTAAGTGG - Intergenic
1136412255 16:30084393-30084415 CTCTTATGTGCTGTTTGGACGGG + Intronic
1137225460 16:46502184-46502206 CTTTTATGAGGTGGTGGTGGTGG - Intergenic
1137634573 16:49974578-49974600 CTTTTATTTGTTTGTTTTAGAGG - Intergenic
1137953741 16:52808267-52808289 CTTATATGGGCTGGGTGTGGTGG + Intergenic
1139252935 16:65513621-65513643 CTATTTTGTGCTGCTTGTGGAGG - Intergenic
1140021728 16:71245479-71245501 CTTTTATCTCCTGGTTGCTGTGG - Intergenic
1140310046 16:73840321-73840343 CTTTTCTGTGATGGTGGTGGGGG - Intergenic
1140731108 16:77857211-77857233 ATTTTATGTTCTGGTTCTGGAGG + Intronic
1140942802 16:79737599-79737621 CTACTATGTGCTATTTGTAGTGG - Intergenic
1141471025 16:84238567-84238589 CTTTTATGTGCAGAATGAAGGGG + Intronic
1142822958 17:2486556-2486578 CTTTTATCAGCTGGGTGCAGTGG - Intronic
1147532870 17:41296310-41296332 CTTTTATGAGATGGTTGGTGAGG - Intergenic
1148517143 17:48230465-48230487 GTTTTATGTGCCGGTTGCAGTGG + Intronic
1149617920 17:58017188-58017210 CTATTATGGGCTGGGTGCAGTGG + Intergenic
1150512158 17:65765815-65765837 CCTTAATGTGCTGGTTGAAAAGG - Intronic
1151148067 17:72059571-72059593 CTTCTATGTGCTAGATGTTGGGG - Intergenic
1151410617 17:73925163-73925185 CTTTTATGGGCTGGGTGGAGTGG + Intergenic
1153353000 18:4102459-4102481 CTCTTTTGTGCTGGATGTAAAGG + Intronic
1153641280 18:7159485-7159507 ATTTTTTTTGCTGGGTGTAGTGG - Intergenic
1155023078 18:21914341-21914363 ATTTTATGGGCTGGGTGCAGTGG - Intergenic
1156562063 18:38136518-38136540 CTTTTTTGTGCTGGTTTTCAAGG - Intergenic
1157902667 18:51534836-51534858 CTTTTATGTGCTGGGATTACAGG + Intergenic
1158034141 18:53004134-53004156 CTTTTCAGTGCTGGTTTTAAGGG + Intronic
1158477750 18:57795248-57795270 CTTTTATTAGCTGGGTGTGGTGG + Intronic
1158924777 18:62244572-62244594 CGTTTATGTGTTGGTTGTGGAGG - Intronic
1161257693 19:3318797-3318819 CTTTTATGGGCTGGGTGCAGTGG - Intergenic
1162075318 19:8182904-8182926 CGTTTATGGGCTGGGTGCAGTGG + Intronic
1164032427 19:21419581-21419603 CTTTTGTATGCTGGTTGTGCTGG + Intronic
1164774011 19:30836776-30836798 CTTTGATGGGCTGGGTGTGGTGG + Intergenic
1165058046 19:33191298-33191320 TTTTAATGTGCTGGGTGTGGTGG - Intronic
1166304595 19:41930508-41930530 CTGTAGTGTGCTGGGTGTAGAGG - Intergenic
1168202013 19:54822335-54822357 CCTTTATATGCTGGGTGTGGTGG + Intronic
1168206827 19:54856391-54856413 CCTTTATATGCTGGGTGTGGTGG + Intronic
932279392 2:70476605-70476627 CTTATATGTGCTCAGTGTAGAGG - Intronic
933284270 2:80367670-80367692 CTTTTATATCCTGCTTGTAATGG + Intronic
933344033 2:81060744-81060766 CTTTTATGTGCTGCTTTGAGGGG + Intergenic
934522677 2:95029856-95029878 CTTTCATGTGCTGCTGGTAGGGG - Intronic
935419366 2:102851403-102851425 CTGTTGTGAGGTGGTTGTAGTGG + Intergenic
936465015 2:112740175-112740197 CTCTTATGAGCTGACTGTAGTGG + Intronic
938321762 2:130370940-130370962 CTTTGATGTTCTGGTAGTGGGGG - Exonic
938798172 2:134735905-134735927 TTTTAATTTGCTGGGTGTAGTGG + Intergenic
939626808 2:144487334-144487356 CTGATATGTGCTGGCTGTTGGGG - Intronic
941039839 2:160608846-160608868 CATTTCTGTGCTGGGTGGAGTGG - Intergenic
941095352 2:161234558-161234580 TATTTATGTGCTGGTTATAGTGG + Intronic
941287751 2:163635278-163635300 CTTATATGGGCTGGGTGTAGTGG + Intronic
941597148 2:167491525-167491547 GTTTTATGGGCTGGGTGCAGTGG + Intergenic
941996808 2:171608861-171608883 TTTTTTTGTGCTGGGTGTAGTGG - Intergenic
942797193 2:179835491-179835513 CTTCGATGTGCTGGTGGTGGGGG + Intronic
943867388 2:192944057-192944079 CTTTTATGTGGTGGTGGTGGTGG + Intergenic
944140983 2:196456592-196456614 CTCTTATTTGCTGATTGCAGTGG - Intronic
944849213 2:203700527-203700549 CATATATGGGCTGGGTGTAGTGG + Intergenic
947596694 2:231416993-231417015 CTTTTCTGGGCTGGTCGTGGTGG - Intergenic
948089059 2:235276721-235276743 CGTTTGTGTGCAGGTTGTTGTGG - Intergenic
948389367 2:237601052-237601074 CTTCTAAATGCTGGTGGTAGAGG - Intronic
1168851583 20:980657-980679 CCTATATGGGCTGGTTGCAGGGG + Intronic
1168909380 20:1434814-1434836 GTTTTGTGTCCTGATTGTAGTGG + Intergenic
1173092545 20:39986961-39986983 CATTTATGTGCTGGTAGAAAAGG - Intergenic
1175115277 20:56677709-56677731 CATTCATGTGCTGGGTGTGGTGG + Intergenic
1175323037 20:58102937-58102959 CTTTTTTGTGGTGGTGGTGGTGG - Intergenic
1176874094 21:14109756-14109778 CTGTTTTGTGATGCTTGTAGAGG - Intronic
1178706149 21:34874753-34874775 CTTTTTTGTGCTGGTTGGCAAGG - Intronic
1179054306 21:37916800-37916822 GTTTTGTCTGCTGGTTGTAGGGG + Intergenic
1180888274 22:19264144-19264166 TTTTAATTAGCTGGTTGTAGTGG + Intronic
1182023620 22:27100804-27100826 CCTTTGTGTGCTGGTAGTGGTGG + Intergenic
1182532489 22:30970583-30970605 CTGTTATCTGCTGCTTGTACTGG + Intergenic
1184212768 22:43045931-43045953 CTTTTCTGGGCTGGGTGCAGTGG + Intronic
951398024 3:22194599-22194621 GTTTTATGTGCTGATTTTATTGG - Intronic
952067411 3:29587925-29587947 CTTTTGTGTCCTGATTGCAGTGG + Intronic
952105949 3:30069571-30069593 CTTTGATGATCTGGTTGAAGTGG - Intergenic
952114830 3:30166317-30166339 GTTTTATGTCTTGTTTGTAGTGG + Intergenic
952194926 3:31065185-31065207 GTTTTATGTCTTGATTGTAGTGG + Intergenic
953700826 3:45194486-45194508 CTTTTTTGGGCTGGGTGTGGTGG + Intergenic
954269571 3:49497010-49497032 TTTTTAGGGGCTGGCTGTAGTGG + Intronic
954640698 3:52096079-52096101 CTGTAATGTGCTGGTGGTTGTGG - Intronic
958448640 3:94245984-94246006 TTTTTGTGTCCTGGTTGGAGGGG + Intergenic
961689340 3:128657383-128657405 CTTTTCTGGGCTGGGTGTGGTGG - Intronic
962646675 3:137447416-137447438 CTTTCTTGGGCTGGTTGTAGTGG - Intergenic
963372089 3:144413123-144413145 CTTTTATTTGTTTGTTGTTGGGG + Intergenic
963690969 3:148502353-148502375 CTTTTATGTCATGGTTGTGAAGG + Intergenic
964724123 3:159796427-159796449 CTTTGATGTGCTGCTTGCAAGGG + Intronic
965420671 3:168454565-168454587 CATCTATGTGCTGATTGTAAAGG - Intergenic
965976795 3:174634620-174634642 CTTTCATGTTCTCTTTGTAGAGG + Intronic
968328464 3:197842795-197842817 TTTTTATGGGCTGGGTGCAGTGG + Intronic
970459068 4:16254818-16254840 CCTTTCTGAGCTGGTAGTAGAGG + Intergenic
971656078 4:29346844-29346866 GTTTTATGGGCTGGGTGCAGTGG - Intergenic
971759347 4:30745256-30745278 TTTTTATGAATTGGTTGTAGAGG + Intronic
972067498 4:34968190-34968212 ATTTTATCTTCAGGTTGTAGAGG + Intergenic
972806256 4:42531930-42531952 CTTTTTTGTGTTTTTTGTAGAGG - Intronic
972812865 4:42609597-42609619 CTTTTAAATGCTGGATTTAGTGG + Intronic
974977962 4:68915589-68915611 CTTTCATGGGCTGGATGCAGTGG - Intergenic
975847858 4:78543899-78543921 CTTTTATATGCTGGCTGTGAAGG + Intronic
981199610 4:141965547-141965569 CTTTTATGATCTGGTTGTGCAGG - Intergenic
982845854 4:160251729-160251751 CTTTTATGTGTGTGTTGGAGGGG - Intergenic
984934131 4:184875014-184875036 GTTTTATGGGCTGGGTATAGTGG - Intergenic
985470933 5:45308-45330 CTTTTAAGTACTGGAAGTAGAGG - Intergenic
986766902 5:10936408-10936430 CTTTTATGTTTTGGATGTTGGGG + Intergenic
987622483 5:20353462-20353484 CTTTTTTGAGCTTGTTCTAGGGG - Intronic
990202248 5:53389585-53389607 ATTTTTAGTGGTGGTTGTAGGGG - Intergenic
990372082 5:55130501-55130523 CTTTTAAATGCTGGGGGTAGGGG + Intronic
993966776 5:94368878-94368900 CTATTATGGGCTGGTTATGGTGG + Intronic
995447556 5:112262579-112262601 TGTTTTTGTGCTGGGTGTAGGGG - Exonic
998334398 5:141357900-141357922 CTTTTCTGTGCTGGGTGTGGTGG + Intronic
999624830 5:153509449-153509471 CTTTTTTGTGCTGCTTTTATTGG + Intronic
1000248134 5:159467224-159467246 AGTTTATGTTCTGGTTGTAGAGG + Intergenic
1002588847 5:180273512-180273534 CATTTATCTGCTGGATGTGGTGG - Intronic
1003438758 6:6120723-6120745 CTGTTATGGGCTGCTTGTGGGGG - Intergenic
1006541240 6:34741571-34741593 CTTTTTTGGGCTGGGTGCAGTGG + Intergenic
1008595395 6:53036701-53036723 CTTTTTTGGGCTGGGTGTGGTGG - Intronic
1010004546 6:70981175-70981197 CTTTTATGGCCTGGCTGTGGAGG + Intergenic
1010004578 6:70981275-70981297 CTTTTATGGCCTGGCTGTGGAGG + Intergenic
1012034103 6:94109539-94109561 CTGTTAAGTACTGCTTGTAGTGG - Intergenic
1012247603 6:96943290-96943312 CCTTTAAGAGCTGGTTCTAGAGG - Intronic
1012627139 6:101418173-101418195 CTTTTCTGTGCTGGTTGGCTTGG + Intronic
1013558576 6:111282339-111282361 AATTTATGTGATGGTTGTATTGG + Intergenic
1014399671 6:120972383-120972405 CTTTTTTGAGCAGGCTGTAGTGG - Intergenic
1015864418 6:137713163-137713185 GTTTATTGGGCTGGTTGTAGAGG + Intergenic
1016837809 6:148496602-148496624 CTTTTATTGGCTGGGTGTGGTGG + Intronic
1017576138 6:155806668-155806690 CTTTTATTGGCTGGTTCAAGTGG - Intergenic
1018704459 6:166452910-166452932 CTTTTAAGGGCTGGGTGCAGTGG + Intronic
1020996855 7:15277018-15277040 TTTTTATTTGCTGGGTGTGGTGG + Intronic
1025248620 7:57336803-57336825 CTTTTATGTGATAGTTATGGAGG - Intergenic
1026916827 7:74125269-74125291 CTTGTATTGGCTGGGTGTAGTGG - Intergenic
1027176944 7:75910336-75910358 TATTTATGAGCTGGGTGTAGAGG + Intronic
1027352892 7:77329795-77329817 CTTCTATGTGTTGATTGTGGTGG - Intronic
1028153179 7:87399185-87399207 CTTTTTTGGGCTGGGTGCAGTGG + Exonic
1029051153 7:97689282-97689304 CTTTTGTGGGCTGGGTGCAGTGG + Intergenic
1030729378 7:112967430-112967452 CTCTTACATACTGGTTGTAGAGG - Intergenic
1032913762 7:136463340-136463362 CTTTTCTGTGTTGATTGTTGTGG + Intergenic
1033082944 7:138314945-138314967 GTCTTCTGTGCTGGTTGTTGGGG - Intergenic
1037431565 8:18818688-18818710 CCTTTTTTTGCTGGTTGTTGGGG - Intronic
1038659479 8:29484620-29484642 CTTTTAAGTGCCGGGTGTACAGG + Intergenic
1041019868 8:53627688-53627710 CTTTTATTTGATGTTTTTAGAGG - Intergenic
1046125330 8:109899729-109899751 CCTTTCTGTGCTTGTTGTGGGGG + Intergenic
1048534019 8:135275732-135275754 CTTTTATTTTCTGGGAGTAGGGG - Intergenic
1049086918 8:140485949-140485971 CCTTTATGGGCTGGATGTGGTGG + Intergenic
1050157091 9:2679239-2679261 TTATTAGGTGCTGGTTGCAGAGG - Intergenic
1050228451 9:3489396-3489418 CTTTAAAGTACTGTTTGTAGTGG + Intronic
1050629303 9:7541922-7541944 CTTCTGTCTGCTGGTTGCAGAGG - Intergenic
1051197412 9:14577449-14577471 CACTTGGGTGCTGGTTGTAGTGG - Intergenic
1054810307 9:69429040-69429062 CCGTTATGTGCAGGTTGTACAGG + Exonic
1057262921 9:93596093-93596115 CTTCTGTGTGCTGGGTCTAGTGG + Intronic
1057572349 9:96214310-96214332 GTTTTGTATGGTGGTTGTAGTGG - Intergenic
1057984196 9:99692955-99692977 CTTTTAGGGGCTGGATGTGGTGG - Intergenic
1057984828 9:99702420-99702442 GTTTTGTGTGGTGGTGGTAGTGG + Intergenic
1058802337 9:108556862-108556884 CTTTTATGTGCCAGCTGTAGAGG - Intergenic
1185651363 X:1650305-1650327 CTTTTATGGGCCGGGTGTGGTGG - Intergenic
1186425735 X:9463944-9463966 ATTTGTTGTTCTGGTTGTAGGGG - Intronic
1186607163 X:11104348-11104370 ATTTCATGTGGTGGTGGTAGAGG + Intergenic
1188001030 X:24982027-24982049 CTTTTGCGTGGTGGTTGGAGTGG + Intronic
1188707895 X:33357823-33357845 CTTGTATGTGCTGGCAGCAGTGG - Intergenic
1193123977 X:77851802-77851824 CGTTTATGGGCTGGGTGTGGTGG - Intronic
1194255985 X:91634650-91634672 CTGTTATGTGCTAGTTGGAATGG - Intergenic
1195537067 X:106021237-106021259 ATTTTATGGGCTGGGTGTGGTGG + Intergenic
1196483866 X:116181682-116181704 CTTTTCAGTCCTGGTTGCAGGGG - Intergenic
1196671809 X:118376223-118376245 CATTTATGGGCTGGGTGCAGTGG - Intronic
1198146536 X:133863175-133863197 GTTTTATTTGCTGTTTCTAGGGG - Intronic
1199106006 X:143869205-143869227 CTTTTCTGTTGTGGTTGTGGTGG - Intergenic
1200574713 Y:4873914-4873936 CTATTATGTGCTAGTTGGAATGG - Intergenic