ID: 906812446

View in Genome Browser
Species Human (GRCh38)
Location 1:48842209-48842231
Sequence TTGCTGGAATGATGGGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 289}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906812446_906812455 30 Left 906812446 1:48842209-48842231 CCCATTTCCCATCATTCCAGCAA 0: 1
1: 0
2: 4
3: 29
4: 289
Right 906812455 1:48842262-48842284 TTTCTTTTTTTTTCTAGGAGAGG 0: 1
1: 0
2: 55
3: 1086
4: 11828
906812446_906812451 -5 Left 906812446 1:48842209-48842231 CCCATTTCCCATCATTCCAGCAA 0: 1
1: 0
2: 4
3: 29
4: 289
Right 906812451 1:48842227-48842249 AGCAATCTCATCTTTTGAAATGG 0: 1
1: 0
2: 1
3: 34
4: 319
906812446_906812453 25 Left 906812446 1:48842209-48842231 CCCATTTCCCATCATTCCAGCAA 0: 1
1: 0
2: 4
3: 29
4: 289
Right 906812453 1:48842257-48842279 TCCTTTTTCTTTTTTTTTCTAGG 0: 1
1: 18
2: 409
3: 3560
4: 26834

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906812446 Original CRISPR TTGCTGGAATGATGGGAAAT GGG (reversed) Intronic
902846643 1:19115974-19115996 TTGCTGTCAGGATGGGAACTTGG - Intronic
904984142 1:34530681-34530703 TTGCTGGAAAGATGGAAAGGTGG + Intergenic
905509312 1:38505977-38505999 GTGGTGGGAAGATGGGAAATTGG + Intergenic
905509627 1:38508579-38508601 TTGCTGGAGACAAGGGAAATTGG + Intergenic
906064341 1:42969400-42969422 GTGCTGGGATTATGGGAAAAAGG + Intergenic
906812446 1:48842209-48842231 TTGCTGGAATGATGGGAAATGGG - Intronic
906971582 1:50520208-50520230 TTCCTGGGATGATAGGTAATTGG + Intronic
907476834 1:54711389-54711411 CTGCTGGTAAGATGGTAAATTGG + Intronic
908717587 1:67086974-67086996 TTGCAGGAGTGATGGGGATTGGG + Intergenic
910340809 1:86184802-86184824 TTGCAGGAATGGTGGGGGATGGG - Intergenic
911157707 1:94653384-94653406 TTGATGGATTGATGGAAAGTGGG - Intergenic
912457867 1:109810604-109810626 TTGGTGGGTTGATGGGAAACTGG - Intergenic
914718397 1:150269393-150269415 TTACTTGAATGAGAGGAAATGGG + Intronic
916909024 1:169324354-169324376 TTGCTTGAATGTTGGCAAAGGGG - Intronic
918241682 1:182625886-182625908 TTGCTTGAATGAAGGGAAATAGG - Intergenic
920112957 1:203599885-203599907 TGGTTGGACTGATGGGACATGGG - Intergenic
920212007 1:204335250-204335272 TTCCTGGATTGGTGGGGAATGGG - Intronic
920605778 1:207383350-207383372 TTGGTGGGGTGATGGGAAAGGGG - Intergenic
920962880 1:210679842-210679864 TTGCTGGAAGGCTGCTAAATGGG + Exonic
921745553 1:218736501-218736523 TTGTTGGAAGGATAGGAAGTAGG - Intergenic
921747277 1:218752797-218752819 TTGCTGGACTGAAGGGGACTGGG - Intergenic
924093393 1:240525372-240525394 TTTCTGGAATGAAGGGAAATGGG + Intronic
924228141 1:241939876-241939898 ATTCTAGAAAGATGGGAAATGGG + Intergenic
1062768697 10:83517-83539 TTGCTGGAGTAAGGGGACATGGG - Intergenic
1063133487 10:3197436-3197458 TTCCTGGACTGCTGGGAAAGCGG - Intergenic
1063850726 10:10186963-10186985 TTGCAGGAATGAGAGAAAATCGG - Intergenic
1063952472 10:11236902-11236924 GTGATGGAATAATGCGAAATAGG + Intronic
1064012908 10:11749735-11749757 TTGCTGGATTGCTGGGATAAAGG - Intronic
1064035620 10:11911272-11911294 TGGCTGAAAAGATGGGAATTTGG - Intergenic
1066031862 10:31435746-31435768 TTGCAGGAATGATGGAACAATGG + Intronic
1067246297 10:44549276-44549298 TGCCTGGCAAGATGGGAAATTGG + Intergenic
1070190959 10:74111877-74111899 TGGCGGGAAGGATGAGAAATAGG - Intronic
1070995278 10:80773476-80773498 TTGCAAGAATGTTGAGAAATGGG - Intergenic
1070997037 10:80793881-80793903 TTGCTAGGCTAATGGGAAATAGG - Intergenic
1073879526 10:107964564-107964586 TTGCTGGAATGGTTAGAAACTGG - Intergenic
1073994303 10:109297573-109297595 TAGATGGAAAGATGGGAAATGGG - Intergenic
1074282843 10:112069575-112069597 TTTCTGGAATTTTTGGAAATTGG + Intergenic
1074786581 10:116847532-116847554 TTTCAGGAATAATGAGAAATAGG - Intergenic
1074836416 10:117300227-117300249 TTTCTGGAATAATAGGAATTAGG - Intronic
1075053628 10:119201863-119201885 TTGCTGTAGTGATGGGAGTTTGG + Intergenic
1079066315 11:17296986-17297008 TGGCTGGAATTATGTCAAATAGG - Intronic
1079869285 11:25776412-25776434 TTTCTGGAATCATGGGAACATGG + Intergenic
1080400013 11:31925623-31925645 TTGCTGGAATAATGGGAAAGAGG - Intronic
1080942106 11:36930463-36930485 TTTCTGGAATGATCTCAAATGGG - Intergenic
1081304070 11:41489981-41490003 ATGCTGGAATGATCAGAAAGGGG + Intergenic
1081417051 11:42828358-42828380 TTGATGGAAAGATGGGTTATAGG + Intergenic
1085012951 11:73154020-73154042 TTTCTGGAATGGTGGGCACTGGG - Intergenic
1085077758 11:73606878-73606900 ATGTTTGAATGATGGGAGATAGG + Intergenic
1086328136 11:85725405-85725427 TTTCTGGAAAGCTGGGAAGTTGG + Intronic
1086435547 11:86776656-86776678 AGGCTGGAAGGAGGGGAAATGGG - Intergenic
1087838837 11:102902182-102902204 TTGCTGGTAGGATTGTAAATTGG + Intergenic
1088153138 11:106772183-106772205 ATCCTGTAATGATGGGAAATAGG - Intronic
1088661106 11:112047102-112047124 ATGCTGGAATGTGGAGAAATAGG - Intronic
1088924969 11:114292797-114292819 ATGATGGAGTGAGGGGAAATGGG + Intronic
1088926413 11:114307681-114307703 TGGCTGGATTGTGGGGAAATAGG - Intronic
1089682687 11:120128167-120128189 TTGCTGGGATAATATGAAATGGG + Intronic
1090874575 11:130777539-130777561 GGGCTGGAAGGAGGGGAAATGGG - Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091657836 12:2358779-2358801 TTGCTGGAAACTTGGGAAAGTGG - Intronic
1091737503 12:2935191-2935213 TGGCTAGAATGATGGGAAGGAGG - Intronic
1092266778 12:6987346-6987368 TGGCTGAGATGATGGGATATAGG + Intronic
1092545609 12:9448864-9448886 TTCCTGGAATGACAGGTAATTGG + Intergenic
1093491470 12:19709856-19709878 TTTCTGGAAGGATAGGAAAAAGG + Intronic
1093804453 12:23415214-23415236 TTGATGAAATGATGGGATAGTGG + Intergenic
1094507344 12:31073187-31073209 TTCCTGGAATGACAGGTAATTGG - Intergenic
1094702504 12:32883757-32883779 TAGCTGGAATTACGGGAAACAGG - Intronic
1096366604 12:51033541-51033563 TTGCTGGAACTATAGGAAAAAGG - Intergenic
1097917841 12:65039234-65039256 TTGCTGGTATTCTGGGATATGGG + Intergenic
1098369009 12:69738376-69738398 TTGCTGGAATGATGGGATCTGGG + Intergenic
1099557429 12:84128144-84128166 TTGCTGGCTTGATGGTAAAGAGG - Intergenic
1100257300 12:92897219-92897241 TTTCTGCACAGATGGGAAATTGG + Intronic
1100478878 12:94959163-94959185 TAGATGGAATGAAGGGAACTGGG - Intronic
1100515356 12:95322370-95322392 ATGCTGGAGTGAGGGGAAAATGG - Intergenic
1100691809 12:97046409-97046431 ATGGTGGAATGGTGGGAGATGGG - Intergenic
1102445983 12:113003127-113003149 TTGTTGGAATGATGTAATATTGG + Intronic
1102853006 12:116268611-116268633 TTGCTGGGAGGAGGGGAGATAGG - Intronic
1103257345 12:119553347-119553369 GTGCTGGAATAATGAGAAAAGGG - Intergenic
1104078187 12:125408815-125408837 TTGCTGGAATGAGTGTAATTTGG - Intronic
1107422038 13:40256253-40256275 GTACTGGAATATTGGGAAATAGG + Intergenic
1107422128 13:40257197-40257219 TTGTTGGACTGATTGCAAATTGG - Intergenic
1107460079 13:40593441-40593463 ATCCTGGAATGATTGTAAATTGG - Intronic
1108212567 13:48153034-48153056 CTGTTGGAAGGATGGGAGATGGG - Intergenic
1108823716 13:54386061-54386083 TTGCAGGAATGTTTGGAAACTGG - Intergenic
1109578617 13:64295796-64295818 TTGCAGAAATGCTGGTAAATAGG - Intergenic
1112995200 13:105566295-105566317 TTACTGGAATGAAGGGTAACTGG - Intergenic
1113379957 13:109795199-109795221 TTGCCAGAATGTTGGGAAACAGG + Intergenic
1114293427 14:21307534-21307556 TGGCTGGCGTGATGAGAAATGGG + Intronic
1116776481 14:49187965-49187987 TTGCCAGAATCATGGTAAATAGG + Intergenic
1117558550 14:56911413-56911435 TTGGTGGAATGATGGGGCATGGG + Intergenic
1118297889 14:64587071-64587093 TTTCAGGAATATTGGGAAATTGG + Intronic
1119439501 14:74618852-74618874 GTCCTGCAATGATGGGAAATGGG + Intergenic
1119984805 14:79125437-79125459 TGGATGGACTGATGGGAAATAGG + Intronic
1121084300 14:91133739-91133761 TTGCTGGTGTGATGGTAAAATGG - Intronic
1121181182 14:91930313-91930335 TTGCTGGGATGATGGGCAAGTGG - Intronic
1121419112 14:93799767-93799789 TTGAAGGAATGAATGGAAATAGG + Intergenic
1122219074 14:100223904-100223926 GGGCTGGAATGCTGGGAAAGTGG + Intergenic
1122840283 14:104458459-104458481 TTGCTGGAAGGAGTGTAAATTGG + Intergenic
1124071381 15:26396269-26396291 GTGCTGGACTGGAGGGAAATTGG + Intergenic
1125063021 15:35447183-35447205 TTTCTGGAGAGAAGGGAAATTGG - Intronic
1126321597 15:47430175-47430197 TTGGGGGAATGATGTGAAGTGGG - Intronic
1126424111 15:48507261-48507283 TTGCTGGAATATTTGGAATTAGG - Intronic
1128321026 15:66694460-66694482 TTGCTGCAGGGAGGGGAAATTGG + Intergenic
1128457460 15:67840267-67840289 ATGAAGGAATCATGGGAAATAGG + Intergenic
1128565024 15:68695365-68695387 TTGCTGGAAAGATGACAAAGAGG - Intronic
1131037929 15:89237065-89237087 TTGCTACTATGATAGGAAATGGG - Intergenic
1135030070 16:19031142-19031164 TTTCTTAAATGGTGGGAAATAGG + Intronic
1135205810 16:20482986-20483008 CTCCTGGAATAATGTGAAATTGG - Intronic
1136517136 16:30774965-30774987 TAGCTGGAATGATTGGAAGTTGG - Exonic
1136618439 16:31412498-31412520 TTGCTGGAAAGATGAGCAAACGG + Intronic
1137382588 16:48012877-48012899 TGGCTAGAATGATGGAAGATAGG + Intergenic
1137775325 16:51049221-51049243 TTGATGGAATGAAGGGAAACTGG - Intergenic
1137869622 16:51937457-51937479 TAGAAGGAATGATGGGAAAAGGG + Intergenic
1140240946 16:73199679-73199701 TTTCTGGAATGATGAAAAATTGG + Intergenic
1140709915 16:77667857-77667879 TGGCTGGAATGTGGGCAAATTGG - Intergenic
1146003752 17:29148028-29148050 TTTGGGGAAGGATGGGAAATGGG + Intronic
1146101668 17:29988757-29988779 TTGCTACTATGATAGGAAATGGG - Intronic
1146462192 17:33055069-33055091 TTCCTGGAGTGCTGGGAAAGGGG - Intronic
1146933062 17:36791686-36791708 TGTCTGGAATGATCAGAAATCGG + Intergenic
1147915777 17:43884780-43884802 TAGAAGGAATGATGGGAATTAGG - Intronic
1148738135 17:49876222-49876244 GTGCTGGAATAAAGGGAAAAGGG - Intergenic
1155501015 18:26486855-26486877 TTGCTGGCATGATTGCAAGTGGG - Intronic
1156056938 18:33017319-33017341 TTGTTGGAATGATGGTATTTGGG - Intronic
1156063173 18:33106250-33106272 TTGCAGGAAGGAAGGAAAATAGG - Intronic
1156193941 18:34751710-34751732 TTTCTGGAATGATCTGAAATAGG - Intronic
1156553680 18:38044028-38044050 TTGCTTTACAGATGGGAAATAGG - Intergenic
1156953379 18:42932305-42932327 TTGATGGATTGATTGGAAAAGGG - Intronic
1158260425 18:55600320-55600342 TTGCTGGTATGATTGCAAATTGG - Intronic
1158938790 18:62388246-62388268 TGGCTGGAAGGATGGGAGACAGG - Exonic
1159605855 18:70474136-70474158 TGGCTGGAATGCTGGGAGAGAGG - Intergenic
1162138445 19:8570630-8570652 GTGCTGGAATGACGGGCACTGGG + Intronic
1162252539 19:9458087-9458109 TTGCTACTATGATAGGAAATGGG + Intergenic
1162393287 19:10402619-10402641 TTCCTGGTATAATGGGAAATGGG + Intronic
1164435144 19:28222328-28222350 CTGCTGGGAAGATGGGAAACTGG - Intergenic
1164489077 19:28690343-28690365 TGGCTGGCATGATGGGAATGGGG - Intergenic
1164744647 19:30602148-30602170 TTGATGCAATGATGAGGAATAGG + Intronic
1165865863 19:38937856-38937878 TTGCTACTATGATAGGAAATGGG - Intronic
1165866724 19:38943964-38943986 TTCCTGGGGTGATGGGAATTAGG - Intronic
1166761356 19:45226294-45226316 CTGCTACAATGATAGGAAATGGG + Intronic
1166778604 19:45327750-45327772 TGGCTGGGGTGATGGGAGATGGG - Intergenic
1168265461 19:55221357-55221379 TTGCTGGCAGGATGGTAAACTGG + Intergenic
925403040 2:3589315-3589337 ATGCTGGCATGAGGGGAAACAGG - Intergenic
926174799 2:10581194-10581216 TTGCTGGAGTGTGGGGAAACAGG + Intronic
926683128 2:15678988-15679010 TTCCTGGAAGGAGGGGAAAATGG - Intergenic
927233382 2:20847403-20847425 TTCCTTGAATAAAGGGAAATTGG + Intergenic
927762450 2:25771490-25771512 CTGCTGGAATGGTGGGTGATGGG + Exonic
927969059 2:27292715-27292737 TTGCTGGAAGGAGGGGGAGTAGG - Intronic
930116782 2:47724969-47724991 TTGCAGGAATAGTGGGAGATAGG + Intronic
930122506 2:47771388-47771410 CTGCTGGAAGGATGAGGAATGGG - Intronic
931228367 2:60352998-60353020 TTGCTGTAATGATGGGAGGGAGG - Intergenic
931320361 2:61169813-61169835 TTGGTGGAATCATGATAAATAGG - Intergenic
931827092 2:66012326-66012348 TGGCTGGAATTGTGGGAAAGAGG + Intergenic
932431516 2:71677714-71677736 TTGCTGGTGTGCTGGGACATTGG + Intronic
933177771 2:79195207-79195229 TTGCTGCCATGATGTGAAAGAGG - Intronic
935431259 2:102978322-102978344 GTGCTGAAATGCAGGGAAATTGG - Intergenic
935982700 2:108643200-108643222 TTGTTGGCAAGATGGCAAATAGG + Intronic
937147004 2:119656060-119656082 TTGCTACAATGCTGGGAGATGGG + Intronic
937494831 2:122406975-122406997 TTTGGGTAATGATGGGAAATTGG + Intergenic
937548222 2:123052004-123052026 TTGCTGGAATTAGAGGAAAGAGG + Intergenic
938565840 2:132517779-132517801 TTCTTGGAAAGATGGAAAATCGG + Intronic
938660139 2:133478201-133478223 TTGCTGGCATGATTGGAACCAGG - Intronic
939679144 2:145108908-145108930 TTGCTGGAAAGATTGGCAATGGG + Intergenic
939980309 2:148772597-148772619 TTGTTTGAATGATTAGAAATTGG + Intronic
940014722 2:149092143-149092165 AAGCTGGAAAGATAGGAAATGGG + Intronic
943757121 2:191568473-191568495 TTTCTGAAAAGTTGGGAAATGGG + Intergenic
943973172 2:194437467-194437489 TTGATGGATTGATGGGCAATTGG + Intergenic
945703569 2:213201011-213201033 TTCCTGGGATGAGGGGAAAGAGG + Intergenic
945981876 2:216318736-216318758 TTGCTGTCATGATGGGACTTTGG + Intronic
946435667 2:219651028-219651050 TTGCTAGAAGGCTGGGAAAGAGG + Intergenic
946493351 2:220171289-220171311 TTCCTTGAATGGTGGCAAATTGG + Intergenic
948202176 2:236137090-236137112 TAGCAGGGATGATGGGAACTTGG + Intergenic
948386501 2:237584068-237584090 TTGCTGGAATGAAAGGAACTAGG + Intronic
1170175891 20:13469448-13469470 TTACTGGAATCAGTGGAAATGGG - Intronic
1170333193 20:15237956-15237978 GTGCTAGAATGATGAGAACTGGG + Intronic
1170360425 20:15540187-15540209 TTGCTTGAATGTGGGGAAGTAGG + Intronic
1171408207 20:24928113-24928135 TTACTGGAATGAGGGGGACTGGG + Intergenic
1174213737 20:48900193-48900215 CTGCAGGAATAATGGGAAAAGGG - Intergenic
1174418215 20:50381870-50381892 TTGCTGGAATCCTGGGATTTGGG - Intergenic
1174943072 20:54953870-54953892 GTGCTGTAAAGATGGGAGATGGG - Intergenic
1176149178 20:63580605-63580627 TCTCTGGAAAGATGGGAACTGGG + Intergenic
1179278144 21:39910456-39910478 TTAATGGACTGGTGGGAAATTGG - Intronic
1180681508 22:17630246-17630268 TTGATGGATTGATGGGACAAAGG - Intronic
1180800236 22:18628335-18628357 TTCCTGGAATGATGGGCAAGAGG + Intergenic
1180818639 22:18809517-18809539 TGGCAGGAGTGATGGGAAAGGGG + Intergenic
1180851468 22:19023899-19023921 TTCCTGGAATGATGGGCAAGAGG + Intergenic
1181204862 22:21243972-21243994 TGGCAGGAGTGATGGGAAAGGGG + Intergenic
1181221480 22:21366931-21366953 TTCCTGGAATGATGGGCAAGAGG - Intergenic
1182380349 22:29882958-29882980 TGGCTAGACAGATGGGAAATGGG - Intergenic
1183694182 22:39411081-39411103 GTGTTGGAATGATTGGATATTGG + Intronic
1183920183 22:41160172-41160194 TTGCTGAAATGAAAGGATATGGG + Intronic
1185248375 22:49785695-49785717 TTGATGGATTGATGTTAAATTGG - Intronic
1203222063 22_KI270731v1_random:51443-51465 TGGCAGGAGTGATGGGAAAGGGG - Intergenic
1203268768 22_KI270734v1_random:35370-35392 TGGCAGGAGTGATGGGAAAGGGG + Intergenic
950673004 3:14538363-14538385 TTGCTGGAACTACTGGAAATAGG + Intronic
951429424 3:22588903-22588925 CTGCTGAAATGATGGGGCATGGG - Intergenic
951833170 3:26952493-26952515 TTGAAGCCATGATGGGAAATGGG - Intergenic
952492498 3:33885727-33885749 TTGGTGGAATGATGTGGACTGGG + Intergenic
955003721 3:54950544-54950566 TTGCTGGTAGGCTGGGAAACAGG - Intronic
955095855 3:55797192-55797214 TTGCTGGGCTCATAGGAAATAGG + Intronic
955965519 3:64385304-64385326 TTACTGCACTCATGGGAAATTGG + Intronic
956983523 3:74668895-74668917 GTTTTGGAATCATGGGAAATCGG + Intergenic
957761718 3:84567377-84567399 TTGCTGGAAAGGAGGTAAATTGG - Intergenic
957768803 3:84660834-84660856 TTGCAGGTATCATGAGAAATTGG - Intergenic
959344191 3:105172403-105172425 TTTCTAGAATGATGGGTGATAGG - Intergenic
960360269 3:116702642-116702664 TTGCTGAAATAAAGGGAAAGGGG + Intronic
961859540 3:129904248-129904270 TTGCTACTATGATAGGAAATGGG + Intergenic
962876121 3:139537438-139537460 TGTTTGGAATGATGGGAAAGAGG - Intronic
963311171 3:143711782-143711804 TTGCTGGAGTGGTGAGAAACAGG - Intronic
964428905 3:156583069-156583091 TTGGTGGAAGACTGGGAAATTGG - Intergenic
964985724 3:162735242-162735264 TTTCAAGTATGATGGGAAATGGG + Intergenic
965314965 3:167180006-167180028 TTGCTACTATGATAGGAAATGGG - Intergenic
965424920 3:168510628-168510650 TGGCTGGGATGTTGGGAAAGTGG + Intergenic
965806157 3:172544528-172544550 CTGCTGGAAAGATGACAAATTGG - Intergenic
966288599 3:178327510-178327532 TTGTTGGGATAATGGGAAAGAGG - Intergenic
966370678 3:179248092-179248114 TTGCTGAAATGAGGGGAATGGGG - Intronic
966968062 3:185015819-185015841 TTGCTACTATGATAGGAAATGGG - Intronic
966984244 3:185165106-185165128 TTAGTGGTATGAAGGGAAATTGG + Intergenic
967920332 3:194609563-194609585 TTGGTGGAATAGTGGGACATGGG + Intronic
969929148 4:10613301-10613323 TTGCTGGAAAGATGGGAACAGGG + Intronic
969937500 4:10696723-10696745 AGGCTGGAATGAGGGCAAATGGG - Intergenic
970135104 4:12913487-12913509 CTGCCCGAATAATGGGAAATGGG - Intergenic
970169472 4:13275453-13275475 TTGTGGGAAAGATGGGAGATGGG - Intergenic
970559588 4:17269553-17269575 TTGGTGGAAGGAAGGGAAAGGGG - Intergenic
971565636 4:28137163-28137185 TTGCTTGTGTGAGGGGAAATTGG - Intergenic
972830156 4:42805662-42805684 TTGGTGGAATGATAGCAAATGGG - Intergenic
973008266 4:45041300-45041322 TTTGTGGACTGATGGGAAAAAGG + Intergenic
973008778 4:45046012-45046034 TTGCTACTATGATAGGAAATAGG + Intergenic
974153864 4:58044912-58044934 TTCCTGGAAAGATGAGAAAAAGG - Intergenic
975491747 4:74996580-74996602 CAGCTGGAATGATGGGAGCTGGG + Intronic
977642254 4:99370145-99370167 TTGCTACTATGATAGGAAATGGG + Intergenic
978094661 4:104761404-104761426 CAGCAGGAATGAAGGGAAATGGG - Intergenic
978181881 4:105808021-105808043 TTGTTAGAATGATGGGACAGAGG - Intronic
979524764 4:121705401-121705423 TTGATTGAATCATGGGCAATTGG + Intergenic
979871833 4:125833036-125833058 ATTTTGTAATGATGGGAAATGGG - Intergenic
980720211 4:136685983-136686005 CTGCAGGAATTATGGGGAATGGG + Intergenic
981513526 4:145583098-145583120 TTGTTGAAATGATTGGAAAGGGG + Intergenic
982445641 4:155487625-155487647 CTGCTGTACTGATGGGGAATGGG + Intergenic
983631966 4:169858539-169858561 TTGCTGAAATGATAGTAACTAGG + Intergenic
984258856 4:177419967-177419989 TTGGTGGAATGATGGAGAATAGG - Intergenic
984845863 4:184107251-184107273 TTGCTTCAAGGATAGGAAATGGG - Intronic
985269159 4:188177909-188177931 TTGCAGCAATGATGGGAGCTAGG - Intergenic
985501130 5:246815-246837 TTGCTACTATGATAGGAAATGGG + Intronic
985735735 5:1580624-1580646 TTGCTACTATGATAGGAAATGGG - Intergenic
987422512 5:17737177-17737199 TTGCTGGAAGGTTGGAATATTGG - Intergenic
988714923 5:33815978-33816000 TTGTTTGAAGGATGGCAAATTGG - Intronic
989612903 5:43312842-43312864 TTGATGGAAAGAAGGGAAGTGGG - Intronic
991489010 5:67165496-67165518 TTTCTGCAAAGATGGGAAACTGG - Exonic
991983794 5:72261784-72261806 ATGCTGGAATGTGGGGTAATGGG - Intronic
992030499 5:72716625-72716647 TTCCTAGAATGATAGGAAATGGG - Intergenic
992759467 5:79938811-79938833 TTGGTGGAATGTTAGCAAATGGG - Intergenic
993113026 5:83683258-83683280 TAACTGTAATGATGGGAATTTGG - Intronic
994953201 5:106492750-106492772 TTGCAGGAATGTGGGGAAGTAGG + Intergenic
995194326 5:109346744-109346766 GGGCTGGAAAGATGGGAAAATGG + Intronic
995648519 5:114341266-114341288 GTGCTGTAAAGAAGGGAAATTGG + Intergenic
995791335 5:115891460-115891482 TTGATTGAGTGATGGTAAATTGG + Intronic
995906898 5:117135603-117135625 GTGCTGGAAAGATAGAAAATTGG - Intergenic
997286601 5:132683904-132683926 TTGCTGGAGTGATTGAAAAATGG + Intergenic
1000983969 5:167846960-167846982 TTGATTGATTGATTGGAAATGGG + Intronic
1002258550 5:177978100-177978122 GTGCTGGAAAGATGGGACATGGG + Intergenic
1002501314 5:179649446-179649468 GCGCTGGAAAGATGGGACATGGG - Intergenic
1002914770 6:1520130-1520152 TTGCTGAAATGATGGCAACTGGG - Intergenic
1003433663 6:6065604-6065626 TTGCTACTATGATAGGAAATGGG - Intergenic
1003469386 6:6415113-6415135 TTGATGAAATGATGAGAAATTGG - Intergenic
1006092996 6:31639264-31639286 TTGCTGGGATCATGGGGACTTGG - Intronic
1006990993 6:38214637-38214659 TTGCTGGTTTGAGGGGAATTAGG - Intronic
1007252079 6:40502558-40502580 TTCCTGGAACGATGGGGAATTGG + Intronic
1007886764 6:45238723-45238745 TTGCTACTATGATAGGAAATGGG + Intronic
1008252347 6:49255787-49255809 CTGCTGGAATCAAGGGAATTTGG - Intergenic
1008641411 6:53466298-53466320 TTTCTGGAGTGATGAGAAAGGGG + Intergenic
1008886241 6:56433431-56433453 TAGTTGGAGTGATGAGAAATAGG + Intergenic
1009418944 6:63443759-63443781 CTGGTGGAATGAGGAGAAATGGG + Intergenic
1011714700 6:90093040-90093062 TTGCTGGACTGAGGGGAGGTTGG + Intronic
1011885422 6:92089025-92089047 TTGCTAGAATGAGGAGATATGGG - Intergenic
1012174452 6:96062980-96063002 TTGCTGGAATGATGTGGAGCAGG + Intronic
1012432657 6:99182110-99182132 TAGCTGGCATGATAGGAAACAGG - Intergenic
1013091324 6:106903284-106903306 TCGCTGGAAGGAAGGGAAGTTGG - Intergenic
1013924968 6:115461202-115461224 TTGCTGAAGAGATGGGAAAATGG - Intergenic
1015503650 6:133959303-133959325 GTGCTGGGATTATGGGCAATGGG + Intronic
1016006812 6:139097403-139097425 TTCCTGGAATAATTGAAAATTGG - Intergenic
1016334479 6:142989598-142989620 GTGCTGGGATTATAGGAAATGGG + Intergenic
1017986934 6:159452376-159452398 TTGCATGAAGGATGGGAAAATGG - Intergenic
1019626029 7:2016062-2016084 TTGTTGATAAGATGGGAAATGGG + Intronic
1019694971 7:2440507-2440529 TTCCTGGGATGATGGGAACTGGG + Intergenic
1020484564 7:8705372-8705394 TTTCTGGCAGGATGGGACATGGG + Intronic
1026335116 7:69387561-69387583 CTGCTTGAAGGATGGGAAAAGGG + Intergenic
1026613847 7:71884358-71884380 TTGATGGAAGGAAGGGAAACAGG - Intronic
1027555000 7:79653062-79653084 TTGCTGGCATGTTGGAAATTTGG - Intergenic
1029366300 7:100118759-100118781 GTGCTGGAAGGATGGGAAGAGGG + Intronic
1032294204 7:130621111-130621133 AGACTGGAATGATGGGAAAGGGG + Intronic
1032453095 7:132051592-132051614 TGGTGGGAATGAAGGGAAATAGG - Intergenic
1033403455 7:141049520-141049542 TTTCTGAAAATATGGGAAATAGG + Intergenic
1034505162 7:151483327-151483349 TTTCTGGAATCTGGGGAAATTGG - Intronic
1034782583 7:153894466-153894488 TTCCTGGGATGATGGGAGAAAGG + Intronic
1037973753 8:23193795-23193817 TTGCTAGAGTCATGGGAAATTGG + Intronic
1038652111 8:29414171-29414193 CTGCTGGAAAGATTGTAAATTGG - Intergenic
1041603339 8:59749826-59749848 TTGCTGGAAAGAGTGTAAATTGG + Intergenic
1041802730 8:61817230-61817252 ATGCTGGAGGGAAGGGAAATTGG + Intergenic
1041885132 8:62799793-62799815 TTGGTGGATTGATGGGCATTTGG - Intronic
1045252775 8:100495472-100495494 TTGCCCGAATTAGGGGAAATGGG + Intergenic
1045827710 8:106419648-106419670 TTGCTGGATTGTTGGGAGACAGG + Intronic
1045836194 8:106524490-106524512 TTGCTGGACAGTTAGGAAATAGG + Intronic
1048596106 8:135868099-135868121 TTGTTTGAAGGATGGGAAGTTGG - Intergenic
1048664479 8:136645431-136645453 TTGCTGGAAAGGTTGGAAAGTGG + Intergenic
1051126006 9:13806564-13806586 TTGCTGGAAGTATGGGCACTTGG - Intergenic
1053121993 9:35554454-35554476 GTGCTGGCATGATTGGAGATGGG + Intronic
1055429489 9:76229236-76229258 TTGTTGGTATGGTGGGGAATTGG - Intronic
1056187672 9:84151643-84151665 TTCCTTTAATGAAGGGAAATTGG + Intergenic
1058694447 9:107547624-107547646 TTCCTGGAATTTTGGAAAATAGG + Intergenic
1061000958 9:127902484-127902506 TTTCTGGAATGATGGGATCTGGG + Intronic
1062466247 9:136682900-136682922 TAGCTGGGAAGAAGGGAAATGGG - Intronic
1186637226 X:11419521-11419543 TTGCTAGAATGATTTGAAAATGG - Intronic
1186734962 X:12452495-12452517 TTACTGCCATGTTGGGAAATTGG - Intronic
1187825071 X:23326952-23326974 TTACAGGAATGATAGAAAATGGG - Intergenic
1188205645 X:27354463-27354485 TTGCTGGCATGAGTGAAAATAGG - Intergenic
1189164276 X:38844950-38844972 CTGCTGGAATGAAGGACAATGGG - Intergenic
1190566535 X:51735800-51735822 TTACTGGAAAGATAGGAAACAGG - Intergenic
1192455817 X:71274542-71274564 AGGCTGGGAGGATGGGAAATGGG - Intergenic
1193996419 X:88370488-88370510 TGACTGGAATGATGGGATAAAGG - Intergenic
1194208606 X:91040613-91040635 GGGCTGGCAAGATGGGAAATAGG - Intergenic
1197441766 X:126500201-126500223 TTGCTGGTGTGAAGGGAAAATGG - Intergenic
1198273630 X:135080005-135080027 TTCCTGGAAAGATTGGAAAGAGG + Intergenic
1200983884 Y:9286484-9286506 TTACTGGACTGAGGGGAACTGGG - Intergenic
1202126485 Y:21573198-21573220 TTACTGGACTGAGGGGAACTGGG + Intergenic
1202152427 Y:21855648-21855670 TTACTGGACTGAGGGGAACTGGG - Intergenic